Aspergillus fumigatus monocarboxylic acid transporter mfsmt gene and application thereof

By knocking out the MFSmt gene in Aspergillus fumigatus, we studied its sensitivity to antifungal drugs, revealed the mechanism of action of voriconazole in Aspergillus fumigatus, provided new drug targets and treatment options, and improved the effectiveness of anti-Aspergillus fumigatus infection.

CN116376937BActive Publication Date: 2026-06-26JINGZHOU CENT HOSPITAL (JINGZHOU HOSPITAL AFFILIATED TO YANGTZE UNIV)

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JINGZHOU CENT HOSPITAL (JINGZHOU HOSPITAL AFFILIATED TO YANGTZE UNIV)
Filing Date
2022-07-19
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

The effectiveness of existing treatments against Aspergillus fumigatus infection is limited, especially due to increased resistance to voriconazole and a lack of research on effective anti-Aspergillus fumigatus drug targets and mechanisms.

Method used

The MFSmt gene in Aspergillus fumigatus was knocked out, and a gene-deleted strain was constructed by homologous recombination. The changes in its sensitivity to antifungal drugs were observed, and it was found that the deletion of the MFSmt gene led to increased sensitivity of Aspergillus fumigatus to voriconazole and enhanced resistance to amphotericin B.

Benefits of technology

This study provides new drug targets and mechanisms, suggesting that the combined use of drugs with MFSmt gene deletion or decreased expression levels with voriconazole can improve bactericidal efficacy, avoid the use of amphotericin B to prevent drug resistance, and guide more effective treatment regimens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116376937B_ABST
    Figure CN116376937B_ABST
Patent Text Reader

Abstract

The MFSmt gene reveals the role of voriconazole in treating Aspergillus fumigatus under the condition of pathogenicity: the deletion of MFSmt gene leads to the increase of amphotericin B resistance and the increase of voriconazole sensitivity in Aspergillus fumigatus. This finding suggests that if the drug that makes the MFSmt gene deletion or reduces the amount of expressed protein is used in clinical treatment, it can be combined with voriconazole to have a more effective bactericidal effect, and at the same time, the use of amphotericin B should be avoided to prevent drug resistance. This has important clinical value for determining the treatment plan for effective treatment of clinical Aspergillus fumigatus infection and controlling drug-resistant strains.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a gene for the monocarboxylic acid transporter MFSmt from Aspergillus fumigatus and its application after deletion, belonging to the field of genetic engineering technology. Background Technology

[0002] With the continuous improvement of medical diagnostic and treatment technologies, the widespread use of broad-spectrum antibiotics and corticosteroids, and the increase in invasive procedures, the incidence of invasive fungal infections is on the rise. In intensive care units, the mortality rate of invasive Aspergillus fumigatus infections is relatively high. Currently, the number and types of drugs available for treating invasive Aspergillus fumigatus infections are very limited, mainly triazole drugs. Voriconazole (VOR) is used for both invasive and chronic infections and is a first-line drug, widely used clinically. Voriconazole (VOR) and amphotericin B (AMB) are also used in the treatment of refractory aspergillosis. Currently, some Aspergillus fumigatus strains have developed resistance to voriconazole, further limiting the clinical treatment of invasive aspergillosis caused by Aspergillus fumigatus. Therefore, research on the resistance mechanisms of anti-Aspergillus fumigatus drugs and new drug targets is crucial, as it provides an important basis for developing treatment plans and improving treatment efficacy.

[0003] The MFSmt gene encodes a monocarboxylic acid transporter, a membrane transporter found on the surface of various tissues. It participates in the regulation of various basal metabolic processes, such as glycolysis and fatty acid homeostasis. This protein is essential for the transport of L-lactic acid and pyruvate, and also participates in the transport of monocarboxylic acid drugs. Therefore, it is hypothesized that the MFSmt gene may be involved in the normal growth process of *Aspergillus fumigatus* strains and the action of antifungal drugs. Thus, it is necessary to identify the *Aspergillus fumigatus* monocarboxylic acid transporter MFSmt gene to study the drug resistance mechanisms of *Aspergillus fumigatus* strains and the mechanisms of action of antifungal drugs. Summary of the Invention

[0004] The purpose of this invention is to provide a gene for the monocarboxylic acid transporter MFSmt from Aspergillus fumigatus, and the application of strains with this gene deletion in relation to azole drug sensitivity.

[0005] The technical solution of this invention is:

[0006] A monocarboxylic acid transporter MFSmt gene from Aspergillus fumigatus, derived from Aspergillus fumigatus AF293, with the NCBI gene database serial number Afu6g09880 and Gene ID: 3508182, is characterized in that: the nucleotide sequence of the Aspergillus fumigatus monocarboxylic acid transporter MFSmt gene is shown in Sequence 1 of the sequence listing, containing 1396 bases.

[0007] The MFSmt gene can be used as a target gene in the preparation or screening of antifungal drugs for the treatment of Aspergillus infection.

[0008] The MFSmt gene in Aspergillus fumigatus can reduce sensitivity to voriconazole.

[0009] The aforementioned deletion of the MFSmt gene leads to increased resistance of Aspergillus fumigatus to amphotericin B;

[0010] The advantages of this invention are:

[0011] This invention discloses the role of the MFSmt gene in the treatment of opportunistic pathogen Aspergillus fumigatus: MFSmt gene deletion leads to increased resistance to amphotericin B and increased susceptibility to voriconazole in Aspergillus fumigatus. This finding suggests that in clinical treatment, combining voriconazole with drugs that cause MFSmt gene deletion or decreased protein expression may result in more effective bactericidal effects, while the use of amphotericin B should be avoided to prevent the development of resistance. This has significant clinical value for effectively treating clinical Aspergillus fumigatus infections, determining treatment regimens, and controlling drug-resistant strains. Attached Figure Description

[0012] Figure 1 This is an electrophoresis gel image of the upstream and downstream flanking fragments of the MFSmt gene coding region, showing the fusion PCR of the three segments. The upstream and downstream flanking fragments are approximately 1.2 kb in length, and the fusion length of the three segments is approximately 4.0 kb.

[0013] Figure 2 This is an electrophoresis gel image of the screening marker pyrG gene, approximately 1.5kb in length.

[0014] Figure 3 This is an electrophoresis gel image of the positive transformant △MFSmt identified by PCR using Carslan R2 and pyrG-vF primers. The image is approximately 1.5 kb in length.

[0015] Figure 4 This is the result of E-test method for detecting the growth status of positive transformant △MFSmt under the action of different antifungal drugs.

[0016] Figure 5 This is the result of the sensitivity of the positive transformant △MFSmt to different antifungal drugs detected by drug drop plate assay.

[0017] Figure 6 This is the growth curve of the positive transformant △MFSmt. Detailed Implementation

[0018] The present invention will be further described below with reference to the accompanying drawings and specific embodiments:

[0019] This invention utilizes a high-throughput method to knock out or disrupt the MFSmt gene in *Aspergillus fumigatus* to construct knockout strains. The invention constructs a gene knockout cassette and replaces a portion of the MFSmt gene sequence in *Aspergillus fumigatus* AF293 with the selection marker pyrG gene via homologous recombination, obtaining positive transformants ΔMFSmt. In drug drop plate experiments, compared to *Aspergillus fumigatus* AF293, the positive transformants showed increased sensitivity to voriconazole and decreased sensitivity to amphotericin B. Both E-test detection and growth curve analysis revealed slower growth of the positive transformants compared to *Aspergillus fumigatus* AF293. This invention provides a new research direction for studying the antifungal mechanisms of azole drugs and the drug resistance mechanisms of strains.

[0020] Example 1: Knockout of the gene encoding MFSmt in Aspergillus fumigatus

[0021] 1. Construct gene knockout boxes;

[0022] The experiment used *Aspergillus fumigatus* AF293 as the basic experimental material, which was purchased from (http: / / www.fgsc.net / asperg.html). The culture medium required for the growth of *Aspergillus fumigatus* AF293 was Czapek-Agar solid medium (CZA) (purchased from Haibo Biotechnology Co., Ltd.). The culture medium required for the growth of plasmid PLAX223 was LB medium supplemented with ampicillin (1 ml / L) (purchased from Haibo Biotechnology Co., Ltd.).

[0023] 1) Using the genome of *Aspergillus fumigatus* AF293 as a template, DNA was extracted using the OMEGA® Fungal DNA Kit. The upstream flanking fragment of the MFSmt gene coding region was amplified using primers MFSmtP1 and MFSmtP2, and the downstream flanking fragment was amplified using primers MFSmtP3 and MFSmtP4. The amplified products were subjected to 1% agarose gel electrophoresis. Approximately 1.2 kb fragments from each amplified product were recovered using the MolPure® PCR Purification Kit (the upstream flanking fragment of the MFSmt gene coding region is shown in Sequence 2 of the sequence listing, and the downstream flanking fragment is shown in Sequence 3 of the sequence listing). The amplification conditions were: 94℃ for 4 min 30 s; 30 cycles (94℃ for 30 s; 54℃ for 30 s; 72℃ for 1 min); 72℃ for 10 min; and temporary storage at 4℃. The electrophoresis gel results are shown in the attached figure. Figure 1 As shown, lane M is Maker, and lanes 1 and 2 are the upstream and downstream flanking segments of the coding region of the MFSmt gene, respectively.

[0024] The sequences of the primers mentioned above are as follows:

[0025] MFSmtP1: GCTGTAGCAGTGCACTTTTCGATTT

[0026] MFSmtP2:TAGTTCTGTTACCGAGCCGGTCTGGACAATGCTGTAAAGGGTTTA

[0027] MFSmtP3:GCTCTGAACGATATGCTCCAACATACTGCTTTTGGTCTGCAAGGAGA

[0028] MFSmtP4:TCTGCACAAGTATGCGGTATGCGGT

[0029] 2) Using the PLAX223 genome as a template, which contains the *Aspergillus nidus* pyrG gene, plasmid DNA was extracted using a kit (MolPure® Plasmid Mini Kit). The pryG gene fragment was amplified using primers pryG-nR and pryG-nF. The amplified product was subjected to 1% agarose gel electrophoresis. A fragment of approximately 1.5 kb was excised and purified using a kit (MolPure® Gel Extraction Kit) (the pyrG gene fragment is shown in sequence 4 of the sequence listing). The amplification conditions were: 95℃ for 2 min; 35 cycles (95℃ for 30 s; 55℃ for 30 s; 68℃ for 1 min 30 s); 68℃ for 5 min; and temporary storage at 4℃. The electrophoresis gel results are shown in the attached figure. Figure 2 As shown, lane M is Maker and lane 1 is the pyrG gene fragment.

[0030] The sequences of the primers mentioned above are as follows:

[0031] pyrG-nF CCGGCTCGGTAACAGAACTACCGCAGACAATGCTCTCTATC

[0032] pyrG-n-RGTTGGAGCATATCGTTCAGAGCAATACCGTTACACATTTCCA

[0033] 3) Using primers MFSmtP5 and MFSmtP6, a three-segment fusion PCR was performed on the upstream flanking fragment, downstream flanking fragment, and pryG gene fragment of the MFSmt gene coding region. The amplified product was subjected to 1% agarose gel electrophoresis. The approximately 4.0 kb fragment was excised from the amplified product and purified using a MolPure® Gel Extraction Kit to obtain the three-segment fusion fragment, i.e., the gene knockout cassette. The amplification conditions were: 95℃ for 2 min; 35 cycles (95℃ for 30 s; 70℃ for 1 s; 55℃ for 30 s; 72℃ for 3 min 50 s); 72℃ for 5 min; and temporary storage at 4℃. The electrophoresis gel results are shown in the attached figure. Figure 1 As shown, lane M is the Maker, and lane 3 is the three-segment fusion fragment, i.e., the gene knockout box.

[0034] The sequences of the primers mentioned above are as follows:

[0035] MFSmtP5:ATTGGAATGAGTGGAATGGCTGTCA

[0036] MFSmtP6:AGTCCCAGGCTGCAGTATGTATAGC

[0037] 2. Constructing the knockout strain △MFSmt

[0038] Aspergillus fumigatus AF293 was the control wild-type strain used in this experiment. The host strain required for transformation was the defective strain A1160 (△KU80, pyrG-) (purchased from http: / / www.fgsc.net / asperg.html). Its growth medium was Czapek-Gro solid medium (purchased from Haibo Biotechnology Co., Ltd.) (CZA+U) supplemented with uracil (0.05 g / ml). The defective strain A1160 lacks the pyrG gene and cannot synthesize uracil itself; therefore, uracil must be added to its growth medium, or the pyrG gene fragment must be inserted into the defective strain for it to grow naturally on a medium without exogenous uracil. After the defective strain △KU80 successfully introduced a gene knockout cassette containing the pyrG gene fragment, its growth was no longer limited by the external supply of uracil. This phenomenon can be used to screen for positive transformants on CZA plates (without exogenous uracil).

[0039] 1) Inoculate the defective strain A1160 (△KU80) onto Czapek-Agar (CZA+U) medium containing uracil and incubate at 37°C for approximately 3 days. Collect spores to adjust the bacterial suspension concentration to 1×10⁻⁶. 9CFU / ml, quantified at 150 μl, was cultured in 50 ml of Sabouraud dextrose liquid medium (purchased from Sigma) containing uracil (0.05 g / ml) with shaking (37°C, 130 rpm / min) for 16 h to increase spore numbers. The mycelia were collected by filtration through sterile gauze and treated with 36 ml of a prepared protoplast solution. The mycelia were then cultured with shaking (37°C, 100 rpm / min) for 4 h to enzymatically dissolve the spore cell walls and form protoplasts. Residual mycelia were removed by filtration through sterile gauze. The filtered solution was then washed stepwise with KCl / CaCl2 solution (the solution was first aliquoted and centrifuged for 10 min to remove the supernatant; centrifugation conditions:...). 1800×g, 4℃; after resuspending in 2ml KCl / CaCl2 solution, aliquot into two tubes and centrifuge for 3 min to remove supernatant. Centrifugation conditions: 900×g, 4℃; both tubes are resuspended in 1ml KCl / CaCl2 solution, and centrifuged again to remove supernatant. The supernatant is then removed twice more after centrifugation, each time for 3 min. Conditions: 900×g, 4℃; after resuspending in 0.5ml KCl / CaCl2 solution, the two tubes are combined into one tube, centrifuged for 3 min to remove supernatant. Centrifugation conditions: 1800×g, 4℃; resuspended in 1ml KCl / CaCl2 solution. Finally, the A1160 protoplast solution is obtained.

[0040] Preparation of protoplasmic solution: Dissolve 8.2g potassium chloride and 2.1g citric acid in distilled water. Adjust the pH to 5.8 using KOH solution (1.1mol / L). Make up to 1L with distilled water. Autoclave to obtain KCl / citric acid solution. Dissolve 1g pectinase and 1g cellulase (Cangzhou Xiasheng Enzyme Biotechnology Co., Ltd.) in 40ml of KCl / citric acid solution. Filter using a 0.45μm PVDF filter (Sigma). 30 minutes before use, mix 16ml of the filtered liquid with 16ml of Sabouraud dextrose liquid to obtain protoplasmic solution.

[0041] Preparation of KCl / CaCl2 solution: 4.47g potassium chloride, 0.74g calcium chloride, 100ml distilled water, autoclave, store at 4℃. Procedures using KCl / CaCl2 solution should be performed on ice.

[0042] 2) The previously successfully constructed gene knockout cassette was introduced into A1160 protoplasts (20 μl of the three-segment fusion product + 20 μl of filtered PEG solution + 50 μl of protoplast solution, mixed thoroughly, and incubated on ice for 30 min; then 100 μl of filtered PEG solution was added, mixed thoroughly, and incubated on ice for 5 min). After thorough mixing, it was evenly spread onto Czapek-Style Solid Medium. If the gene knockout cassette is successfully introduced into the protoplasts, the transformants will grow on Czapek-Style Solid Medium without exogenous uracil. After incubating the spread Czapek-Style Solid Medium at 37°C for 2-3 days, colonies will grow, which are considered positive transformants, abbreviated as △MFSmt.

[0043] PEG solution preparation: Dissolve 400g of polyethylene glycol in 800ml of KCl / CaCl2 solution, stir well, and then bring the volume to 1L with KCl / CaCl2 solution. Autoclave and store at room temperature. Before use, filter through a 0.45μm PVDF filter (Sigma) to remove any precipitate.

[0044] 3) Using a sterile pipette tip, pick up the colonies growing on CZA plates and transfer them to CZA plates for further culture. Repeat the transfer twice to stabilize the strain shape before streak isolation. Collect the isolated single colonies and culture them on CZA plates for 2-3 days. Extract DNA using the OMEGA® Fungal DNA Kit. Perform PCR amplification on the DNA of positive transformants and Aspergillus fumigatus AF293 using primers Carslan R2 and pyrG-vF, respectively. The amplification conditions are: 94℃ for 4.5 min; 30 cycles (94℃ for 30 s; 54℃ for 30 s; 72℃ for 2 min 50 s); 72℃ for 10 min; 4℃ for temporary storage. Perform 1% agarose gel electrophoresis. The electrophoresis results are shown in the attached figure. Figure 3 As shown, lane M is the marker, lane 1 is the positive transformant validation band (approximately 1.5 kb in length), and lane 2 is the Aspergillus fumigatus AF293 control, with no band observed. The PCR products of the positive transformants showing the validation band were further sequenced (Sangon Biotech Co., Ltd.). This successfully confirmed that the constructed gene knockout cassette was successfully introduced into A1160 protoplasts, and the MFSmt gene was knocked out, yielding the knockout strain △MFSmt.

[0045] Primer Carslan R2 was designed based on the pyrG gene sequence from 798 to 820 bp, a total of 23 bp, with a distance of 550 bp downstream. Primer pryG-VF is based on the pyrG gene sequence from 889 to 909 bp, a total of 21 bp, with a distance of 461 bp downstream.

[0046] The primer sequences are as follows:

[0047] Carslan R2:GTGTTGCCGATGTCGATGAACTT

[0048] pryG-VF:TCCTGCCGGGCGAAGGGATCG

[0049] Example 3: Detection of the growth status of knockout strain △MFSmt under antifungal drug treatment after the MFSmt gene was knocked out;

[0050] 1. E-test method for detection

[0051] The knockout strain △MFSmt obtained in Example 2 and the wild-type strain AF293 (control group) were used to determine the growth status of the strains under the action of four antifungal drugs: amphotericin B (AMB), voriconazole (VOR), itraconazole (ITR), and posaconazole (POS) using E-test strips (Guangzhou Yiman Biotechnology Co., Ltd.). The specific methods are as follows:

[0052] 1) Preparation of RPMI-1640 solid medium: Dissolve 10.2g of RPMI1640 powder (Thermo Fisher Scientific) and 34.53g of MOPS powder (Yisheng Biotechnology Co., Ltd.) in distilled water, adjust the pH to 7.0 with NaOH or glacial acetic acid, add 2% agar powder (Sigma), and bring the volume to 1L with distilled water. After autoclaving, pour into Petri dishes and allow to cool and solidify to obtain RPMI-1640 solid medium.

[0053] 2) To prepare bacterial suspensions of the two strains, the concentration needs to be adjusted to 1×10⁻⁶ using physiological saline. 6 CFU / ml, after completely soaking the tube with a sterile cotton swab and squeezing out the excess liquid from the tube wall, spread it evenly in three directions onto RPMI-1640 solid culture medium, and let it stand for 15 minutes to ensure that the petri dish is completely dry;

[0054] 3) Carefully place the drug susceptibility test strips (E-test strips) for amphotericin B (AMB), voriconazole (VOR), itraconazole (ITR), and posaconazole (POS) on the center surface of the petri dish, ensuring the graduated side faces upwards. Remove any air bubbles by squeezing out the strips. Then, place the petri dish in a 35°C incubator for 24 hours. Read the results after 48 hours. Results are as follows: Figure 4As shown in the 24-hour results, under the influence of the four drugs, the knockout strain △MFSmt showed significantly sparser growth compared to Aspergillus fumigatus AF293, indicating that its growth was much slower. In the 48-hour results, the growth status of the knockout strain △MFSmt also differed from that of Aspergillus fumigatus AF293, with the knockout strain △MFSmt exhibiting a lower density. This indicates that the MFSmt gene is involved in the normal growth rate and growth status of Aspergillus fumigatus strains.

[0055] 2. Drug drop plate

[0056] The specific methods are as follows;

[0057] 1) Prepare RPMI-1640 solid medium containing the drug. Prepare RPMI-1640 solid medium as above. Dispense the prepared medium into different flasks and autoclave them. Before pouring into Petri dishes, calculate the volume of voriconazole (VOR) and amphotericin B (AMB) solution to be added according to the volume of the medium in the flask, so that the concentration of VOR and AMB in the medium is 0.125 μg / ml. After adding the drug solution, mix well, pour into Petri dishes, and after cooling and solidification, you will get RPMI-1640 solid medium containing the required drug concentration.

[0058] 2) To prepare bacterial suspensions of the two strains, the concentrations need to be adjusted to five gradients using physiological saline, 1×10⁻⁶ each. 6 CFU / ml, 1×10 5 CFU / ml, 1×10 4 CFU / ml, 1×10 3 CFU / ml, 1×10 2 CFU / ml, corresponding to each concentration, was measured in 1 μl. The two control groups of strains were spotted onto petri dishes containing voriconazole and amphotericin B, respectively. After drying, the petri dishes were incubated at 35℃ for 48-72 hours before the results were read. To minimize error, this experiment needed to be repeated three times on different days. The results are as follows: Figure 5 As shown, compared to Aspergillus fumigatus AF293, the knockout strain △MFSmt had a smaller colony diameter at the same concentration. Compared to Aspergillus fumigatus AF293, the knockout strain △MFSmt showed increased sensitivity to voriconazole and decreased sensitivity to amphotericin B. This indicates that the MFSmt gene can reduce the sensitivity of Aspergillus fumigatus to voriconazole and enhance its sensitivity to amphotericin B.

[0059] Example 4: Growth rate detection of knockout plants after MFSmt gene knockout

[0060] The knockout strain △MFSmt obtained in Example 2 and the wild-type strain AF293 (control group) were used, and their bacterial suspensions were adjusted to a concentration of 1×10⁻⁶ in Sabouraud dextrose liquid medium. 4CFU / ml, cultured in a shaker at 130 rpm / min and 37℃. 1 ml samples were taken at 0 h, 1 h, 2 h, 4 h, 8 h, 12 h, 16 h, 18 h, and 20 h, and placed separately. The bacterial culture samples at each time point were then added to 96-well plates, 100 μl per well, with three replicates per time point. The absorbance at 450 nm was measured using a microplate reader, and growth curves of *Aspergillus fumigatus* AF293 and the knockout strain ΔMFSmt were plotted based on the values. The results are as follows: Figure 6 As shown, compared to Aspergillus fumigatus AF293, the growth rate of ΔMFSmt is slower. This indicates that the MFSmt gene is involved in the normal growth rate of Aspergillus fumigatus.

[0061] application

[0062] 1. Targeted drugs against the MFSmt gene can be designed, meaning the drug only works against the MFSmt gene. By designing drugs to cause MFSmt gene deletion or a decrease in the expression of the protein encoded by the MFSmt gene, and then combining this drug with voriconazole while avoiding the use of amphotericin B, the antifungal effect of voriconazole can be enhanced.

[0063] 2. It can be used to screen new drugs and develop better treatment regimens. By targeting novel drugs to Aspergillus fumigatus strains, labeling the MFSmt gene, and detecting the expression level of the MFSmt gene in Aspergillus fumigatus strains, drugs that reduce MFSmt gene expression can be screened. In clinical treatment, this drug is used in combination with voriconazole, while avoiding the combination with amphotericin B, to achieve better antifungal treatment effects.

[0064] The discovery of the *Aspergillus fumigatus* monocarboxylic acid transporter gene MFSmt revealed the role of voriconazole in the treatment of opportunistic pathogens like *Aspergillus fumigatus*: deletion of the MFSmt gene led to increased resistance to amphotericin B and increased susceptibility to voriconazole. This finding suggests that in clinical treatment, combining voriconazole with drugs that cause MFSmt gene deletion or decreased protein expression may yield more effective bactericidal results, while the use of amphotericin B should be avoided to prevent the development of resistance. This finding has significant clinical value for determining treatment regimens and controlling drug-resistant strains in the effective treatment of clinical *Aspergillus fumigatus* infections.

Claims

1. Knock out Aspergillus fumigatus ( Aspergillus fumigatus The monocarboxylic acid transporter MFSmt gene in Aspergillus fumigatus plays a role in enhancing the activity of Aspergillus fumigatus (…). Aspergillus fumigatus Its application in the sensitivity of voriconazole is characterized by: The nucleotide sequence of the monocarboxylic acid transporter MFSmt gene is shown in SEQ ID NO.

1. The application does not involve the diagnosis and treatment of diseases.