Upconversion fluorescent chromatographic test paper for detecting azaspirocycle acid and preparation method thereof

Abstract

The application discloses a preparation method of an up-conversion fluorescent chromatographic test strip for detecting azaspiracids (AZA), and belongs to the field of analytical chemistry, environment and food safety detection. The test strip comprises a sample pad, a binding pad, a nitrocellulose membrane, an absorption pad, a back plate, a detection line and a quality control line. The method utilizes up-conversion nanoparticles to improve the fluorescence intensity and reduce the background signal, and utilizes the conformational change of nucleic acid aptamer to realize the optical signal change of the detection line, thereby realizing the rapid quantitative detection of AZA. The test strip has the advantages of short detection time, simple operation, high specificity and high sensitivity, and has important significance for the detection of AZA in marine shellfish.

Description

Technical Field

[0001] This invention relates to the fields of analytical chemistry, environmental and food safety testing technology, and specifically to an upconversion fluorescence chromatography test strip for rapid quantitative detection of azepamoic acid and its preparation method. Background Technology

[0002] With the development of human industrialization, eutrophication of water bodies leads to frequent red tides in the global oceans, and harmful algae and their related marine algal toxins pose a serious threat to human health. Marine algal toxins are natural organic compounds produced by toxic algae in the ocean. After shellfish filter-feed these toxic microalgae, they are bioaccumulated and amplified, transforming into shellfish toxins. These toxins accumulate in the shellfish's body and are eventually released into the human body after consumption, causing corresponding food poisoning symptoms such as vomiting, severe diarrhea, and limb paralysis, and in severe cases, death. In particular, with the increasing consumption of shellfish each year, shellfish food poisoning incidents are becoming more frequent, seriously endangering consumers' health and safety. Researching how to efficiently detect marine toxins has become a current focus of attention. Currently, traditional analytical techniques are no longer able to meet the market demand for rapid delivery of shellfish products from harvest to table in terms of timeliness and portability. This will place new demands on the rapid detection of shellfish toxins in terms of detection speed, accuracy, and portability.

[0003] Azaspiracids (AZAs) are a class of lipophilic marine toxins with molecular weights ranging from 716 to 902 Da. More than 30 analogues exist, produced by phytoplankton through biotransformation in shellfish, or as byproducts of AZAs-contaminated shellfish during storage or cooking. AZA-1, AZA-2, and AZA-3 are the three most common AZA toxins. The identification of AZAs as a food safety issue is relatively new; the first human AZA poisoning incident was reported in the Netherlands in 1995. Currently, AZAs toxins have been detected in shellfish and marine organisms from the United States, Japan, and my country.

[0004] Traditional methods for detecting AZAs include mouse bioassays and liquid chromatography-tandem mass spectrometry (LC-MS / MS). LC-MS / MS, with its high specificity and sensitivity, serves as a reference method for AZAs analysis. Immunologically based analytical methods, such as enzyme-linked immunosorbent assays (ELISA), immunosensors, and immunolateral chromatography, rely on antibodies, which suffer from high synthesis costs and poor stability, leading to false positive or false negative results. While these methods can effectively provide accurate information for AZAs detection, most existing detection technologies require lengthy sample preparation and extraction procedures before analysis. Therefore, there is an urgent need for novel biorecognition molecules and detection methods with high sensitivity, strong specificity, and ease of operation to meet the rapidly growing market demand for rapid detection of AZAs.

[0005] Fluorescence chromatography is a powerful tool for point-of-care testing, offering advantages such as ease of operation, visualization, and user-friendliness. Researchers have developed various novel nanomaterials (upconversion luminescent materials, quantum dots, carbon dots, etc.) to improve the analytical performance of traditional chromatography techniques. Among them, lanthanide-doped upconversion nanoparticles (UCNPs) possess unique physicochemical properties such as large Stokes shift, high color purity, and good chemical stability. They can convert near-infrared excitation into strong visible fluorescence emission, offering advantages such as avoiding background fluorescence and improving photostability.

[0006] Nucleic acid aptamers are single-stranded DNA (ssDNA) or RNA molecules that function similarly to antibodies. Due to their sequence-specific target-binding function, they are considered "chemical antibodies" and possess advantages such as conformational change, high stability, specificity, and uniform activity. They have attracted widespread attention in food safety testing and rapid detection of toxic and harmful small molecules. The synthetic feasibility of nucleic acid aptamers makes them easy to modify and label, providing excellent flexibility for the development of point-of-care testing. Based on the rapid development of nucleic acid aptamer analysis technology and its application in the field of food safety, a new solution has been provided for the detection of small molecule toxins (AZAs).

[0007] This invention uses superconversion nanoparticles and AZA-1 nucleic acid aptamers as raw materials to prepare a chromatographic test strip for rapid detection of AZA-1, aiming to obtain an AZA-1 detection method with higher sensitivity, stronger specificity, and simpler operation. Summary of the Invention

[0008] In response to at least one deficiency of the prior art, this invention provides a method for preparing and applying an AZA-1 rapid test strip based on an upconversion nanobioprobe composed of upconversion nanoparticles and AZA-1 nucleic acid aptamers. This method combines the advantages of fluorescent chromatography test strips, nanobioprobes, and their nucleic acid aptamers to prepare a rapid, simple, highly sensitive, and highly specific AZA-1 test strip for application in the detection of shellfish.

[0009] The technical solution adopted in this invention is a method for preparing an upconversion fluorescence chromatography test strip for detecting azaspirocyclic acid, comprising the following steps:

[0010] (1) Preparation of upconversion nanoparticles

[0011] To prepare NaYF4:Er,Tm nanoparticles, 1 mmol of lanthanide chloride was mixed with 6 mL of oleic acid and 15 mL of octadec-1-ene in a 100 mL three-necked round-bottom flask. The mixture was slowly heated to 160 °C and stirred under an argon atmosphere for 30 minutes to form a homogeneous solution. The solution was then cooled to room temperature. 2.5 mmol of HF was added dropwise to a methanol solution of 4 mmol of NaOH and NH4F·, and the mixture was slowly heated to 120 °C under an argon atmosphere until the methanol evaporated. The mixture was then heated to 300 °C and held at this temperature for 1.5 hours. After cooling to room temperature, NaYF4:Er,Tm nanoparticles were precipitated with 10 mL of acetone, washed with ethanol, and the obtained UCNPs upconversion nanoparticles were redispersed in cyclohexane.

[0012] (2) Preparation of UCNPs@mSiO2 nanoparticles

[0013] Take 4 mL of synthesized UCNPs, wash with cyclohexane and centrifuge for 15 min; transfer the precipitate to 40 mL of CTAB solution and stir vigorously for 30 min; slowly heat the mixture to 85 °C, while sonicating the solution and alternately shaking to disperse the UCNPs; add 2 mL of ammonia water to the mixture and react for 15 min; add 8 mL of ethanol and 0.64 mL of tetraethyl orthosilicate (TEOS) and stir vigorously, reacting at 70 °C for 5 h; centrifuge to collect the nanoparticles, wash with ethanol several times to collect the product, and finally extract with methanol-NaCl solution for 3 h to remove the CTAB model; by controlling the ratio of reactants, silica is regularly grown on the surface of UCNPs to obtain UCNPs@mSiO2 nanoparticles with different silica thicknesses;

[0014] (3) Preparation of nanobioprobes

[0015] An AZA-1 nucleic acid aptamer-UCNPs@mSiO2 bioprobe was prepared using a condensation reaction. After centrifugation, the modified UCNPs@mSiO2 was activated by adding 120 μL of 2 mg / mL EDC and 60 μL of 2 mg / mL NHS to the surface-modified carboxyl groups. After standing for 2 h, 400 μL of 2 nmol / mL AZA-1 aptamer solution was added, and the mixture was incubated overnight. The precipitate was collected by centrifugation, washed with PBS, and the prepared AZA-1 upconversion nanobioprobe (A-UCNPs@mSiO2) specifically recognizing AZA-1 was resuspended in Tris-HCl buffer for later use.

[0016] (4) The prepared A-UCNPs@mSiO2 solution from step (3) was sprayed onto glass fibers in a 500 μL-1 mL sprayer, and then dried at 40 °C for 12 h to obtain the bonding pad.

[0017] (5) On the nitrocellulose membrane, a test line is drawn at the end near the conjugation pad using the complementary strand of the AZA-1 aptamer modified with incubated biotin and streptavidin, and a quality control line is drawn at the end near the absorbent pad using streptavidin.

[0018] (6) The sample pad, conjugation pad, nitrocellulose membrane and absorption pad are sequentially overlapped on the PVC backing to obtain the upconversion fluorescence chromatography test strip for detecting azirocyclocycline.

[0019] Preferably, both the sample pad and the conjugate pad are made of glass fiber, with the sample pad measuring 20mm × 30cm and the conjugate pad measuring 13mm × 30cm.

[0020] Preferably, the AZA-1 specific aptamer sequence is: 5′

[0021] -ATACCAGCTTATTCAATT-CGGTGAGTTAGACAAGCGCTTGCA-AGATAGTAAGTGCAATCT-3′.

[0022] Preferably, the 1 mmol of lanthanide chloride is 0.78 mmol of YCl3, 0.2 mmol of YbCl3, and 0.02 mmol of ErCl3.

[0023] The beneficial effects of the present invention are: (1) This method uses upconversion nanoparticles to increase fluorescence intensity and reduce background signal, and at the same time uses the conformational change of nucleic acid aptamers to realize the optical signal change of the detection line, thereby achieving sensitive and rapid detection of AZA;

[0024] (2) The test strip test card has a short detection time for AZA-1, and the test results can be obtained within 15 minutes; it is simple to operate, highly specific and sensitive, which can improve the on-site detection efficiency.

[0025] (3) AZA-1 can be quantitatively detected and analyzed using a fluorescence quantitative analyzer, which is of great significance for the detection of AZA in marine shellfish. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of the test strip of the present invention.

[0027] Figure 2 These are the different fluorescence signals of AZA-1 in this invention on 0-120 ng / L NC membranes.

[0028] Figure 3 This is a photograph of the AZA-1 detection card of the present invention.

[0029] Figure 4 The H of AZA-1 at different concentrations in this invention T / H C Values ​​and their CV values. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The components of the embodiments of the present invention described and shown in the accompanying drawings can generally be arranged and designed in various different configurations.

[0031] The technical solution of this invention is as follows: A rapid quantitative upconversion fluorescence chromatography test strip for the detection of azirocycloacids is adopted, comprising a sample pad, a conjugate pad, a nitrocellulose membrane, an absorbent pad, a PVC backing, a detection line, and a control line; the sample pad, conjugate pad, nitrocellulose membrane, and absorbent pad are sequentially attached to the PVC backing; the detection line (T line) and the control line (C line) are sequentially set on the nitrocellulose membrane. The preparation process of the conjugate pad is as follows: firstly, NaYF4:Er,Tm upconversion nanoparticles (UCNPs) are prepared by a solvothermal method, and then silica is modified on its surface by the Stobel method to obtain UCNPs@mSiO2. Then, a condensation reaction is used to form a functionalized AZA-1 nucleic acid aptamer-UCNPs@mSiO2 biological probe; wherein the AZA-1 specific aptamer sequence is: 5′ATACCAGCTTATTCAATTCGGTGAGTTAGACAAGCGCTTGCAAGATAGTAAGTGCAATCT-3′. The T-line was drawn on the nitrocellulose membrane near the conjugation pad using the complementary strand of the AZA1 aptamer modified with incubated biotin and streptavidin, and the C-line was drawn on the end near the absorbent pad using streptavidin.

[0032] The preparation method of the upconversion fluorescence chromatography test strip for rapid quantitative detection of azirocycloacids is carried out according to the following steps:

[0033] (1) Preparation of upconversion nanoparticles

[0034] To prepare NaYF4:Er,Tm nanoparticles, 1 mmol of lanthanide chlorides (YCl3 (0.78 mmol), YbCl3 (0.2 mmol), and ErCl3 (0.02 mmol)) was mixed with oleic acid (6 mL) and octadec-1-ene (15 mL) in a 100 mL three-necked round-bottom flask. The mixture was slowly heated to 160 °C and stirred under an argon atmosphere for 30 minutes to form a homogeneous solution. The mixture was cooled to room temperature; HF (2.5 mmol) was added dropwise to a methanol solution of NaOH (4 mmol) and NH4F·, and the mixture was slowly heated to 120 °C under an argon atmosphere until the methanol evaporated. Finally, the mixture was heated to 300 °C and held at this temperature for 1.5 hours. After cooling to room temperature, NaYF4:Er,Tm nanoparticles were precipitated with acetone (10 mL), washed three times with ethanol, and the obtained upconversion nanoparticles (UCNPs) were redispersed in cyclohexane.

[0035] (2) Preparation of UCNPs@mSiO2 nanoparticles

[0036] Take 4 mL of the synthesized UCNPs, wash with cyclohexane and centrifuge for 15 min. Transfer the precipitate to 40 mL of CTAB solution and stir vigorously for 30 min. To remove cyclohexane, slowly heat the mixture to 85 °C while sonicating the solution and alternately shaking to disperse the UCNPs. Then, add 2 mL of ammonia to the mixture and react for 15 min. Add 8 mL of ethanol and 0.64 mL of tetraethyl orthosilicate (TEOS) and stir vigorously, reacting at 70 °C for 5 h. Centrifuge to collect the nanoparticles, wash the product several times with ethanol, and finally extract with methanol-NaCl solution for 3 h to remove the CTAB model. By controlling the proportion of reactants, silica is regularly grown on the surface of UCNPs, obtaining upconversion nanoparticles (UCNPs@mSiO2) with different silica thicknesses.

[0037] (3) Preparation of nanobioprobes

[0038] AZA-1 nucleic acid aptamer-UCNPs@mSiO2 bioprobe was prepared using a condensation reaction. After centrifuging the modified UCNPs@mSiO2 (12000 rpm, 20 min), EDC (2 mg / mL, 120 μL) and NHS (2 mg / mL, 60 μL) were added to activate the surface-modified carboxyl groups. After standing for 2 h, AZA-1 aptamer solution (2 nmol / mL, 400 μL) was added, and the mixture was incubated overnight. After centrifugation (15000 rpm, 15 min), the precipitate was collected, washed with PBS, and the prepared A-UCNPs@mSiO2 was resuspended in Tris-HCl buffer for later use.

[0039] (4) Assembly of the test card

[0040] The detection card based on upconversion nanoparticle-nucleic acid aptamer technology consists of five parts: a sample pad, a conjugation pad, a nitrocellulose (NC) membrane, an absorbent pad, and a PVC backing. Both the sample pad (20 mm × 30 cm) and the conjugation pad (13 mm × 30 cm) are made of glass fiber. First, the sample pad is blocked with blocking buffer (0.01 M PBS (pH 7.4) containing 2% PEG6000, 1% BSA, and 2% Tween-20) and then dried overnight at 40°C. The desired volume of nanoparticles is sprayed onto the glass fiber using a spray pad sprayer and then dried at 40°C for 12 hours to obtain the conjugation pad. The sample pad, conjugation pad, NC membrane, and absorbent pad are sequentially stacked on the PVC backing to form a layered structure (see [link to relevant documentation]). Figure 1 Then, use a strip cutter to cut it into 4mm wide strips, assemble them into AZA-1 test cards, and store them in a drying room for later use.

[0041] The detection principle and specific steps of the AZA-1 rapid detection fluorescent test strip based on upconversion nanoparticles-nucleic acid aptamers are as follows: First, the AZA-1 specific nucleic acid aptamer (AA) is condensed with UCNPs@mSiO2 to obtain the biological probe A-UCNPs@mSiO2. Two additional biotin-modified DNA sequences are designed: one partially complementary to the AZA-1 nucleic acid aptamer, abbreviated as AT; the other is a 16-base sequence, abbreviated as AC. AT and AC can respectively partially complementarize with the AA sequence on the biological probe. After the biotin labeled on AT and AC binds to streptavidin, these two DNA sequences are dispersed onto the nitrocellulose membrane of the test strip using a spray membrane device, serving as the markers for the detection line (T line) and control line (C line) of the test strip. When no analyte is present, due to DNA sequence complementarity, the AA sequence on A-UCNPs@mSiO2 is complementary to the AT and AC sequences on the T and C lines, respectively. UCNPs@mSiO2 is trapped on these two lines, and two detection signals can be observed under near-infrared light. When an analyte is present, due to the recognition of the analyte by the nucleic acid aptamer, the AA nucleic acid aptamer on A-UCNPs@mSiO2 can specifically bind to the analyte, hindering its complementarity with the AT sequence on the T line. However, this process does not affect the complementarity between the 16 A bases on the C line and the 16 T bases on the nucleic acid aptamer. Therefore, the signal on the T line will become fainter or even disappear, while the signal on the C line remains unaffected. Based on the difference in the T line signal before and after the addition of the analyte, the signal on the detection card is read using a quantitative fluorescence detector to quantify the fluorescence intensity, thereby calculating the content of AZA-1 in the sample.

[0042] Example 1: Determination of AZA-1 standard solution using a test card

[0043] First, AZA-1 standard solutions with concentrations of 0, 1, 5, 10, 25, 50, 80, and 120 ng / mL were prepared. Each concentration was tested 10 times using a self-made detection card and detected by a quantitative fluorescence detector. A standard curve was plotted based on the collected data. The LoD value is equal to the average value of the blank samples detected using the AZA-1 detection card plus three times the standard deviation.

[0044] like Figure 2 As shown, different positions of the NC membrane on the detection card exhibit different fluorescence signal intensities, with the strongest signal observed in the T-line region. The corresponding results can be visually observed on the detection card (see...). Figure 3 Based on H T / H C The relative fluorescence intensity of the test card decreases with increasing AZA-1 concentration, such as... Figure 4 As shown. Figure 4This indicates that, under optimized parameters, this analytical method yields reliable results. As a standard for diagnosing shellfish toxins, the detection of AZA-1 requires high sensitivity. The calculated LoD value was determined to be 5.8 ng / mL. The analytical method based on UCNPs@mSiO2 as a fluorescent probe exhibits excellent analytical performance and meets the LoD requirements for POCT detection.

[0045] Example 2: Performance Analysis of the AZA-1 Detection Card

[0046] (1) Specificity

[0047] The specificity of the test card was evaluated by adding real shellfish samples to AZA-1 samples at concentrations of 2.70 ng / mL and 30.80 ng / mL, respectively. AZA-1 samples without added interferon served as a control group. The interferons included: Ōta-sponge acid (6.00 ng / mL), clam toxin (12.00 ng / mL), and bryophyte toxin (25.00 ng / mL).

[0048] As shown in Table 1, the specificity of the test card was evaluated using two different concentrations of AZA-1 to obtain reliable results. The results showed that the relative deviation (RD) of the test card after adding ooda-sponge acid, clam toxin, and bryophylloidin was all within ±10%, indicating that the effect of interferon was not significant, and the test card had high specificity for AZA-1, demonstrating that the specificity of this technique is acceptable.

[0049] Table 1. Effects of different interferons on the specificity of AZA-1

[0050]

[0051] Note: RD=(Value-Standard value) / Standard value

[0052] (2) Precision

[0053] The precision of the test cards was evaluated using AZA-1 samples at three concentration levels (6.25, 20.15, and 50.60 ng / mL). Thirty test cards from the same batch were used to detect AZA-1 at different concentration levels, with 10 cards tested for each concentration. Data were recorded, and the intra-batch measurement precision of the test cards was evaluated by calculating the coefficient of variation (CV).

[0054] For inter-batch measurement precision, three test cards were randomly selected from each of three different batches to test one concentration of AZA-1. Similarly, the tests for the other two concentrations were performed, and the data were recorded and the CV was calculated.

[0055] The results are shown in Table 2. At AZA-1 concentrations of 6.25 and 20.15 ng / mL, the calculated coefficients of performance (CVs) for both intra-assay precision and inter-assay precision were less than 5%, and the CV was less than 10% at an AZA-1 concentration of 50.60 ng / mL. These results indicate that this immunochromatographic technique exhibits good accuracy and is suitable for the on-site quantitative detection of AZA-1.

[0056] Table 2 Precision test results of AZA-1 test card

[0057]

[0058] (3) Stability

[0059] In practical applications, stability is a crucial parameter in performance analysis. In this work, the stability of the test cards was investigated through storage and accelerated testing. The specific procedures were as follows: A batch of test cards was assembled according to optimized parameters and stored in a desiccant oven at 50°C. Test cards stored in the 50°C desiccant oven were collected on days 7, 14, and 21 for testing AZA-1 (1.0, 5.0, 10.0, 25.0, and 50.0 ng / mL), and the data were recorded. The long-term shelf life of the test cards was evaluated through accelerated testing.

[0060] The experimental results are listed in Table 3. We can observe that after a period of storage at 50℃, the test card showed good performance in the determination of AZA-1, indicating that the test card can still maintain high stability under high temperature conditions, which shows that the test card has the performance of long-term room temperature storage.

[0061] Table 3 Stability analysis of the test card

[0062]

[0063] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A method for the preparation of an upconversion fluorescent lateral flow test strip for the detection of azaspirocycle acids, characterized by: Comprising the following steps: (1) Preparation of upconversion nanoparticles Preparation of NaYF4:Er, Tm nanoparticles, 1 mmol of lanthanide chloride was mixed with 6 mL of oleic acid and 15 mL of octadec-1-ene in a 100 mL three-necked round-bottom flask, the mixture was slowly heated to 160 °C, and stirred under argon atmosphere for 30 minutes to form a homogeneous solution; cooled to room temperature; 4 mmol of NaOH and NH4F·methanol solution was added dropwise 2.5 mmol of HF, and the mixture was slowly heated to 120 °C under argon atmosphere until the methanol evaporated; the mixture was heated to 300 °C and kept at this temperature for 1.5 hours, cooled to room temperature, and the NaYF4:Er, Tm nanoparticles were precipitated with 10 mL of acetone, washed with ethanol, and the obtained UCNPs upconversion nanoparticles were redispersed in cyclohexane; (2) Preparation of UCNPs@mSiO2 nanoparticles Take 4 mL of synthesized UCNPs, wash with cyclohexane and centrifuge for 15 minutes; transfer the precipitate to a 40 mL CTAB solution while stirring vigorously for 30 min; slowly heat the mixture to 85 °C while ultrasonically treating the solution and alternately shaking for dispersion of UCNPs; add 2 mL of ammonia water to the mixture and react for 15 min; add 8 mL of ethanol and 0.64 mL of tetraethyl orthosilicate TEOS and stir vigorously, react at a temperature of 70 °C for 5 hours; centrifuge to collect the nanoparticles, use ethanol to wash 3 times to collect the product, and finally use a methanol-NaCl solution to extract for 3 h to remove the CTAB model; by controlling the proportion of reactants, the silica is regularly grown on the surface of UCNPs, and UCNPs@mSiO2 nanoparticles with different silica thicknesses are obtained; (3) Preparation of nanobiosensors The AZA-1 aptamer-UCNPs@mSiO2 biosensor was prepared by condensation reaction; after centrifugation of the modified UCNPs@mSiO2, 120 μL of EDC with a concentration of 2 mg / mL and 60 μL of NHS with a concentration of 2 mg / mL were added to activate the surface modified carboxyl group, and the mixture was allowed to stand for 2 h, 400 μL of AZA-1 aptamer solution with a concentration of 2 nmol / mL was added, and the mixture was incubated overnight; Centrifuge, collect the precipitate, wash with PBS, and resuspend the prepared AZA-1 specific recognition AZA-1 upconversion nanobiosensor A-UCNPs@mSiO2 in Tris-HCl buffer for use; the sequence of the AZA-1 specific aptamer is: 5'-ATACCAGCTTATTCAATT-CGGTGAGTTAGACAAGCGCTTGCA-AGATAGTAAGTGCAATCT-3'; (4) The prepared A-UCNPs@mSiO2 solution in step (3) is sprayed by a spray pad instrument to spray 500 μL - 1 mL of nanoparticles on a glass fiber, and then dried at 40°C for 12 h to obtain a combination pad; (5) The complementary strand of the incubated biotin and streptavidin modified AZA-1 aptamer is used to draw a test line on one end of the nitrocellulose membrane close to the combination pad, and streptavidin is used to draw a quality control line on the end close to the absorbent pad; (6) The sample pad, the combination pad, the nitrocellulose membrane and the absorbent pad are sequentially overlapped on a PVC back plate to obtain the upconversion fluorescence chromatography test strip for detecting azaspiro acid.

2. The preparation method of the upconversion fluorescent chromatographic test strip for detecting azaspirocycle acid according to claim 1, characterized in that: The sample pad and the combination pad are both made of glass fiber, the size of the sample pad is 20 mm×30 cm, and the size of the combination pad is 13 mm×30 cm.

Images