KPC-type Carbapenemase Gene Detection Kit, Composition and Its Application
The KPC type carbapenemase gene was detected by PCR-CRISPR-Cas13a system, and the RNA enzyme cleavage activity of specific crRNA and Cas13a protein was used to achieve rapid, sensitive and simple detection, solving the high detection cost and time-consuming problems in the prior art, and is suitable for the rapid clinical identification of carbapenemase-producing strains.
Patent Information
- Application Number
- CN202111672573.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-12-31
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2041-12-31
AI Technical Summary
The existing technology cannot quickly, accurately and easily detect KPC type carbapenemase genes, and commonly used methods require large-scale instruments, which are expensive and difficult to promote.
PCR technology combined with CRISPR-Cas13a system was used to design specific crRNA to target KPC-type carbapenemase gene, and use the RNase cleavage activity of Cas13a protein to detect the KPC-type carbapenemase gene, and report the results through fluorescence signals.
It has achieved rapid, sensitive and simple detection of KPC type carbapenemase gene, with high specificity and high sensitivity, and is suitable for the rapid clinical identification of carbapenemase-producing strains and guides reasonable antibiotic treatment.
Smart Images

Figure BDA0003449964650000061 
Figure BDA0003449964650000071 
Figure BDA0003449964650000081
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a KPC-type carbapenemase gene detection kit, a composition and their applications. Background Art
[0002] Carbapenem antibiotics are a class of broad-spectrum β-lactam antibiotics. Because of their broad antibacterial spectrum and strong antibacterial effect, they have become one of the main antibacterial drugs for treating severe bacterial infections and are considered to be the last line of defense against multi-drug resistant Gram-negative bacilli infections since the 1980s. In recent years, with the increase in unreasonable drug use such as improper and excessive use of broad-spectrum antibacterial drugs in clinical practice, the resistance rate to carbapenem antibiotics has also accelerated. Currently, the main bacteria resistant to carbapenem antibiotics are Enterobacteriaceae bacteria, and the main mechanism of resistance is the production of a hydrolase that can hydrolyze carbapenem antibiotics, namely carbapenemase. According to the Ambler classification method, it can be divided into three categories (classes A, B, and D). Class A enzymes include KPC, GES, SME, etc., class B enzymes include NDM, IMP, VIM, etc., and class D enzymes include OXA-48, etc. Although there are many types, the following 5 carbapenemases are mainly prevalent globally: KPC (Klebsiella Pneumoniae Car-bapenemase, KPC), NDM (New Delhi Metallo-β-Lactamases, NDM), VIM (Verona integron-encoded Metallo-β-Lactamases, VIM), IMP (Imipenem-resistant Pseudomonas), OXA-48 (Oxacillin-hydrolysing carbapenemase). KPC-type carbapenemase is a relatively prevalent carbapenemase in China, followed by NDM-type carbapenemase.
[0003] Currently, the commonly used phenotypic detection methods for carbapenemase in laboratories include: modified Hodge test, imipenem-EDTA double disc synergy test for group B carbapenemase, Carba-NP confirmation test recommended by CLSI, and carbapenem inactivation method (CIM) test. However, the above detection methods not only cannot know the specific carbapenemase genotype, but also the detection process takes 24 - 96 hours. Commonly used genotypic detection methods for carbapenemase include: traditional PCR method, fluorescence quantitative PCR method, whole genome sequencing, etc. However, these detection methods rely on large-scale instrument equipment, resulting in extremely high detection costs and severely limiting their use and promotion.
[0004] In recent years, gene editing technologies have developed rapidly, and gene editing systems of different subtypes of CRISPR-Cas have expanded their applications in clinical detection, basic research, and the biomedical field. The CRISPR-Cas system is divided into two major categories. Cas13a is an effector protein in the second major category, type VI system, which has RNA-mediated RNase activity. It can specifically target and cleave single-stranded RNA and remain active after cleavage to continue cleaving other non-target RNAs. This property is called "collateral cleavage". Utilizing this collateral cleavage activity of Cas13a, it is applied to molecular diagnostic detection. By adding a single-stranded RNA probe containing a reporter group to the detection system, when Cas13a recognizes the presence of the target sequence, it will enter an enzymatically "activated" state, and then cleave the single-stranded RNA probe to release the fluorescent reporter group, emitting a fluorescent signal to achieve the purpose of detecting the target sequence. Summary of the Invention
[0005] The technical problem to be solved by the present invention is how to accurately, sensitively, simply, and rapidly detect the KPC-type carbapenemase gene. The technical problems to be solved are not limited to the described technical themes, and those skilled in the art can clearly understand other technical themes not mentioned herein through the following description.
[0006] To solve the above technical problems, the present invention first provides a composition for detecting the KPC-type carbapenemase gene. The composition includes a primer pair for specifically amplifying the KPC-type carbapenemase gene and crRNA. The sequence of the crRNA consists of an anchor sequence for binding to the Cas13a protein and a guide sequence targeting the target sequence of the KPC-type carbapenemase gene. The guide sequence can be SEQ ID No.1.
[0007] The nucleotide sequence of the target of the KPC-type carbapenemase gene is SEQ ID No.5, which is located at positions 324-351 of the KPC-type carbapenemase genome (GenBank ID: NG049253.1).
[0008] In the above composition, the nucleotide sequence of the crRNA can be SEQ ID No.2.
[0009] Among them, positions 1-38 of SEQ ID No.2 are the anchor sequence for binding to the Cas13a protein; positions 39-66 of SEQ ID No.2 are the guide sequence targeting the target sequence (SEQ ID No.5) of the KPC-type carbapenemase gene.
[0010] In the above composition, the primer pair consists of primer KPC-F3 and primer KPC-R3. The primer KPC-F3 is a single-stranded DNA molecule shown in SEQ ID No. 3; the primer KPC-R3 is a single-stranded DNA molecule shown in SEQ ID No. 4.
[0011] The present invention also provides a kit for detecting the KPC-type carbapenemase gene, and the kit includes the composition for detecting the KPC-type carbapenemase gene.
[0012] Furthermore, the kit further includes the Cas13a protein.
[0013] In the above kit, the Cas13a protein can exist independently or in the form of a complex with the crRNA of the present invention.
[0014] Furthermore, the Cas13a protein can be the LwCas13a protein.
[0015] Furthermore, the kit further includes the reporter RNA.
[0016] The reporter RNA is an RNA molecule with a signal reporting function, and when the RNA molecule is degraded, it can report a positive signal and be detected.
[0017] In one embodiment of the present invention, the reporter RNA is RNaseAlert TM QC system v2 (Invitrogen TM company product, catalog number 4479769).
[0018] Furthermore, the kit may further include one or more of T7 transcriptase, NTP (such as NTP Mix), RNase inhibitor, RNase-free water, and PCR amplification buffer.
[0019] In one embodiment of the present invention, the PCR amplification buffer is a product of Beijing Bomed Gene Technology Co., Ltd., with the catalog number MT211-02.
[0020] Furthermore, the kit further includes a readable carrier recording the method for detecting the KPC-type carbapenemase gene described herein. The readable carrier can be a kit instruction manual for practicing the method of the present invention (such as a printed instruction manual) or a computer-readable medium (such as a floppy disk, CD, etc.) on which information has been recorded.
[0021] The various reagent components of the kit can be present in separate containers, or can be pre-combined into a reagent mixture in whole or in part.
[0022] The crRNA described herein or the complex of the crRNA and Cas13a protein is also within the scope of protection of the present invention.
[0023] The present invention also provides a method for detecting the KPC-type carbapenemase gene, and the method comprises the following steps:
[0024] A1) Extracting the DNA of the sample to be tested;
[0025] A2) Using the DNA as a template, performing PCR amplification with the primer KPC-F3 and the primer KPC-R3 to obtain an amplification product;
[0026] A3) Detecting by using a CRISPR-Cas13a detection system;
[0027] The CRISPR-Cas13a detection system includes the crRNA.
[0028] In the above method, the CRISPR-Cas13a detection system further includes Cas13a protein and / or transcriptase.
[0029] Furthermore, the CRISPR-Cas13a detection system further includes reporter RNA, NTP (such as NTP Mix), T7 transcriptase, RNase inhibitor, RNase-free water, and a transcription and CRISPR-Cas13a detection reaction buffer;
[0030] Furthermore, in step A2), the reaction conditions for performing the PCR amplification may be: pre-denaturation at 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 45 s, for 35 cycles; extension at 72°C for 10 min.
[0031] Furthermore, the method for detecting by using the CRISPR-Cas13a detection system in step A3) is as follows:
[0032] ① Preparing a transcription and CRISPR-Cas13a detection system containing the following components: the PCR amplification product obtained in step A2), Cas13a protein, crRNA, reporter RNA, NTP, T7 transcriptase, RNase inhibitor, RNase-free water, and a transcription and CRISPR-Cas13a detection reaction buffer; ② Performing the reaction; ③ Detecting the positive signal.
[0033] Furthermore, in step ②, the reaction conditions may be: 37°C, and in step ③, the detection of the positive signal may be: detecting the positive signal once every 2 min for a total of 30 times.
[0034] Further, the method further includes determining whether the test sample contains the KPC-type carbapenemase gene based on the presence or absence of a positive signal, and / or determining the concentration of the KPC-type carbapenemase gene in the test sample based on the strength of the positive signal.
[0035] The determination of whether the test sample contains the KPC-type carbapenemase gene based on the presence or absence of a positive signal is as follows: if there is a positive signal, it is determined that the test sample contains or may contain the KPC-type carbapenemase gene; if there is no positive signal, it is determined that the test sample does not contain or may not contain the KPC-type carbapenemase gene.
[0036] The determination of the concentration of the KPC-type carbapenemase gene in the test sample based on the strength of the positive signal is as follows: the stronger the positive signal, the higher the content of the KPC-type carbapenemase gene in the test sample; the weaker the positive signal, the lower the content of the KPC-type carbapenemase gene in the test sample.
[0037] In this article, the positive signal can be a fluorescence signal. Within the same detection time, if the fluorescence intensity value of the experimental group is more than 1 time higher than the fluorescence intensity value of the negative control (ddH2O), it is determined as a positive result (positive signal).
[0038] Further, the test sample can be a purified colony.
[0039] The present invention also provides any one of the following applications of the composition, and / or the crRNA or complex:
[0040] B1) Application in detecting the KPC-type carbapenemase gene;
[0041] B2) Application in preparing a product for detecting the KPC-type carbapenemase gene;
[0042] B3) Application in identifying carbapenemase-producing strains;
[0043] B4) Application in preparing a product for identifying carbapenemase-producing strains;
[0044] B5) Application in detecting microbial drug resistance;
[0045] B6) Application in preparing a product for detecting microbial drug resistance.
[0046] The product can be a reagent or a kit.
[0047] B5) The detection of microbial drug resistance can be carried out by detecting whether the tested microbial sample contains a carbapenemase gene. If it contains a carbapenemase gene, it indicates that the tested microorganism is likely to be resistant to carbapenem antibiotics. It can further be used to diagnose subjects with carbapenem resistance and to develop appropriate treatment regimens for subjects with bacterial infections, where the treatment is determined based on the presence or absence of carbapenem resistance.
[0048] The microorganism can be a bacterium of the Enterobacteriaceae family, including but not limited to Pseudomonas aeruginosa, Acinetobacter baumannii, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter sp., Salmonella enterica, Escherichia coli, etc.
[0049] The purposes of the above applications and methods can be for disease diagnosis purposes, disease prognosis purposes, and / or disease treatment purposes, and their purposes can also be non-disease diagnosis purposes, non-disease prognosis purposes, and non-disease treatment purposes; their direct purposes can be to obtain information on intermediate results of disease diagnosis results, disease prognosis results, and / or disease treatment results, and their direct purposes can be non-disease diagnosis purposes, non-disease prognosis purposes, and / or non-disease treatment purposes.
[0050] The present invention relates to the field of bacterial detection, and specifically relates to a kit, composition, and their applications for detecting KPC-type carbapenemase genes based on PCR-CRISPR-Cas13a. The present invention discloses a nucleic acid detection technology based on CRIPSR-Cas13a. Its main mechanism is that the Cas13a protein can recognize RNA fragments with a target sequence with the help of a guide RNA, and then the activated sequence-independent RNA enzyme activity is added to the reaction system by adding a signal reporter molecule caused by RNA chain degradation, and finally the signal recognition of the RNA fragment with the target sequence is achieved.
[0051] The method of the present invention for detecting KPC-type carbapenemase genes by combining PCR technology and CRISPR-Cas13a technology provides a specific crRNA targeting this sequence for detecting KPC-type carbapenemase genes through design, construction, and screening. The method provided by the present invention is simple, rapid, and has high sensitivity and specificity. It can be used for the rapid clinical identification of carbapenemase-producing strains, so as to carry out reasonable antibiotic treatment for patients and shorten the treatment cycle. It has very important clinical application prospects and development value. BRIEF DESCRIPTION OF THE DRAWINGS
[0052] Figure 1 It is a diagram of the agarose gel electrophoresis detection result of the PCR amplification product in step four of Example 1.
[0053] Figure 2 Electrophoresis detection result graph of the crRNA transcription template in Step 2 of Example 2.
[0054] Figure 3 Screening result graph of crRNAs (crRNA1, crRNA2, crRNA3, crRNA4, crRNA5) specific to the KPC-type carbapenemase gene.
[0055] Figure 4 Sensitivity detection result graph in Example 4.
[0056] Figure 5 Stability experiment result graph in Example 4. Among them, Sample 3 and Sample 8 are Enterobacter strains producing non-KPC-type carbapenemase detected by the disk diffusion method. Samples 1, 2, 4, 5, 6, and 7 are Enterobacter strains producing KPC-type carbapenemase detected by the disk diffusion method.
[0057] Figure 6 Specificity detection of the KPC-CRISPR-Cas13a detection method. Specific implementation manners
[0058] The present invention will be further described in detail below in conjunction with specific implementation manners. The provided examples are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0059] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.
[0060] The genomic DNA extraction kit in the following examples is a product of Tiangen Biotech (Beijing) Co., Ltd., and the DNA purification and recovery kit (product number DP315), 2×Taq mix (product number MT211-02), and ddH2O are products of Beijing Biomed Gene Technology Co., Ltd.
[0061] The clinical samples used in the following examples are clinical specimens from Beijing You'an Hospital, Capital Medical University.
[0062] Example 1 Preparation of plasmid standards, primer design and screening
[0063] The basic principle of the method for detecting KPC-type carbapenemase gene based on PCR-CRISPR-cas13a provided by the present invention is as follows: First, the KPC-type carbapenemase gene is transcribed into single-stranded RNA, then the target fragment is specifically bound by the crRNA of CRISPR, and finally, the Cas13a enzyme cuts the reporter RNA with a fluorescent signal, and the KPC-type carbapenemase gene is detected through the fluorescent signal.
[0064] I. Preparation of plasmid standard
[0065] First, the conservation analysis of the KPC-type carbapenemase gene sequence is carried out. 84 KPC-type carbapenemase gene sequence information is downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov / ), and the sequences are analyzed by bioinformatics using MEGA7 software. The conserved sequence is the KPC-type carbapenemase gene fragment of SEQ ID No.6. The present invention uses the recombinant plasmid (plasmid pUC57-KPC) carrying the KPC-type carbapenemase gene fragment with the nucleotide sequence of SEQ ID No.6 as the detection template (plasmid standard).
[0066] The recombinant plasmid pUC57-KPC is obtained by replacing the fragment (small fragment) between the EcoRV restriction endonuclease recognition sites of the pUC57 vector with the DNA fragment shown in SEQ ID No.6 in the sequence listing, and keeping the other nucleotide sequences of the pUC57 vector unchanged.
[0067] The KPC-type carbapenemase plasmid pUC57-KPC is synthesized by Bomed Biotech Co., Ltd., and the plasmid concentration is: 200 ng / μL. The plasmid length is 3295 bp.
[0068] Copy number calculation formula: 6.02×10 23 ×200 (ng / μL)×10 -9 / 3295×660 = 5.5×10 10 Copies / μL
[0069] Dilution: Take 4 μL of the plasmid into 18 μL of water to obtain a plasmid standard with a concentration of 1×10 10 Copies / μL. Then it is gradient-diluted to 10 9 Copies / μL, 10 8 Copies / μL, 10 7 Copies / μL, 10 6 Copies / μL, 10 5 Copies / μL, 10 4 Copies / μL, 10 3 Copies / μL, 10 2Copies / μL, 10 1 Copies / μL, 10 0 Copies / μL.
[0070] II. Design of PCR Primers
[0071] A primer pair for specifically amplifying the KPC-type carbapenemase gene was designed based on the conserved sequence of the KPC-type carbapenemase gene (SEQ ID No. 6).
[0072] A T7 transcription sequence is present at the 5' end of the primer, enabling the double-stranded DNA (dsDNA) obtained by PCR amplification to be recognized by T7 RNA polymerase and transcribed. The primer sequences are shown in Table 1 and were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0073] Table 1. PCR Amplification Primers for KPC-Type Carbapenemase Gene
[0074] Name Sequence (5’-3’) KPC-F1 <![CDATA aattctaatacgactcactataggg cggtgtgtacgcgatggata]]> KPC-F2 <![CDATA aattctaatacgactcactatagggctccatcggtgtgtacgcga > KPC-F3 <![CDATA aattctaatacgactcactatagggtggcggctccatcggtgtgt > KPC-R1 acggaacgtggtatcgccga KPC-R2 cggttttgtctccgactgcc KPC-R3 tgcagagcccagtgtcagtt
[0075] Note: The underlined part in Table 1 is the T7 transcription sequence.
[0076] III. PCR Amplification
[0077] Using the plasmid standard pUC57-KPC obtained in Step 1 as a template, PCR amplification was performed with the primers designed in Table 1 to obtain a PCR amplification product (KPC amplification product). The PCR amplification system is shown in Table 2.
[0078] Table 2. PCR Amplification System
[0079]
[0080]
[0081] The PCR reaction conditions were: pre-denaturation at 95°C for 5 min, 95°C for 30 s, 55°C for 30 s, 72°C for 45 s, for 35 cycles, and extension at 72°C for 10 min. This PCR amplification product is the KPC amplification product.
[0082] IV. Screening of PCR Primers
[0083] With 10 4Using the plasmid standard pUC57-KPC obtained in Step 1 at [X] copy / μL as a template, perform PCR amplification using the method described in Step 3. The primers are the primer combinations shown in Table 1, in the combination forms of F1R1 (primer KPC-F1 and primer KPC-R1), F2R2 (primer KPC-F2 and primer KPC-R2), and F3R3 (primer KPC-F3 and primer KPC-R3), to obtain PCR amplification products. Set the amplification product with water as a template as a negative control.
[0084] After the PCR is completed, take 5 μL of the amplification product, add 1 μL of 6× Loading Buffer, mix well, and then perform agarose gel electrophoresis detection.
[0085] The detection results are as Figure 1 shown. The results show that the primer combination (primer pair) of primer KPC-F3 and primer KPC-R3 has a higher amplification efficiency. Primer KPC-F3 and primer KPC-R3 are used as the best amplification primer pair for the amplification of the KPC carbapenemase resistance gene.
[0086] The primer pair screened for the specific amplification of the KPC-type carbapenemase gene consists of primer KPC-F3 and primer KPC-R3. The primer KPC-F3 is a single-stranded DNA molecule shown in SEQ ID No.3; the primer KPC-R3 is a single-stranded DNA molecule shown in SEQ ID No.4.
[0087] Example 2 Design and Screening of crRNA
[0088] I. Design of crRNA
[0089] According to the PCR amplification primers (primer KPC-F3 and primer KPC-R3) screened in Example 1 and the sequence alignment analysis results, design 5 crRNAs in the conserved sequence (SEQ ID No.6) of the KPC-type carbapenemase gene: KPC-crRNA-1, KPC-crRNA-2, KPC-crRNA-3, KPC-crRNA-4, KPC-crRNA-5.
[0090] The target sequences of KPC-crRNA-1 are as follows: cccatctcggaaaaatatctgacaacag, located at positions 321-348 of the KPC-type carbapenemase genome (GenBank ID: NG049253.1); the target sequences of KPC-crRNA-2 are as follows: cacccatctcggaaaaatatctgacaac, located at positions 319-346 of the KPC-type carbapenemase genome (GenBank ID: NG049253.1); the target sequences of KPC-crRNA-3 are as follows: catctcggaaaaatatctg acaacaggc, located at positions 323-350 of the KPC-type carbapenemase genome (GenBank ID: NG049253.1); the target sequences of KPC-crRNA-4 are as follows: tcacccatctcggaaaaatatctgacaa, located at positions 318-345 of the KPC-type carbapenemase genome (GenBank ID: NG049253.1); the target sequences of KPC-crRNA-5 are as follows: atctcggaaaaatatctgacaacaggca (SEQ ID No.5), located at positions 324-351 of the KPC-type carbapenemase genome (GenBank ID: NG049253.1).
[0091] The primers required for crRNA preparation are shown in Table 3 below.
[0092] Table 3. Templates and primer sequences required for preparing crRNA
[0093]
[0094] II. Preparation of crRNA
[0095] 1. PCR amplification
[0096] Dilute the primers synthesized in Table 3 with ddH2O to 10 μM and prepare the PCR reaction system. The PCR reaction system is shown in Table 4.
[0097] Table 4. PCR amplification system
[0098] Name Volume KPC-crRNA-F 2μL T7-crRNA-F 2μL KPC-crRNA-R 2μL 2×Taq Mix 25μL <![CDATA[ddH2O]]> 19μL Total Volume 50μL
[0099] The PCR reaction conditions are: heat denaturation at 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 45 s, for a total of 35 cycles; automatic extension at 72°C for 10 min; store the PCR product at 4°C.
[0100] After PCR, 5 μl of the PCR product can be taken, 1 μL of 6× Loading Buffer is added, and after mixing, agarose gel detection is performed. The size of the product obtained is about 130 bp, and the results are as Figure 2 .
[0101] 2. Purification of PCR products
[0102] The PCR product obtained in step 1 is purified using Tris-buffered phenol. The specific steps are as follows: Take 500 μL of Tris-buffered phenol (HaoYang Bio), add an equal volume of chloroform, mix well by shaking and centrifuge briefly, discard the supernatant; Take 130 μL of the phenol-chloroform mixture and add it to the PCR product, mix well and centrifuge at 12,000 rpm for 1 min; Take the supernatant to a new 1.5 mL centrifuge tube, add absolute ethanol so that the ratio of supernatant to ethanol is 3:7 (volume ratio), mix, centrifuge at 12,000 rpm for 10 min, and discard the supernatant; Add 200 μL of 75% ethanol, centrifuge at 12,000 rpm for 10 min, and discard the supernatant (this step is performed three times in total). The obtained precipitate is air-dried at room temperature (about 10 min), add 40 μL of RNase-free water, detect the concentration with a ND5000 ultra-micro spectrophotometer, and store at -20°C.
[0103] 3. Transcription
[0104] Take 1 μg of the purified PCR product obtained in step 2 and transcribe crRNA using a T7 transcription kit (NEB, product catalog number E2050S). The crRNA transcription system is shown in Table 5.
[0105] Table 5. crRNA transcription system
[0106] Name Volume NTP Mix 10μL PCR Product 1μg T7 RNA Polymerase 2μL Nuclease-free Water XμL Total Volume 20μL
[0107] After the above crRNA transcription system is mixed well, transcribe overnight at 37°C, and use DNaseⅠ to remove the excess DNA: Add 20 μL of RNase-free water to the transcription product obtained in the previous step, add 2 μL of DNaseⅠ, mix well, and incubate at 37°C for 15 min.
[0108] 4. Purification of crRNA
[0109] The crRNA obtained by transcription in step 3 of purification according to the Agencourt RNA Clean XP instruction manual (Beckman Coulter) is as follows: Vortex the magnetic beads to mix well. Add 1.8 times the volume of magnetic beads to the transcription product, pipette 10 times or vortex for 30 s to mix the magnetic beads and the transcription system, and let it stand at room temperature for 5 min. Place the reaction system on a magnetic stand and let it stand for 5 - 10 min to separate the magnetic beads. Gently aspirate the liquid in the system, avoiding aspirating the magnetic beads. Add 200 μL of 70% ethanol (prepared with RNase-free water) to the magnetic beads, incubate at room temperature for 30 s, and aspirate the ethanol; repeat this process to wash the magnetic beads, for a total of 3 times. Let the system dry at room temperature to remove the ethanol in the system, about 10 min. Add 50 μL of RNase-free water, vortex for 30 s or pipette 10 times, aspirate the supernatant, place it in a 1.5 mL RNase-free centrifuge tube, and measure the concentration of the purified crRNA with an ND5000 spectrophotometer. Aliquot and store at -80 °C for later use.
[0110] The sequences of the finally obtained five crRNAs are as follows:
[0111] crRNA1:
[0112] GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACcuguugucagauauuuuuccgagaugggcrRNA2:
[0113] GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACguugucagauauuuuuccgagaugggugcrRNA3:
[0114] GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACgccuguugucagauauuuuuccgagaugcrRNA4:
[0115] GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACuugucagauauuuuuccgagaugggugacrRNA5:
[0116] GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACugccuguugucagauauuuuuccgagau(SEQ ID No.2)
[0117] III. Screening of crRNA
[0118] 1. At 10 3Using the plasmid standard pUC57-KPC obtained in Step 1 of Example 1 at a copy number of [[COPY_NUMBER]] per μL as a template, and using the primers KPC-F3 and KPC-R3 in Table 1 (SEQ ID No. 3 and SEQ ID No. 4) as primers, PCR amplification was carried out according to the method in Step 3 of Example 1 to obtain a PCR amplification product.
[0119] 2. After PCR amplification, 5 μL of the amplification product was taken and used to detect the KPC-type carbapenemase gene using different crRNAs according to the method in Example 3. At the same time, the amplification product with water as a template was set as a negative control.
[0120] The detection results showed that when using the KPC plasmid at a concentration of 10 3 as a template, the fluorescence value detected by crRNA5 (SEQ ID No. 2, with the 1st to 38th positions being the anchor sequence for binding to the Cas13a protein and the 39th to 66th positions being the guide sequence for binding to the PCR amplification product) was higher than that detected by the other 4 crRNAs ( Figure 3 ). Therefore, crRNA5 was used as the preferred crRNA for the detection of the KPC-type carbapenemase gene.
[0121] Example 3 Detection of KPC-Type Carbapenemase Gene Based on CRISPR-Cas13a
[0122] I. Preparation of the CRISPR-Cas13a Detection System
[0123] Using the KPC amplification product obtained in Step 3 of Example 1 as a template, the CRISPR-Cas13a detection system was prepared according to Table 6.
[0124] Replacing the PCR product in Table 6 with ddH2O and keeping other reagent components unchanged served as the negative control.
[0125] Table 6. CRISPR-Cas13a Detection System
[0126]
[0127]
[0128] Relevant reagents in Table 6: The LwCas13a protein was from Hangzhou Zhongce Biotechnology Co., Ltd., with the product number R101zc. The NTPMix was a product of BBI company, with the product number B600056-0500. The reporter RNA was RNaseAlert TM QC System v2, specifically from Invitrogen TMThe company's product, with the product number 4479769. It contains reporter RNA that generates a fluorescent signal when degraded. The RNase inhibitor (Murine RNase inhibitor) and T7 RNA polymerase are products of NEB company, with the product numbers M0314S and M0251S respectively. The HEPES Buffer Solution is specifically a product of gibco company, with the product number 15630 - 106.
[0129] II. Fluorescence intensity detection
[0130] Add the above - prepared reaction system into a PCR tube and place it in a fluorescence quantitative PCR instrument. Detect the change of fluorescent signal in the FAM channel. Set the temperature at 37°C and read the fluorescence intensity value every 2 minutes for 30 times. Result determination: If the fluorescence intensity value of the experimental group is more than 1 - fold higher than that of the negative control (ddH2O) within the same detection time, it is determined as a positive result (positive signal).
[0131] Furthermore, determine whether the test sample contains the KPC - type carbapenemase gene according to the presence or absence of the positive signal, and / or determine the concentration of the KPC - type carbapenemase gene in the test sample according to the strength of the positive signal:
[0132] (1) If there is a positive signal, it is determined that the test sample contains or potentially contains the KPC - type carbapenemase gene; if there is no positive signal, it is determined that the test sample does not contain or potentially does not contain the KPC - type carbapenemase gene;
[0133] (2) The stronger the positive signal, the higher the content of the KPC - type carbapenemase gene in the test sample; the weaker the positive signal, the lower the content of the KPC - type carbapenemase gene in the test sample.
[0134] Example 4 Sensitivity, specificity and stability experiments
[0135] I. Sensitivity detection
[0136] Using the gradient - diluted plasmid standard pUC57 - KPC in Example 1 as a template, detect the KPC - type carbapenemase plasmid with different concentrations according to the method in Example 3 to detect the sensitivity of the method of the present invention. The specific steps are as follows:
[0137] 1. Perform PCR amplification on the KPC - type carbapenemase plasmid with different concentrations respectively according to the method in Step 3 of Example 1 to obtain PCR amplification products.
[0138] 2. After PCR amplification, take 5 μL of the amplification product and detect the KPC - type carbapenemase plasmid according to the method in Example 3. Take 10 5The 100-copy / μl plasmid was gradiently diluted to 1 copy / μl, and water was used as a negative control. The method of the present invention (see Example 3) was used as a template for detection. All PCR products were detected by CRISPR-Cas13a using the method of the present invention (see Example 3). The results showed that at 10 copies / μl, the fluorescence value of the negative control was significantly different after 40 minutes of detection, indicating that the sensitivity of the method of the present invention is good and can be as low as 10 copies / μl ( Figure 4 ).
[0139] 2. Stability Test
[0140] The method of the present invention was adopted, and the gradient diluted plasmid standard pUC57-KPC (i.e., the standard prepared in step 1) was used as the sample. Each sample was subjected to 3 repeated experiments (refer to Example 1), and there was no significant difference between the groups (p<0.05). Eight samples from clinical sources were tested 3 times (refer to Example 1), and all 8 samples were from Beijing You'an Hospital. There was no significant difference between the groups (p<0.05), indicating that the method of the present invention has good stability and repeatability ( Figure 5 ).
[0141] Specificity Detection
[0142] Two CRKP strains were obtained from the laboratory of Beijing You'an Hospital. PCR detection showed that they were strains carrying KPC-type carbapenemase genes and NDM-type carbapenemase genes respectively.
[0143] 1. Using DNA extracted from two strains as templates, the method in Example 3 was used to perform detection to verify the specificity of the method of the present invention. The specific steps are as follows:
[0144] (1) Using DNA of a strain carrying a KPC-type carbapenemase gene and DNA of a strain carrying an NDM-type carbapenemase gene as detection templates, PCR amplification was performed according to the method in step 3 of Example 1 to obtain PCR amplification products.
[0145] (2) Take 5 μL of the above amplification product and detect it according to the method in Example 3, and set the amplification product with water as the template as a negative control.
[0146] The CRISPR-Cas13a test results showed that the fluorescence signal of the experimental group carrying the KPC carbapenemase gene strain gradually increased after the reaction started, while the fluorescence intensity in the negative control group (ddH2O) and the experimental group carrying the NDM carbapenemase gene strain did not increase over time. After 30 minutes of detection, the fluorescence intensity of the experimental group carrying the KPC carbapenemase gene was significantly higher than that of the negative control and the group carrying the NDM carbapenemase gene strain ( Figure 6) It shows that the method for detecting KPC-type carbapenemase gene based on the CRISPR-Cas13a system of the present invention has high specificity and no cross-reaction occurs during the detection process.
[0147] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses or improvements to the present invention, including those that deviate from the scope disclosed in this application and are made with conventional techniques known in the art. According to the scope of the following appended claims, some basic features can be applied. SEQUENCE LISTING <110> Beijing You'an Hospital, Capital Medical University <120> Kit, composition for detecting KPC-type carbapenemase gene and its application <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 28 <212> RNA <213> Artificial sequence <400> 1 ugccuguugu cagauauuuu uccgagau 28 <210> 2 <211> 66 <212> RNA <213> Artificial sequence <400> 2 gggauuuaga cuaccccaaa aacgaagggg acuaaaacug ccuguuguca gauauuuuuc 60 cgagau 66 <210> 3 <211> 45 <212> DNA <213> Artificial sequence <400> 3 aattctaata cgactcacta tagggtggcg gctccatcgg tgtgt 45 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 tgcagagccc agtgtcagtt 20 <210> 5 <211> 28 <212> DNA <213> Artificial sequence <400> 5 atctcggaaa aatatctgac aacaggca 28 <210> 6 <211> 619 <212> DNA <213> Artificial sequence <400> 6 gcggaaccat tcgctaaact cgaacaggac tttggcggct ccatcggtgt gtacgcgatg 60 gataccggct caggcgcaac tgtaagttac cgcgctgagg agcgcttccc actgtgcagc 120 tcattcaagg gctttcttgc tgccgctgtg ctggctcgca gccagcagca ggccggcttg 180 ctggacacac ccatccgtta cggcaaaaat gcgctggttc cgtggtcacc catctcggaa 240 aaatatctga caacaggcat gacggtggcg gagctgtccg cggccgccgt gcaatacagt 300 gataacgccg ccgccaattt gttgctgaag gagttgggcg gcccggccgg gctgacggcc 360 ttcatgcgct ctatcggcga taccacgttc cgtctggacc gctgggagct ggagctgaac 420 tccgccatcc caggcgatgc gcgcgatacc tcatcgccgc gcgccgtgac ggaaagctta 480 caaaaactga cactgggctc tgcactggct gcgccgcagc ggcagcagtt tgttgattgg 540 ctaaagggaa acacgaccgg caaccaccgc atccgcgcgg cggtgccggc agactgggca 600 gtcggagaca aaaccggaa 619
Claims
1. A composition for detecting KPC-type carbapenemase gene, characterized in that, The composition comprises a primer pair and a crRNA. The sequence of the crRNA consists of an anchoring sequence for binding to the Cas13a protein and a guide sequence targeting the KPC-type carbapenemase gene target sequence, and the guide sequence is SEQ ID No.1; The primer pair consists of primer KPC-F3 and primer KPC-R3. The primer KPC-F3 is a single-stranded DNA molecule shown as SEQ ID No.3; the primer KPC-R3 is a single-stranded DNA molecule shown as SEQ ID No.
4.
2. The composition according to claim 1, wherein The nucleotide sequence of the crRNA is SEQ ID No.
2.
3. Kit for detecting KPC-type carbapenemase gene, characterized in that, The kit comprises the composition according to claim 1 or 2.
4. The kit according to claim 3, characterized in that, The kit further comprises Cas13a protein.
5. The kit according to claim 3 or 4, characterized in that, The kit further comprises reporter RNA.
6. A method for detecting KPC-type carbapenemase gene for non-disease diagnosis and treatment purposes, characterized in that, The method comprises the following steps: A1) Extracting the DNA of the sample to be tested; A2) Using the DNA as a template, performing PCR amplification with the primer KPC-F3 and primer KPC-R3 described in claim 3 to obtain an amplification product; A3) Performing detection using the CRISPR-Cas13a detection system; The CRISPR-Cas13a detection system comprises the crRNA described in claim 1 or 2.
7. The method according to claim 6, wherein The CRISPR-Cas13a detection system further comprises Cas13a protein and / or transcriptase.
8. Use of the composition according to any one of claims 1-3 for any of the following non-diagnostic and therapeutic purposes: B1) Use in detecting the KPC-type carbapenemase gene; B2) Use in preparing a product for detecting the KPC-type carbapenemase gene; B3) Use in identifying carbapenemase-producing strains; B4) Use in preparing a product for identifying carbapenemase-producing strains; B5) Use in preparing a product for detecting microbial drug resistance.
Citation Information
Patent Citations
Method for detecting microorganism based on CRISPR-Cas13a system and application
CN111321234A
Method for rapidly detecting blaKPC gene based on CRISPR / Cas13a
CN115976236A
Kit for detecting NDM type carbapenemase gene based on PCR / RAA-CRISPR-Cas13a
CN118056914A