An indole diketopiperazine derivative, strain, preparation method and application thereof derived from Aspergillus oceanicola
By isolating and extracting a new isopropylated indole dionepiperazine compound from the fermentation medium of marine fungus Aspergillus sp. WHUF0304, the problem of limited effects of existing anti-tumor drugs was solved, and the significant growth inhibition effect on human pancreatic cancer cells was achieved.
Patent Information
- Application Number
- CN202310218912.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-03
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2043-03-03
AI Technical Summary
Existing anti-tumor drugs have limited effectiveness in treating malignant tumors such as human pancreatic cancer and lack new and effective sources of drugs.
A novel isopropylated indoledionepiperazine compound was isolated and extracted from the fermentation medium of the marine fungus Aspergillus sp. WHUF0304, and a new antitumor drug was developed using the antitumor activity of the compound.
This compound has a significant growth inhibitory effect on human pancreatic cancer MIA PaCa-2 cells, with an IC50 value of 1.366±0.02μM, providing a new way to treat tumors.
Smart Images

Figure CN116354946B_ABST
Abstract
Description
(1) Technical field
[0001] The present invention relates to an indole diketopiperazine derivative, a strain, a preparation method and an application. (2) Background technology
[0002] Marine fungi are a class of spore-forming, eukaryotic microorganisms that live in the ocean. Most fungi inhabit certain substrates, and their distribution in the ocean is primarily determined by the distribution of their hosts. They are found in intertidal zones, high-tide lines, estuaries, shallow-sea beaches, deep-sea sediments, and numerous marine organisms. Marine fungal secondary metabolites are characterized by diverse structures, a broad spectrum of bioactivities, and high levels of activity, making them an important source of marine active natural products. These activities primarily include antibacterial, antitumor, antioxidant, and enzyme inhibitory activities. For example, cephalosporin C, an antibiotic now widely used in clinical practice, was isolated from marine fungi.
[0003] Huquan Gao et al. reported that dihydrocryptoechinulin D, an indole diketopiperazine derivative, was isolated from the fermentation broth of the marine fungus Aspergillus effuses H1. The cytotoxicity of the compound was evaluated and found to be highly active against mouse leukemia cells P388. 50 The value was 1.83 μM.
[0004] The present invention relates to a new isopropylated indole diketopiperazine compound. So far, there are no similar compounds and related patents or literature reports on their activities at home and abroad. (3) Summary of the invention
[0005] The present invention aims to provide a novel indole diketopiperazine derivative represented by formula (I), a preparation method thereof, and an application thereof in the preparation of antitumor drugs. The compound is prepared by fermentation culture of marine fungus (Aspergillus sp.) WHUF0304, has antitumor activity, and provides a new approach for treating tumors.
[0006] The present invention adopts the following technical solutions:
[0007] In the first aspect, the present invention provides an indole diketopiperazine derivative derived from Aspergillus niger represented by formula (I):
[0008]
[0009] In a second aspect, the present invention provides a method for preparing an indole diketopiperazine derivative represented by formula (I), the method comprising the following steps:
[0010] (1) Fermentation culture: The marine fungus (Aspergillus sp.) WHUF0304 is inoculated into a rice culture medium and allowed to ferment at room temperature (25-30°C) for 120 days to obtain a fermentation product; the rice culture medium is prepared by mixing rice and water in a mass ratio of 1:1-10, preferably 1:1.5; the rice can be edible rice, preferably Northeast rice; the fungus (Aspergillus sp.) WHUF0304 is deposited in the China Center for Type Culture Collection, with a deposit date of December 9, 2022, a deposit number of CCTCCNO: M20221920, and an address of Wuhan University, Wuhan, China, with a postal code of 430072.
[0011] (2) Crude extract: The fermented product was stirred and dispersed, and an equal volume of ethyl acetate was added for ultrasonic extraction. The product was filtered, and the filtrate was concentrated under reduced pressure until no liquid condensed, and dried (preferably at 60°C for 5 h) to obtain a crude extract.
[0012] (3) Separation and extraction:
[0013] a. The crude extract was dissolved in ethyl acetate and separated by normal phase silica gel chromatography. The solvent was petroleum ether-ethyl acetate in a volume ratio of 5:1, 2:1, and 1:2, and pure methanol were used as eluents for elution. The elution rate was 10-30 mL / min (preferably 20 mL / min), and the elution volume was 2-6 (preferably 5) column volumes. 500 mL of the effluent was collected in each bottle and subjected to thin layer chromatography (TLC, the developing solvent was petroleum ether-ethyl acetate in a ratio of 2:1, v / v) spot plate monitoring, the effluent with Rf of 0.81-1.0 was combined and recorded as component A; the effluent with Rf of 0.71-0.8 was combined and recorded as component B; the effluent with Rf of 0.61-0.7 was combined and recorded as component C; the effluent with Rf of 0.41-0.6 was combined and recorded as component D; the effluent with Rf of 0.31-0.4 was combined and recorded as component E; the effluent with Rf of 0.21-0.3 was combined and recorded as component F;
[0014] b. Component C was separated by normal phase silica gel column chromatography, with dichloromethane-methanol (60:1, 40:1, 20:1) by volume ratio, and pure methanol was used as the eluent for elution, the elution rate was 10-30 mL / min (preferably 20 mL / min), and the elution volume was 2-6 (preferably 5) column volumes. 400 mL of the effluent was collected in each bottle, and the effluent was monitored by thin layer chromatography (TLC, developing solvent was dichloromethane-methanol 40:1, v / v) spot plate. The effluent with an Rf of 0.91-1.0 was combined and recorded as component C1; the effluent with an Rf of 0.61-0.9 was combined and recorded as component C2; the effluent with an Rf of 0.51-0.6 was combined and recorded as component C3; the effluent with an Rf of 0.41-0.5 was combined and recorded as component C4; the effluent with an Rf of 0.21-0.4 was combined and recorded as component C5;
[0015] c. Component C2 was separated by ODS medium-pressure chromatography using 50% (v / v) methanol-water for 0-10 min, 50-70% (v / v) methanol-water for 10-50 min, and 70-100% (v / v) methanol-water for 50-90 min, all at a rate of 10 mL / min. 30 mL of the effluent was collected in each bottle. The effluent from 50% (v / v) methanol-water was combined and recorded as component C2-1; the effluent from 50-70% (v / v) methanol-water was combined and recorded as component C2-2; and the effluent from 70-100% (v / v) methanol-water was combined and recorded as component C2-3.
[0016] d. Component C2-3 was separated by normal phase silica gel column chromatography, sequentially eluted with petroleum ether-ethyl acetate (2: 1, 1: 1) by volume and pure methanol as eluent, the elution rate was 10-30 mL / min (preferably 20 mL / min), the elution volume was 2-6 (preferably 5) column volumes, 20 mL of the effluent was collected in each bottle, and the effluent was monitored by thin layer chromatography (TLC, developing solvent was petroleum ether-ethyl acetate 1: 1, v / v) spot plate, and the effluent with Rf of 0.81-1.0 was combined and recorded as component Z-1; the effluent with Rf of 0.61-0.8 was combined and recorded as component Z-2; the effluent with Rf of 0.41-0.6 was combined and recorded as component Z-3; the effluent with Rf of 0.31-0.4 was combined and recorded as component Z-4; the effluent with Rf of 0.21-0.3 was combined and recorded as component Z-5;
[0017] e. The Z-1 component collected in step d is then separated by semi-preparative high performance liquid chromatography, isocratically eluted with methanol-water in a volume ratio of 85:15, and the fraction at 15.9 min is collected and concentrated and evaporated to dryness (preferably 40-60° C.) to obtain the indole diketopiperazine derivative represented by formula (I).
[0018] Furthermore, in step (1), the marine fungus (Aspergillus sp.) WHUF0304 is first activated and seed expanded before fermentation, and then the seed liquid is inoculated into the rice culture medium at an inoculum concentration of 5% by volume. The activation and seed expansion are as follows: sp.) WHUF0304 was inoculated into a plate culture medium and cultured in a 28°C incubator for 3-5 days, preferably 3 days, until the colonies matured; spores were inoculated into ISP4 liquid culture medium and cultured in a shaker at 28-30°C and 180-220 rpm for 3-5 days (preferably 28°C and 200 rpm for 4 days) to serve as seed solution; the final concentration of the plate culture medium was as follows: 200 g / L potato, 20 g / L glucose, 15-20 g / L agar, the solvent was water, and the pH was natural; the final concentration of the ISP4 liquid culture medium was as follows: 15 g / L soluble starch, 5 g / L glucose, 5 g / L peptone (meat peptone), 5 g / L yeast powder, 0.5 g / L (NH4)2SO4, 0.5 g / L K2HPO4, 0.5 g / L NaCl, 0.5 g / L MgSO4·7H2O, and 0.5 g / L CaCO3 1g / L, solvent is water, pH 7.2.
[0019] Furthermore, in step (2), the fermented product is stirred and dispersed with a glass rod; the ultrasonic extraction conditions are 70KHz frequency at room temperature for 20 minutes, and the number of extractions is 1-3 times.
[0020] Furthermore, in steps a, b, and d of step (3), the silica gel of the silica gel chromatography column is from Qingdao Ocean Chemical, with a model of 200-300 mesh, a chromatography column height of 50 cm, and an inner diameter of 6, 3, and 2 cm, respectively; and the silica gel height is 30 cm.
[0021] Furthermore, in step (3) c, the ODS medium-pressure chromatographic column and the ODS chromatographic column filler are from Japan YMC Company, the chromatographic column is 20 cm high, the inner diameter is 5 cm, and the ODS filler height is 20 cm.
[0022] Furthermore, the chromatographic column model of the semi-preparative HPLC in step (3) e is Agilent ZORBAXSB-C18 (5 μm, 9.6×150 mm), the HPLC system is Agilent 1260, the detection wavelengths are 220 nm and 254 nm, and the injection volume is 50 μL.
[0023] In a third aspect, the present invention provides the use of an indole diketopiperazine compound represented by formula (I) in the preparation of an anti-tumor drug.
[0024] Furthermore, the anti-tumor drug is a drug against human pancreatic cancer MIA PaCa-2 cells.
[0025] In a fourth aspect, the present invention also provides a marine fungus (Aspergillus sp.) WHUF0304 for preparing the indoledione piperazine derivative shown in formula (I), which is deposited in the China Center for Type Culture Collection, with a deposit date of December 9, 2022, a deposit number of CCTCC NO: M20221920, and an address: Wuhan University, Wuhan, China.
[0026] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: the marine fungus (Aspergillus sp.) WHUF0304 screened by the present invention is easy to culture and survive, and the compound (I) extracted by fermentation of the marine fungus (Aspergillus sp.) WHUF0304 has a novel structure and has cytotoxic activity against human pancreatic cancer PACA. (IV) Description of the accompanying drawings
[0027] Figure 1 : Preparation process of compound of formula (I).
[0028] Figure 2 : High resolution ESI mass spectrum of the compound of formula (I).
[0029] Figure 3 : Proton spectrum of the compound of formula (I).
[0030] Figure 4 : Carbon spectrum of the compound of formula (I).
[0031] Figure 5 : HSQC spectrum of the compound of formula (I).
[0032] Figure 6 : HMBC spectrum of the compound of formula (I). (V) Specific implementation methods
[0033] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:
[0034] The room temperature refers to 25-30°C.
[0035] Example 1: Screening and identification of strain WHUF0304
[0036] 1. Strain screening
[0037] (1) The rhizosphere soil samples of Kandelia candelii from the mangrove forests in Yalong Bay, Sanya, Hainan, China, collected in December 2018, were diluted with sterile water to 10 -1 , 10 -2 , 10 -3Vortex each dilution for 3-5 minutes before proceeding to the next dilution. Use a spreading rod to evenly spread the samples of each dilution gradient onto Martin solid medium and incubate inverted in a 30°C incubator. Perform three replicates for each sample.
[0038] (2) Over the next 1 to 7 days, observe the culture obtained in step (1) and pick out different types of single colonies and repeat step (1) for streaking isolation until a pure single colony is confirmed.
[0039] (3) The different single colonies in step (2) were inoculated on PDA solid culture medium, cultured at 28°C for 24 hours, and the mycelia were cut into pieces. The antibacterial activity was tested by agar block method. Specifically, the mycelia were suspended in sterile water to make 10 -6 A bacterial suspension was inoculated onto PDA plates and incubated at 30°C for 96 hours. Agar blocks were then prepared using a sterile borer and incubated at 30°C for 72 hours. The blocks were then placed on the surface of LB plates inoculated with an indicator bacterium (Escherichia coli CCTCC AB 93154) and incubated at 30°C for 24 hours. The diameter of the inhibition zone was then measured. The positive control drug was kanamycin sulfate, prepared in sterile water at concentrations of 64, 32, 16, 8, and 4 μg / mL. A strain with antibacterial activity equivalent to 32 μg / mL of the positive drug was selected and designated strain WHUF0304.
[0040] (4) A single colony of strain WHUF0304 from step (3) was inoculated onto a slant of PDA solid culture medium and cultured at 28°C for 7 days to obtain spores of strain WHUF0304. The spores were then added with 20% glycerol and stored in a -80°C refrigerator.
[0041] Martin solid medium: sea salt 15 g / L, glucose 10 g / L, peptone 5 g / L, magnesium sulfate 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, red Bengal 0.03 g / L, agar 20 g / L, solvent is double distilled water, pH natural.
[0042] PDA solid culture medium composition: potato extract 5 g / L, glucose 20 g / L, sea salt 15 g / L, agar 20 g / L, solvent is double distilled water, pH 6±0.2.
[0043] LB solid medium composition: sodium chloride 10 g / L, yeast extract 5 g / L, tryptone 10 g / L, agar 20 g / L, solvent is double distilled water, pH 5.0-5.5.
[0044] 2. Identification of strain WHUF0304
[0045] (1) Colony morphological characteristics
[0046] Strain WHUF0304 was inoculated into MEA solid medium and cultured in a 28°C incubator for 7 days until the colonies reached maturity. The colony morphology was as follows: the colonies were white, velvety hyphae, and the spores were light brown.
[0047] MEA solid culture medium composition: malt extract 17 g / L, peptone 3 g / L, sea salt 15 g / L, agar 20 g / L, solvent is double distilled water, pH is natural.
[0048] (2) ITS rDNA determination
[0049] A rapid extraction method using a nucleic acid extraction instrument was used. A small amount of sterilized quartz sand was prefilled into a nucleic acid extraction tube. A sterilized bamboo stick was used to pick fresh, visible mycelium into the tube, submerging it within the sand. 400 μL of sterile water was added to the tube, and the cap was tightened. The tube was shaken three times for 30 seconds using a nucleic acid extraction instrument. 400 μL of a phenol / chloroform / isoamyl alcohol (25:24:1) mixture was added. The contents of the tube were mixed using a vortexer and centrifuged at 13,300 rpm for 5 minutes. The supernatant was aspirated and placed in a new 1.5 mL centrifuge tube and refrigerated at 4°C until ready for use.
[0050] The ITS barcode region was amplified by PCR using universal primers. The forward primer for ITS1 was 5'-TCC GTAGGT GAA CCT GCG G-3', and the reverse primer was ITS4: 5'-TCC TCC GCT TAT TGA TAT GC-3'. These primers were synthesized by Wuhan Qingke Co., Ltd. The PCR reaction consisted of a 50 μL system containing 25 μL 2× ES Taq Master Mix (Dye), 2 μL upstream primer, 2 μL downstream primer, 2 μL template, and 19 μL water. PCR reaction conditions included 30 cycles of initial denaturation at 95°C for 2 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 50 s, followed by a final extension at 72°C for 5 min. Successful amplification of the target sequence was verified by electrophoresis on a 0.8% agarose gel at 110 V for 40 min. The bacterial solution containing the target DNA sequence was sent to BGI for sequencing, and ITS rDNA (shown in SEQ ID NO. 1) was obtained. The accession number in the GenBank database is OQ028233.
[0051] ITS rDNA (shown in SEQ ID NO.1) sequence:
[0052] AATATTTTCCTTCCCCGCTTATGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGA
[0053] GGTCAACCTGGTTAAAAAGATTGGTTGCGAGGCTAGCTGCCAGCTGGACCTACGGGAG
[0054] CGGGTGACAAAGCCCCATACGCTCGAGGACCAGACATGGTGCCGCCACTGCCTTTTGGG
[0055] CCCGTCCCCGTTGCCAGGGACGGAAGCCCAACACACAAGCCGTGCTTGAGGGCAGCAA
[0056] TGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGA
[0057] CTCGATGATTCACTGAATTCTGCAATTCACATTAATTATCGCATTTCGCTGCGTTCTTCATC
[0058] GATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACGATTGTTTAACTAAAAACTC
[0059] AGACTGCAAACTTCAGACAGCGTTCAAATGTTAGTCTCCGGCGGGCCGTGGCCACGCC
[0060] GAAGCAACAGGGTACAGATAGACACGGATGGGAGGTTGGACCCAGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGAAAA。
[0061] Forward primer (F) ITS1 sequence: 5'-TCC GTA GGT GAA CCT GCG G-3'
[0062] Reverse primer (R) ITS4 sequence: 5'-TCC TCC GCT TAT TGA TAT GC-3'
[0063] Based on the ITS sequence, it has 99.63% similarity with Aspergillus ruber (NCBI reference sequence: HM145962.1), and the strain WHUF0304 was identified as a marine fungus (Aspergillus sp.) and named marine fungus (Aspergillus sp.) WHUF0304. It was deposited in the China Center for Type Culture Collection on December 9, 2022, with the deposit number CCTCCNO: M20221920.
[0064] Example 2, Preparation of Compound of Formula (I)
[0065] 1. Fermentation culture
[0066] Aspergillus sp WHUF0304 strains stored in cryovials were inoculated onto plate culture plates and incubated in a 28°C incubator for 3 days until colonies reached maturity. Spores were inoculated into ISP4 liquid culture medium and cultured in a shaker at 28°C, 200 rpm, for 4 days to prepare the seed solution. The seed solution was inoculated at a 5% volume concentration into 60 sterilized 1L Erlenmeyer flasks containing 200 g of rice culture medium. The fermentation product was then cultured at room temperature for 120 days.
[0067] The final concentration composition of the plate culture medium is: potato 200 g / L, glucose 20 g / L, agar 18 g / L, solvent is water, and natural pH.
[0068] The final concentration composition of ISP4 liquid culture medium is: soluble starch 15 g / L, glucose 5 g / L, peptone (meat peptone) 5 g / L, yeast powder 5 g / L, (NH4)2SO4 0.5 g / L, K2HPO4 0.5 g / L, NaCl 0.5 g / L, MgSO4·7H2O 0.5 g / L, CaCO3 1 g / L, the solvent is water, pH 7.2.
[0069] The final concentration composition of every 200g rice culture medium is: 80g rice (Northeast rice) and 120g water.
[0070] 2. Separation and extraction
[0071] (1) Each bottle of fermentation product was stirred with a glass rod until the rice was dispersed. An equal volume of ethyl acetate was added and ultrasonic-assisted extraction was performed at 70 kHz for 20 min. This was repeated three times. The filtrates (i.e., the ethyl acetate layers from the 60 bottles of fermentation product) were combined and concentrated under reduced pressure until no liquid condensed. The extract was then dried at 60°C for 5 h to obtain 100.4 g of crude extract.
[0072] (2) 100.4 g of the crude extract was dissolved in 300 mL of ethyl acetate and separated by dry loading on a normal silica gel column (silica gel was selected from Qingdao Ocean Chemical, 200-300 mesh, silica gel column height 50 cm, inner diameter 6 cm, silica gel height 30 cm), and eluted with petroleum ether-ethyl acetate and pure methanol in a volume ratio of 5:1, 2:1, and 1:2, respectively. The elution rate was 20 mL / min and the elution volume was 5 column volumes. 500 mL of the effluent was collected in each bottle and subjected to thin layer chromatography. The elutions with Rf of 0.81-1.0 were combined and recorded as component A; the elutions with Rf of 0.71-0.8 were combined and recorded as component B; the elutions with Rf of 0.61-0.7 were combined and recorded as component C; the elutions with Rf of 0.41-0.6 were combined and recorded as component D; the elutions with Rf of 0.31-0.4 were combined and recorded as component E; the elutions with Rf of 0.21-0.3 were combined and recorded as component F;
[0073] (3) Component C was separated by normal phase silica gel column chromatography (silica gel was selected from Qingdao Ocean Chemical, 200-300 mesh, silica gel column height 50 cm, inner diameter 3 cm, silica gel height 30 cm), and eluted with dichloromethane-methanol with a volume ratio of 60:1, 40:1, and 20:1, and pure methanol as eluents, with an elution rate of 20 mL / min and an elution volume of 5 column volumes. 400 mL of the effluent was collected in each bottle and subjected to thin layer chromatography (TL C, developing solvent: dichloromethane-methanol 40:1, v / v) spot plate monitoring, the effluent with Rf of 0.91-1.0 was combined and recorded as component C1; the effluent with Rf of 0.61-0.9 was combined and recorded as component C2; the effluent with Rf of 0.51-0.6 was combined and recorded as component C3; the effluent with Rf of 0.41-0.5 was combined and recorded as component C4; the effluent with Rf of 0.21-0.4 was combined and recorded as component C5;
[0074] (4) Component C2 was separated by ODS medium-pressure chromatography using 50% (v / v) methanol-water for 0-10 min, 50-70% (v / v) methanol-water for 10-50 min, and 70-100% (v / v) methanol-water for 50-90 min. The elution rate was 10 mL / min. 30 mL of the effluent was collected from each bottle. The effluent of 50% (v / v) methanol-water was combined and recorded as component C2-1; the effluent of 50-70% (v / v) methanol-water was combined and recorded as component C2-2; the effluent of 70-100% (v / v) methanol-water was combined and recorded as component C2-3.
[0075] (4) Components C2-3 were separated by normal phase silica gel column chromatography (silica gel was selected from Qingdao Ocean Chemical, 200-300 mesh, silica gel column height 50 cm, inner diameter 2 cm, silica gel height 30 cm), and eluted with petroleum ether-ethyl acetate (2:1, 1:1) and pure methanol as eluents, respectively, at an elution rate of 20 mL / min and an elution volume of 5 column volumes. 20 mL of the effluent was collected in each bottle and subjected to thin layer chromatography (TLC, developed) The effluent with an Rf of 0.81-1.0 was combined and recorded as component Z-1; the effluent with an Rf of 0.61-0.8 was combined and recorded as component Z-2; the effluent with an Rf of 0.41-0.6 was combined and recorded as component Z-3; the effluent with an Rf of 0.31-0.4 was combined and recorded as component Z-4; the effluent with an Rf of 0.21-0.4 was combined and recorded as component Z-5;
[0076] (5) The Z-2-1 component collected in step d was further separated by semi-preparative HPLC. The chromatographic column model was Agilent ZORBAX SB-C18 (5 μm, 9.6×150 mm), the HPLC system was Agilent 1260, the detection wavelengths were 220 nm and 254 nm, the injection volume was 50 μL, and the product was isocratically eluted with methanol-water in a volume ratio of 85:15. The fraction at 15.9 min was collected and concentrated and evaporated to dryness at 40-60° C. to obtain the indolediketopiperazine derivative represented by formula (I) (12.0 mg).
[0077] 3. Structural identification of compound (I)
[0078] The obtained compound (I) was characterized by high resolution mass spectrometry (HRESIMS), nuclear magnetic resonance spectroscopy ( 1 H NMR, 13 C NMR, 2D NMR) were used for structural identification, and the results are shown in Figure 2-Figure 6 shown.
[0079] (1)HRESIMS
[0080] High-resolution mass spectrometry (HRESIMS) detection conditions: Instrument model: Agilent 6210TOF MS ion source parameters ESI-: VCap: 3000V Gas Temp: 350℃ Drying Gas: 7L / min Nebulizer: 35psig.
[0081] Compound I is a white powder, HRESIMS ( Figure 2 ) gives a quasi-molecular ion peak m / z 616.2773[MH] - , determine the molecular formula of the compound to be C 38 H 39N3O5.
[0082] (2) 1 H NMR
[0083] 1 H NMR (CDCl3, 600 MHz) spectrum ( Figure 3 ) gives one aldehyde proton δ H 10.24 (s, 1H, H-34), 1 phenolic hydroxyl proton δ H 11.73 (s, 1H, OH-21), 3 amino protons δ H 8.30 (s, 1H, 1-NH), 7.39 (s, 1H, 14-NH), 6.10 (s, 1H, 11-NH), 4 aromatic protons δ H 7.33 (brd, J = 7.8 Hz, 1H, H-7), 7.17 (dd, J = 7.8, 7.2 Hz, 1H, H-6), 7.10 (dd, J = 7.8, 7.2 Hz, 1H, H-5), 7.03 (brd, J = 7.8 Hz, 1H, H-4), 8 sp 2 Hybridized proton δ H 7.02(s,1H,H-8), 6.88(s,1H,H-26), 6.06(dt,J=10.1,3.0Hz,1H,H-30), 5.96(dd,J=17. 4,10.1Hz,1H,H-16), 5.85(dt,J=10.1,1.8Hz,1H,H-29), 5.31(t,J=7.2Hz,1H,H-36), 5. 15 (d, J = 10.8 Hz, 1H, H-17a), 5.09 (d, J = 17.4 Hz, 1H, H-17b), 5 methyl protons 1.76 (s, 3H, H-39), 1.69 (s, 3H, H-38), 1.37 (d, J = 1.8 Hz, 6H, H-18, H-19), 1.33 (d, J = 7.8 Hz, 3H, H-33), 4 methylene protons δ H 3.39 (d, J = 7.2 Hz, 2H, H-35), 2.61 (dd, J = 13.8, 8.4 Hz, 1H, H-32), 1.99 (m, J = 13.8 Hz, 1H, H-32), 2 methine protons 4.38 (m, 1H, H-28), 2.70 (brs, 1H, H-31).
[0084] (3) 13 C NMR, 2D NMR, HMBC
[0085] 13 C NMR (CDCl3, 150 MHz) spectrum ( Figure 4) and combined with HSQC spectrum ( Figure 5 ) gives 38 carbon signals, including 5 methyl C-18 (δ C 27.3), C-19(δ C 27.4), C-38(δ C 17.9), C-39(δ C 25.9), C-33(δ C 22.1) and 2 methylene C-32 (δ C 39.5), C-35(δ C 27.6); 2 methine C-28 (δ C 42.9), C-31(δ C 27.9); 3 carbonyl C-34 (δ C 193.1), C-13(δ C 166.9), C-10(δ C 159.4); 14 sp 2 -aromatic carbon C-21(δ C 158.1), C-24(δ C 149.1), C-2(δ C 144.0), C-7a(δ C 134.4), C-25(δ C 127.4), C-22(δ C 127.3), C-3a(δ C 126.1), C-6(δ C 122.5), C-5(δ C 121.1), C-23(δ C 120.0), C-4(δ C 118.8), C-7(δ C 111.4), C-20(δ C 110.9), C-3(δ C 103.0); 10 sp 2 -Carbon C-26 (δ C 102.5), C-27(δ C 158.3), C-16(δ C 144.2), C-30(δ C 134.8), C-37(δ C 134.46), C-29(δ C 122.4), C-36(δ C 121.1), C-17(δ C 113.5), C-8(δC 111.8), C-9(δ C 123.9); 2 sp 3 -Quaternary carbon C-15(δ C 39.2), C-12(δ C 61.0); similar to the compound Cryptoechinuline D except for the different substituents at C-27 and C-24, HMBC spectrum ( Figure 6 ) shows the methine proton δ H 4.38 is related to C-26, δ H 6.88 is related to C-20 and C-24, and the positions of C-26 and C-24 are determined respectively; the proton δ H 6.06 is related to C-27, confirming the position of C-27; compared with the known compound Cryptoechinuline D, the molecular formula of the compound of formula I has two fewer hydrogen atoms, namely one less hydrogen proton on C-27 and one less hydroxyl hydrogen on C-24, and the chemical shift of C-26 is shifted to 102.5 ppm upfield, thus confirming that C-24 is connected to C-27 through an oxygen atom. 1 H and 13 C NMR signals were assigned (Table 1).
[0086] Through the above analysis, the structural formula of the compound is finally determined as shown in formula (I):
[0087]
[0088] Table 1. Compounds of formula (I) 1 H and 13 C NMR chemical shift values (solvent: CDCl3)
[0089]
[0090]
[0091] Example 3: The compound of formula (I) has growth inhibitory activity against MIA PaCa-2 human pancreatic cancer cells in vitro
[0092] MIA PaCa-2 cell monolayers were seeded in DMEM medium containing 2% glutamine, 1.5% sodium bicarbonate, and 10% fetal bovine serum, supplemented with 100 units / mL of penicillin and 100 μg / mL of streptomycin. The cells were cultured at 37°C in a 5% CO2 incubator. Logarithmically growing cells were plated at a concentration of 5000 cells / mL onto 96-well plates, with 100 μL added to each well. Experimental, positive, and blank (no cell inoculation) groups were assigned and incubated in a 37°C CO2 incubator for 24 hours.
[0093] In the experimental group, 100 μL of compounds containing different concentrations prepared in 1% DMEM medium (1% fetal bovine serum, 1% double antibody, 98% culture medium) were added to each well. Each concentration had 3 groups of parallels, and 6 concentrations were set: 0.625, 1.25, 2.50, 5.00, 10.0, and 20.0 μM.
[0094] The positive control group was treated with an equal amount of paclitaxel prepared in 1% DMEM medium (1% fetal bovine serum, 1% double antibody, 98% culture medium) at 6 concentrations: 0.00125, 0.0125, 0.125, 1.25, 2.50, and 5.00 μM. The blank group was treated with an equal amount of 1% DMEM medium.
[0095] The cells were cultured in a 37°C carbon dioxide incubator for 48 h. 5 mg / mL MTT was then added to the wells, 20 μL per well, and cultured at 37°C for another 4 h. 150 μL of DMSO was added to each well to dissolve the MTT precipitate. The cells were shaken on a microplate reader for 10 min and the optical density at 570 nm was measured. The tumor cell growth inhibition rate IC was calculated according to formula (1). 50 .
[0096] Tumor cell growth inhibition rate = [1-(measurement value of experimental well-measurement value of blank well) / (measurement value of control well-measurement value of blank well)] × 100% formula (1)
[0097] Table 2. IC values of each compound determined and calculated by MTT assay 50 value
[0098]
[0099] In vitro experimental results showed that the compound of formula (I) had an inhibitory effect on the growth of human pancreatic cancer MIA PaCa-2 cells in vitro. 50 The results show that the 1.366±0.02μM iodine hydrochloride is expected to be used in the preparation of human pancreatic cancer MIA PaCa-2 cell inhibitors.
Claims
1. An indolyl diketopiperazine derivative derived from Aspergillus marinus shown in formula (I):
2. A preparation method of the indolyl diketopiperazine derivative according to claim 1, characterized in that the method comprises the following steps: (1) Fermentation culture: The marine fungus Aspergillus sp. WHUF0304 is inoculated into a rice medium and left to ferment statically at room temperature for 120 days to obtain a fermented product; the rice medium is prepared by mixing rice and water in a mass ratio of 1:1 - 10; the marine fungus Aspergillus sp. WHUF0304 is preserved in the China Center for Type Culture Collection, with the preservation date of December 9, 2022, and the preservation number CCTCC NO: M20221920, address: Wuhan University, Wuhan, China; (2) Crude extract: The fermented product is stirred and dispersed, and an equal volume of ethyl acetate is added for ultrasonic extraction, filtered, and the filtrate is concentrated under reduced pressure until no liquid condenses, and then dried to obtain a crude extract; (3) Separation and extraction: a. The crude extract is dissolved in ethyl acetate and separated by a normal-phase silica gel chromatographic column. Petroleum ether - ethyl acetate with volume ratios of 5:1, 2:1, and 1:2, and pure methanol are used as eluents for elution. The elution speed is 10 - 30 mL / min for all, and the elution volume is 2 - 6 column volumes for all. 500 mL of the effluent is collected in each bottle. Monitored by thin-layer chromatography spotting plate, the developing agent is petroleum ether - ethyl acetate with a volume ratio of 2:
1. The effluents with Rf values of 0.81 - 1.0 are combined and denoted as fraction A; the effluents with Rf values of 0.71 - 0.8 are combined and denoted as fraction B; the effluents with Rf values of 0.61 - 0.7 are combined and denoted as fraction C; The effluents with Rf values of 0.41 - 0.6 are combined and denoted as fraction D; The effluents with Rf values of 0.31 - 0.4 are combined and denoted as fraction E; The effluents with Rf values of 0.21 - 0.3 are combined and denoted as fraction F; b. Fraction C is separated by normal-phase silica gel column chromatography. Dichloromethane - methanol with volume ratios of 60:1, 40:1, and 20:1, and pure methanol are used as eluents for elution. The elution speed is 10 - 30 mL / min for all, and the elution volume is 2 - 6 column volumes for all. 400 mL of the effluent is collected in each bottle. Monitored by thin-layer chromatography spotting plate, the developing agent is dichloromethane - methanol with a volume ratio of 40:
1. The effluents with Rf values of 0.91 - 1.0 are combined and denoted as fraction C1; the effluents with Rf values of 0.61 - 0.9 are combined and denoted as fraction C2; The effluents with Rf values of 0.51 - 0.6 are combined and denoted as fraction C3; The effluents with Rf values of 0.41 - 0.5 are combined and denoted as fraction C4; The effluents with Rf values of 0.21 - 0.4 are combined and denoted as fraction C5; c. Component C2 is separated by an ODS medium-pressure chromatographic column, and eluted under the elution conditions of 50% methanol-water from 0 - 10 min, 50 - 70% methanol-water from 10 - 50 min, and 70 - 100% methanol-water from 50 - 90 min. The elution speed is 10 mL / min for all. 30 mL of the effluent is collected in each bottle. The effluent of 50% methanol-water is combined and denoted as component C2-1; the effluent of 50 - 70% methanol-water is combined and denoted as component C2-2; the effluent of 70 - 100% methanol-water is combined and denoted as component C2-3; d. Component C2-3 is separated by normal-phase silica gel column chromatography and eluted successively with petroleum ether - ethyl acetate with a volume ratio of 2:1 and 1:1, and pure methanol as the eluent. The elution speed is 10 - 30 mL / min for all, and the elution volume is 2 - 6 column volumes. 20 mL of the effluent is collected in each bottle. Monitored by thin-layer chromatography spotting plate, the developing agent is petroleum ether - ethyl acetate with a volume ratio of 1:
1. The effluent with an Rf value of 0.81 - 1.0 is combined and denoted as component Z-1; the effluent with an Rf value of 0.61 - 0.8 is combined and denoted as component Z-2; the effluent with an Rf value of 0.41 - 0.6 is combined and denoted as component Z-3; the effluent with an Rf value of 0.31 - 0.4 is combined and denoted as component Z-4; The effluent with an Rf value of 0.21 - 0.4 is combined and denoted as component Z-5; e. The Z-1 component collected in step d is further separated by semi-preparative high-performance liquid chromatography, isocratically eluted with methanol - water with a volume ratio of 85:15, and the fraction at 15.9 min is collected, concentrated and evaporated to dryness to obtain the indolodione piperazine derivative shown in formula (I).
3. The preparation method according to claim 2, characterized in that In step (1), before the fermentation of marine fungus WHUF0304, activation and seed expansion culture are first carried out, and then the seed liquid is inoculated into the rice medium at an inoculation amount of 5% by volume. The activation and seed expansion culture are as follows: The marine fungus WHUF0304 is inoculated into the plate medium and cultured in an incubator at 28 °C for 3 - 5 d until the colony grows to maturity; the spores are taken and inoculated into ISP 4 liquid medium, and cultured on a shaker at 28 - 30 °C and 180 - 220 rpm for 3 - 5 d to obtain the seed liquid; The final concentration composition of the plate medium is: 200 g / L of potato, 20 g / L of glucose, 15 - 20 g / L of agar, the solvent is water, and the natural pH; ISP 4 The final concentration composition of the liquid medium is: 15 g / L of soluble starch, 5 g / L of glucose, 5 g / L of peptone, 5 g / L of yeast powder, (NH 4 ) 2 SO 4 0.5 g / L, K 2 HPO 4 0.5 g / L, 0.5 g / L of NaCl, MgSO 4 ·7H 2 O 0.5 g / L, CaCO 3 1 g / L, the solvent is water, and the pH is 7.
2.
4. The preparation method according to claim 2, characterized in that In step (2), the ultrasonic extraction conditions are at a frequency of 70 KHz at room temperature for 20 min, and the extraction times are 1 - 3 times.
5. The preparation method according to claim 2, characterized in that In a, b, and d of step (3), the silica gel of the silica gel chromatographic column is 200 - 300 mesh, the column height is 50 cm, the inner diameters are 6 cm, 3 cm, and 2 cm respectively, and the height of the silica gel is 30 cm for all.
6. In the preparation method according to claim 2, in c of step (3), for the ODS medium-pressure chromatographic column, the ODS chromatographic column packing is from Japanese YMC Company, the chromatographic column height is 20 cm, the inner diameter is 5 cm, and the height of the ODS packing is 20 cm.
7. The preparation method according to claim 2, characterized in that In step (3) e, the chromatographic column model of the semi-preparative high-performance liquid chromatography is Agilent ZORBAX SB-C18, 5 μm, 9.6×150 mm, the high-performance liquid chromatography system is Agilent1260, the detection wavelengths are 220 nm and 254 nm, and the injection volume is 50 μL.
8. Use of the indolodione piperazine derivative according to claim 1 in the preparation of an anti-tumor drug.
9. The use according to claim 8, characterized in that The anti-tumor drug is a drug against human pancreatic cancer MIA PaCa-2 cells.
Citation Information
Patent Citations
Indole diketopiperazine derivatives and preparation method thereof, and application of indole diketopiperazine derivatives in preparation of anti-inflammatory drugs
CN112707890A