A method for improving citrus resistance to bacterial wilt based on gene interference

Abstract

The application provides a method for improving the resistance of citrus to canker disease based on gene interference, which comprises the following steps: introducing a long-chain fatty alcohol oxidase gene in a citrus plant into an interference vector as an interference sequence, and integrating the interference sequence into the citrus genome by means of agrobacterium-mediated genetic transformation, so as to effectively improve the resistance of the citrus to canker disease. CsFAO3 The part of the coding sequence of the gene, i.e., the sequence as shown in SEQ ID NO: 3, is used as an interference sequence, introduced into an interference vector, and integrated into the citrus genome by means of agrobacterium-mediated genetic transformation, so as to effectively improve the resistance of the citrus to canker disease. The method can directly inhibit most of the pathogenic bacteria causing the canker disease of the citrus, the gene to be interfered with can greatly improve the resistance of the citrus to the canker disease while reducing the adverse effects on the known quality and performance of the citrus to the greatest extent, a new way for the breeding of the citrus resistant to the canker disease is opened up, and the development of the breeding of the citrus resistant to the canker disease is promoted.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a method for improving the resistance of citrus fruits to citrus canker based on gene interference. Technical Background

[0002] Citrus canker is a highly destructive bacterial disease caused by Xanthomonas citri subsp. citri (Xcc), which causes enormous economic losses to the global citrus industry every year. Currently, the main control method for canker is chemical control, such as spraying citrus trees with copper-based agents, hexanoic acid, and glycerol-derived compounds. However, chemical control methods cause significant environmental pollution and require substantial human and material resources. Therefore, developing new citrus varieties resistant to canker is an effective way to completely solve the problem of citrus canker. Using genetic engineering techniques, overexpression of antimicrobial peptide genes (Peng et al. 2015), CsBZIP genes (Li et al. 2019), and CRISPR / Cas9-mediated gene editing of the susceptibility gene CsLOB1 (Peng et al. 2017) in citrus resulted in transgenic citrus plants with enhanced canker resistance.

[0003] Chinese patent application CN114561397A discloses the application of the CsCaBP1 gene in inducing resistance to citrus canker. The study found that overexpression of the citrus CsCaBP1 gene can effectively enhance the resistance of transgenic plants to citrus canker.

[0004] Chinese patent application CN110819607A discloses the application of the CsLYK gene and its encoded protein in improving the resistance of citrus canker. The CsLYK gene, which encodes the LysM receptor protein phosphokinase in citrus, is integrated into citrus through an overexpression vector, effectively improving the resistance of citrus to bacterial canker.

[0005] Chinese patent application CN101260399A discloses the pthA-nls gene for resistance to citrus canker, its construction method, and its application. Utilizing the principle of broad-spectrum resistance mediated by the pathogenic gene pthA of citrus canker, a new gene pthA-nls for resistance to citrus canker was constructed. This gene can be further genetically transformed into susceptible citrus varieties to obtain new germplasm resistant to citrus canker.

[0006] The above patent applications all aim to achieve resistance to citrus canker by overexpressing genes related to citrus canker. Overexpression of these genes leads to the production of large amounts of related encoded proteins, which may not only affect resistance to citrus canker but also have unpredictable adverse effects on the quality and performance of the citrus itself.

[0007] Chinese patent application CN114395570A discloses a method for improving the resistance of citrus to citrus canker by silencing the CsNCED3 gene. The expression level of CsNCED3 in the transgenic plants obtained is significantly downregulated to 29% of that in existing citrus, and the incidence of citrus canker can be reduced to 47% of that in existing citrus.

[0008] Chinese patent application CN110283843A discloses a method for improving citrus canker resistance by CRISPR / Cas9-mediated site-specific editing of CsWRKY22. This method results in the loss or reduction of CsWRKY22 protein function, achieving successful editing of the CsWRKY22 gene in the citrus genome, obtaining CsWRKY22 mutant transgenic plants, enhancing the plants' resistance to citrus canker, and obtaining citrus with high canker resistance.

[0009] These two existing patents disclose methods to enhance citrus resistance to citrus canker by inhibiting gene expression, including gene interference or gene editing. However, the downregulation of these genes has not been shown to significantly inhibit the proliferation of citrus canker bacteria, and cannot fundamentally guarantee that the bacteria will not proliferate again. Furthermore, while CRISPR / Cas9-mediated gene editing achieves gene silencing, it also introduces a Cas9 gene into the citrus genome. The presence of this gene could lead to editing of sites in transgenic plants with high similarity to the target site, posing a potential off-target risk and potentially causing unpredictable adverse effects on the quality and performance of the citrus. Summary of the Invention

[0010] The purpose of this invention is to provide a method for improving the resistance of citrus to citrus canker based on gene interference. This method involves introducing a portion of the coding sequence of the CsFAO3 gene as an interference sequence into an interference vector, and then integrating it into the citrus genome via Agrobacterium-mediated genetic transformation, effectively improving the resistance of citrus to citrus canker.

[0011] The objective of this invention is achieved through the following technical solution:

[0012] A method for improving the resistance of citrus to citrus canker based on gene interference is characterized by reducing the transcription level of the long-chain fatty alcohol oxidase CsFAO3 gene in citrus plants by interfering with RNA (RNAi).

[0013] Specifically, the RNAi uses an interfering sequence with a nucleotide sequence as shown in SEQ ID NO:3.

[0014] The method of the present invention includes the following steps: (1) cloning the interference sequence from the citrus CsFAO3 gene; (2) constructing a CsFAO3 interference expression vector containing the interference sequence; and (3) transforming citrus with the CsFAO3 interference expression vector to obtain transgenic citrus plants.

[0015] In step (1), the cloning method of the interference sequence is as follows: extract total RNA from citrus, then reverse transcribe it into cDNA, and use cDNA as a template to amplify the interference sequence by PCR.

[0016] Furthermore, in step (1), the primers used for PCR amplification are rCsFAO3-F and rCsFAO3-R, and their nucleotide sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0017] Further, in step (2), the method for constructing the CsFAO3 interference expression vector is as follows: the pUC-RNAi vector and the T-cloning vector containing the interference sequence are double-digested with AscI and SwaI, respectively; the large fragment of the digested pUC-RNAi vector and the digested fragment of the interference sequence are ligated with T4-DNA ligase to construct a forward interference sequence vector; the forward interference sequence vector and the T-cloning vector containing the interference sequence are then double-digested with XbaI and BamHI, respectively; the large fragment of the digested forward interference sequence vector and the interference sequence fragment are ligated with T4-DNA ligase to construct a pUC-RNAi-CsFAO3 interference vector containing both forward and reverse interference sequence fragments; finally, the pUC-RNAi-CsFAO3 interference vector and the pLGNe vector are double-digested with KpnI and SalI, respectively; the forward and reverse interference sequence fragments are ligated with T4-DNA ligase to obtain the CsFAO3 interference expression vector.

[0018] Further, in step (3), the method of transforming citrus with the CsFAO3 interference expression vector is as follows: the CsFAO3 interference expression vector is introduced into Agrobacterium strain EHA105 by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens. The genetically transformed explants are then cultured in vitro, stained and identified, and grafted to obtain transgenic citrus plants.

[0019] Furthermore, after obtaining the transgenic citrus plants in step (3), the transgenic plants were evaluated for resistance to determine the correlation between CsFAO3 gene interference and citrus canker resistance.

[0020] Preferably, before evaluating the resistance of transgenic citrus plants, the transgenic citrus plants are verified by PCR using primers GUS-F and GUS-R, whose nucleotide sequences are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively.

[0021] More preferably, after PCR verification, the transcription level of the CsFAO3 gene in the transgenic citrus plants was verified by qRT-PCR. The primers used for the detection were qCsFAO3-f and qCsFAO3-r, and their nucleotide sequences are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively. The internal reference gene was the citrus Actin gene, and the primers used were Actin-F and Actin-R, and their nucleotide sequences are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively.

[0022] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0023] This invention provides a method for improving the resistance of citrus to bacterial canker based on interfering with the expression of the CsFAO3 gene. The transgenic plants obtained through this method show a reduction in bacterial canker incidence to 45.6% of existing citrus varieties, significantly alleviating canker symptoms and improving the resistance of citrus to bacterial canker.

[0024] More importantly, the transgenic citrus plants obtained by this invention, after being infected with citrus canker bacteria for 9 days, showed that the number of citrus canker bacteria cells proliferating in the leaves was only 19.3% of that in the wild-type control citrus. Direct inhibition of the proliferation of pathogenic bacteria causing citrus canker can ensure that the disease is essentially suppressed, further preventing the large-scale spread of citrus canker in the citrus industry.

[0025] This invention utilizes the long-chain fatty alcohol oxidase CsFAO3 gene, which is known only as one of the important enzymes catalyzing the oxidation of long-chain hydrocarbons and fatty acids, participating in the ω-oxidation pathway of long-chain fatty acids or alkanes, and providing a carbon source for microbial growth. However, its effects on plants, especially on the quality and performance of citrus, have not been extensively studied. By interfering with a segment of this gene, the resistance of citrus to citrus canker is greatly improved while minimizing the adverse effects on the known quality and performance of citrus. This opens up another avenue for breeding citrus resistant to citrus canker and promotes the development of citrus canker resistance breeding. Attached Figure Description

[0026] Figure 1 A schematic diagram of the construction of the CsFAO3 interference expression vector described in this invention is provided.

[0027] Figure 2The relative expression levels of the CsFAO3 gene in transgenic plants are provided. WT represents wild-type plants, and RNAi-4 and RNAi-12 represent the numbers of two transgenic plants containing the interference sequence described in this invention. The expression level of the CsFAO3 gene in transgenic plants containing the interference sequence described in this invention is significantly lower than that in wild-type plants, while the differences between transgenic plants themselves are not significant.

[0028] Figure 3 The disease incidence of transgenic plants with interfering CsFAO3 expression 10 days after inoculation with *Pseudomonas aeruginosa* is presented. WT represents wild-type plants, and RNAi-4 and RNAi-12 represent the numbers of two transgenic plants containing the interfering sequence described in this invention. The disease incidence of transgenic plants containing the interfering sequence described in this invention showed a visually significant difference compared to wild-type plants after inoculation with *Pseudomonas aeruginosa*, while the differences between the transgenic plants themselves were not significant.

[0029] Figure 4 The data provides information on lesion area 10 days after inoculation of transgenic plants with interfering CsFAO3 expression with ulcer pathogen. The lesion area is expressed in mm. 2 Wherein WT represents wild-type plants, and RNAi-4 and RNAi-12 represent the numbers of two transgenic plants containing the interference sequence described in this invention. The lesion area of ​​transgenic plants containing the interference sequence described in this invention is significantly different from that of wild-type plants, while the differences between transgenic plants themselves are not significant.

[0030] Figure 5 Disease indexes were provided for transgenic plants with interfering CsFAO3 expression 10 days after inoculation with *Pseudomonas aeruginosa*, expressed as a percentage (%). WT represents wild-type plants, and RNAi-4 and RNAi-12 represent the numbers of two transgenic plants containing the interfering sequence described in this invention. The disease index of transgenic plants containing the interfering sequence described in this invention 10 days after inoculation with *Pseudomonas aeruginosa* was statistically significantly different from that of wild-type plants, while no significant differences were observed among the transgenic plants themselves.

[0031] Figure 6 This study presents the growth of *C. canker* pathogens in transgenic citrus plants inoculated with *C. canker* pathogens for 0-9 days after inoculation. The x-axis represents the number of days since inoculation, and the y-axis represents the number of *C. canker* bacteria cells. WT represents wild-type plants, and RNAi-4 and RNAi-12 represent the numbers of two transgenic plants containing the interfering sequence described in this invention. At 9 days after inoculation, the number of *C. canker* pathogens in the leaves of transgenic plants containing the interfering sequence described in this invention showed a statistically significant difference compared to wild-type plants, while the difference between transgenic plants themselves was not significant. Detailed Implementation

[0032] The materials, reagents, tools, and conditions used in this invention are merely illustrative, and those skilled in the art may choose other materials, reagents, tools, and conditions that have the same or similar functions.

[0033] The late-maturing Jincheng orange selected in this invention is a superior late-maturing Jincheng orange strain bred from common Jincheng orange (Citrus sinensis) by the Citrus Research Institute of the Chinese Academy of Agricultural Sciences from the early 1980s to 2010, with the approval number "Yu Shen Gan Ju 2011001".

[0034] The primers used in this invention were all synthesized by Beijing Liuhe BGI Genomics Co., Ltd.

[0035] Unless otherwise specified, all experimental reagents used in this invention are commercially available reagents purchased by the applicant's organization.

[0036] In this invention, "gene interference" refers to the use of specific methods to shut down or inhibit the transcription and / or expression of a target gene. Commonly used methods include antisense RNA, triple-stranded DNA, and interfering RNA. In this invention, gene interference specifically refers to gene interference using interfering RNA technology. Therefore, these two terms can be used interchangeably in this invention.

[0037] In this invention, RNA interference (RNAi) refers to the phenomenon where highly conserved segments of a target gene are artificially cloned and transgenic into an organism, inducing efficient and specific degradation of the target gene's homologous mRNA in the form of RNA. The terms "RNA interference" and "interfering RNA" are used interchangeably.

[0038] The terms “interference sequence,” “interference fragment,” or “CsFAO3 interference sequence” used in this invention are interchangeable and refer to the cloning DNA fragment used for RNA interference after transgenic modification in this invention, specifically the DNA fragment with the nucleotide sequence shown in SEQ ID NO:3.

[0039] The term "vector" as used in this invention refers to a self-replicating DNA molecule used in recombinant DNA technology to transfer DNA fragments into recipient cells, including bacterial plasmids, bacteriophages, and plant and animal viruses. The vector used in this invention specifically refers to a plasmid vector; therefore, the two terms are interchangeable. The pUC-RNAi vector and pLGNe vector mentioned in this invention are commonly used pUC vectors and overexpression vectors in the art. These basic vectors are described in the prior art literature mentioned in the background section of this invention, differing only in the inserted interfering gene fragment. The T-cloning vector is the commonly used commercial vector pGEM-T, purchased from Promega. In this invention, the ligation product of the pUC-RNAi vector and the interfering sequence is called a "forward interfering sequence vector"; the pUC-RNAi vector obtained by ligating the interfering sequence again onto the forward interfering sequence vector is called a "pUC-RNAi-CsFAO3 interfering vector"; finally, the forward and reverse interfering sequences are ligated to the pLGNe vector through this intermediate vector to form the final interfering vector, called a "CsFAO3 interfering expression vector." Since the pLGNe vector carries the cauliflower mosaic virus promoter (CaMV 35S promoter), the CsFAO3 interference expression vector constructed from it also has the CaMV 35S promoter, which has the nucleotide sequence shown in SEQ ID NO:4.

[0040] Example 1: RNA extraction and cDNA synthesis from Late-ripening Citrus Orange

[0041] 0.05g of tender leaves of the late-maturing citrus fruit were selected, and total RNA was extracted from the leaves using the EASYspin Plant RNA Rapid Extraction Kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and RNA concentration was determined using Nanodrop 2000 Thermo.

[0042] Using 500ng of RNA with iScript TM 10 μl of cDNA was synthesized using the cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). The cDNA was then diluted 5-fold and stored at -20°C for later use.

[0043] Example 2: Obtaining the CsFAO3 interference sequence

[0044] The CsFAO3 gene interference fragment was amplified from the cDNA obtained in Example 1 using primers rCsFAO3-F and rCsFAO3-R as shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The fragment length was 321 bp, and its sequence is shown in SEQ ID NO:3, which is the interference sequence described in this invention.

[0045] The amplified DNA fragments were recovered by agarose gel electrophoresis using a Biospin gel recovery kit (Bohr, BSC02M1). The recovered products were ligated into a T-cloning vector, and the ligation products were amplified using primers rCsFAO3-F and rCsFAO3-R as shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The bacterial culture containing the amplified fragments was sequenced to obtain the correct CsFAO3 interference sequence. Amplification system: 2×PCR mix (TaRaKa): 25 μL; primers rCsFAO3-F and rCsFAO3-F (100 μmol / L): 1 μL each; cDNA: approximately 60 ng; ddH2O added to 50 μL.

[0046] Amplification program: 94℃, 5 min; 94℃, 30 s, 60℃, 30 s, 72℃, 30 s, 32 cycles; extension at 72℃ for 5 min.

[0047] Example 3: Construction of CsFAO3 interference expression vector

[0048] Carrier construction flowchart as follows Figure 1 As shown, all restriction endonucleases were purchased from THERMO and used according to the instructions.

[0049] Utilizing GenElute TM A plasmid extraction kit (Sigma, PLN350) was used to extract T-clone plasmids and pUC-RNAi plasmids containing the CsFAO3 interference sequence. Both plasmids were double-digested with AscI and SwaiI, respectively. The digestion products were recovered after agarose gel electrophoresis. The CsFAO3 interference fragment was recovered from the T-clone plasmid, and the larger fragment from the pUC-RNAi plasmid was recovered. The recovered products were ligated using T4-DNase, and the ligation products were transformed into *E. coli* DH5α and plated on LB agar supplemented with 50 mg / mL ampicillin. Single colonies grown on LB agar were picked and incubated overnight in LB liquid agar supplemented with 50 mg / mL ampicillin. Plasmids were extracted from the bacterial culture using the plasmid extraction kit and double-digested with AscI and SwaiI. The digestion products were then subjected to agarose gel electrophoresis. Plasmids containing a 321 bp band were identified as positive interference sequences.

[0050] The positive interference plasmid and the T-clone plasmid containing the CsFAO3 interference fragment were double-digested with XbaI and BamHI, respectively. After agarose gel electrophoresis, the T-clone plasmid fragment of about 321 bp (i.e., the CsFAO3 interference fragment) was recovered, and the larger fragment of the positive interference plasmid was recovered. The recovered interference fragment was ligated to the linearized positive interference plasmid using the above method, and the ligation product was used to transform E. coli DH5α. The plasmids were extracted from the bacterial culture and digested with XbaI and BamHI. The plasmid containing a fragment of about 321 bp in the digestion product was identified as the interference sequence plasmid containing the reverse interference sequence.

[0051] The interfering sequence plasmid and pLGNe plasmid were double-digested with KpnI and SalI, respectively. The digestion products were recovered after agarose gel electrophoresis. The band containing the interfering sequence was recovered from the interfering sequence plasmid, and the large fragment from the pLGNe plasmid was recovered. The two fragments were ligated as described above, and the ligation product was used to transform *E. coli* DH5α. Plasmids were extracted from the bacterial culture and digested with KpnI and SalI. The plasmid containing the interfering fragment in the digestion product was designated as the CsFAO3 interfering expression plasmid. The CsFAO3 interfering plasmid was introduced into *Agrobacterium* strain EHA105 using electroporation, and the bacterial culture was stored at -80°C.

[0052] Example 4: Genetic transformation of Late-blooming Orange

[0053] Wash the late-ripening oranges, surface sterilize them with 75% alcohol, remove the seeds under aseptic conditions, peel off the seed coat, and inoculate them onto MS medium (PhytoTechnology Laboratories) supplemented with 30 g / L sucrose and 8 g / L agar. TM The cells were cultured in the dark at 28°C for 2 weeks on M519, followed by 1 week of culture under a 16-hour light / 8-hour dark photoperiod. Under aseptic conditions, the epicotyls of germinating seedlings were cut into stem segments of about 1 cm for Agrobacterium tumefaciens-mediated citrus genetic transformation.

[0054] Two days before transformation, Agrobacterium-containing CsFAO3 interference expression vector culture was spread onto LB solid medium supplemented with 50 mg / L kanamycin. Single colonies of Agrobacterium were picked and inoculated into 10 mL of LB liquid medium containing the same antibiotic, and cultured overnight at 28°C and 220 rpm with shaking. The OD value of the culture was measured using a spectrophotometer. The culture was diluted with the above LB liquid medium to an OD value of 0.1, and cultured under the same conditions with shaking. The OD value was monitored, and when it reached 0.5, the culture was collected in a 50 mL sterile centrifuge tube, centrifuged at 5000 rpm for 10 min, the supernatant was discarded, and the culture was resuspended in MS liquid medium at pH 5.4 before being used for citrus genetic transformation.

[0055] Immerse approximately 1 cm segments of the hypocotyl of the late-maturing orange in Agrobacterium tumefaciens for 12 minutes, gently agitating them during this time. After removing the segments, blot the surface of the bacterial solution with sterile filter paper. Transfer the segments to MS solid medium supplemented with 1 mg / L N6-isopentenyladenine (2-ip), 0.5 mg / L indoleacetic acid (IAA), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 100 μM acetylsyringone (AS), 30 g / L sucrose, and 8 g / L agar. Co-culture for 3 days at 26°C in the dark.

[0056] After co-culture, the epicotyls were transferred to MS solid medium supplemented with 2 mg / L 6-benzylaminopurine (6-BA), 0.5 mg / L IIAA, 50 mg / L kanamycin, 500 mg / L cephalosporin, 30 g / L sucrose and 8 g / L agar. After 7 days of dark culture at 28°C, they were transferred to a photocycle of 28°C, 16 h light / 8 h dark, and subcultured every two weeks.

[0057] Adventitious buds sprouting from wounds at both ends of the epicotyl stem segment were subjected to GUS histochemical staining using β-glucuronidase (GUS) staining solution; those that stained blue with GUS were identified as GUS-positive buds.

[0058] GUS staining solution contains the following components: 100mM NaH2PO4, 100mM Na2HPO4, 0.5mM K4[Fe(CN)6], 0.5mM MK3[Fe(CN)6], 10mM EDTA-Na2, 1mM 5-bromo-4-chloro-3-indole-β-glucuronic acid (X-gluc), 0.1% sodium azide, and 0.1% Triton-100.

[0059] When the stem of the GUS-positive bud is about 0.5cm long, cut it horizontally and micrograft it onto the trifoliate orange rootstock under sterile conditions. After the graft union has fully healed, cut the GUS-positive bud horizontally from the base of the trifoliate orange rootstock and graft it onto the field trifoliate orange rootstock according to the field grafting method. Keep it moist with a plastic bag for 2 weeks. Remove the plastic bag after it has taken root.

[0060] Example 5: PCR detection of transgenic plants

[0061] Three months after grafting GUS-positive buds into the field, 100 mg of leaves were collected, and genomic DNA was extracted using a DNA extraction kit (Adley, CAT: DN15). PCR detection of GUS gene integration was then performed. PCR reaction conditions were: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 32 cycles; 72℃ for 5 min. The detection primers were GUS-F and GUS-R, with nucleotide sequences shown in SEQ ID NO:5 and SEQ ID NO:6, respectively. Positive plants yielded a 505 bp amplified fragment, while wild-type Late Jin Orange plants showed no corresponding amplified band.

[0062] Example 6: Expression analysis of the CsFAO3 gene

[0063] Leaves were extracted from plants that were verified as PCR positive according to Example 5. Total RNA was extracted from the leaves using the EASYspin Plant RNA Rapid Extraction Kit. RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a NanoDrop 2000 Thermo concentration meter. 500 ng of RNA was used to extract RNA using iScript. TM 10 μL of cDNA was synthesized using the cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA), and then diluted 5-fold.

[0064] The expression level of the CsFAO3 gene was detected using real-time quantitative PCR. Primers qCsFAO3-f and qCsFAO3-r were used, and their nucleotide sequences are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively. The citrus Actin gene was used as an internal control for quantitative PCR, employing primers Actin-F and Actin-R, whose nucleotide sequences are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively. Reaction system: iTaq TM Universal 6 μL of 100 μmol / L primers, 0.3 μL each of primers, and 50 ng of cDNA were added, and ddH2O was added to a final volume of 12 μL. Reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min. The experiment was repeated three times. WT plants were used as a control. -△△Ct The relative expression level of the CsFAO3 gene in transgenic plants was calculated using a method. The results are shown below. Figure 2The results showed that the expression levels of the CsFAO3 gene in WT, RNAi-4, and RNAi-12 transgenic plants were 1.027, 0.192, and 0.502, respectively. Compared with WT plants (i.e., taking the expression level of WT plants as 1), the expression levels of RNAi-4 and RNAi-12 were downregulated to 19.2% and 49.2% of those in existing citrus plants, respectively.

[0065] Example 7: Evaluation of canker resistance in transgenic plants

[0066] Mature leaves from the aforementioned transgenic plants and wild-type Late Jin Orange were selected, washed thoroughly with tap water, and then rinsed multiple times with sterile water. Excess moisture was wiped off the leaf surface and from the sterile culture dish. The leaves were then laid flat in the dish, with the underside facing upwards and suspended in the air. Cotton, moistened with sterile water, was placed over the petiole to maintain humidity. The leaves were punctured with a 0.5mm needle, making the same number of punctures on both sides of the midrib. 1μL of *Citrus canker* (XccYN1 strain, provided by Dr. Hu Junhua of the Citrus Research Institute of Southwest University) bacterial suspension (5×10⁻⁶) was inoculated at each puncture site. 8 (CFU / mL). After acupuncture, the leaves were cultured in a light incubator at 28℃ and 85% humidity.

[0067] Photos were taken 10 days after vaccination, and the area of ​​the lesions was calculated using ImageJ software, in mm. 2 The condition is classified into 7 grades based on the area of ​​the lesions. The lesion area is represented by the letter R, with grade 1 (R <= 0.75 mm). 2 ), Level 2 (0.75mm) 2 <R<=1.25mm 2 ), Level 3 (1.25mm) 2 <R<=1.75mm 2 ), Level 4 (1.75mm) 2 <R<=2.25mm 2 ), Level 5 (2.25mm) 2 <R<=2.75mm 2 ), Level 6 (2.75mm) 2 <R<=3.25mm 2 ), Level 7 (R>3.25mm) 2 Disease Index (DI) = 100 × Σ[number of lesions at each level × corresponding level value] / (total number of lesions × maximum level). The test was repeated 3 times.

[0068] Using the method described above, leaves from CsFAO3 interference-expressing transgenic plants and wild-type plants of the same developmental stage were inoculated with the same concentration of *C. canker*. Leaf discs from the inoculated area were collected at 0, 1, 3, 5, and 7 days post-inoculation using a perforator, with three leaf discs per group. These discs were placed in 1.5 mL centrifuge tubes, and 200 μL of sterile water was added. The mixture was then homogenized and brought to a final volume of 1000 μL. Serial dilutions were performed, and 50 μL of the bacterial suspension was plated on LB agar plates and incubated at 28°C for 2 days. The number of bacterial plaques was counted to analyze bacterial growth in transgenic plants induced by *C. canker*. The experiment was repeated three times.

[0069] like Figure 3 As shown, 10 days after in vitro inoculation with ulcer pathogens, wild-type plants were found to be more severely affected, while transgenic plants with CsFAO3 interference expression all showed varying degrees of disease, but the size of the lesions was significantly different from that of the wild type.

[0070] like Figure 4 As shown, the size of lesions on leaves inoculated with *C. canker* was statistically analyzed. The results showed that the lesion area of ​​the two CsFAO3 interference-expressing transgenic plants (RNAi-4 and RNAi-12) was significantly smaller than that of the wild-type plants. Specifically, the lesion area of ​​WT, RNAi-4, and RNAi-12 was 2.02 mm². 2 0.79mm 2 and 0.75mm 2 .

[0071] like Figure 5 As shown, the disease index statistics of the transgenic plants revealed that the disease severity of the two transgenic plants, numbered RNAi-4 and RNAi-12, was significantly lower than that of the wild-type plants. The disease indices of WT, RNAi-4, and RNAi-12 were 48.9%, 27.3%, and 22.3%, respectively. The disease index of RNAi-12 was only 45.6% of that of the wild-type control group.

[0072] As shown in Table 1 and Figure 6 As shown, after infection with *Citrus canker*, the proliferation of *Citrus canker* in the leaves of transgenic plants was significantly inhibited compared to wild-type plants. Nine days after infection, the number of *Citrus canker* cells in the leaves of RNAi-4 and RNAi-12 transgenic plants was only 48.2% and 19.3% of that in the wild-type control citrus, respectively.

[0073] Table 1. Proliferation of *Pseudomonas ulcerans* in leaves of RNAi-4 and RNAi-12 transgenic plants.

[0074] 0 days 1.40E+06±7.72E+04 9.96E+05±3.57E+05 1.17E+06±3.20E+05 1 day 5.11E+06±1.44E+06 4.08E+06±6.36E+05 5.17E+06±1.14E+06 3 days 5.44E+07±5.11E+06 6.85E+06±2.61E+06 2.42E+07±3.69E+06 5 days 6.76E+07±6.50E+06 1.82E+07±2.27E+06 1.48E+07±3.10E+06 7 days 1.15E+08±2.20E+07 4.98E+07±1.14E+07 3.85E+07±7.72E+06 9 days 1.15E+08±1.92E+07 5.57E+07±4.73E+06 2.23E+07±4.60E+06

[0075] In conclusion, interfering with the expression of the CsFAO3 gene can inhibit the growth of citrus canker pathogens in citrus leaves, thereby significantly reducing the lesion area and severity of canker.

[0076] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0077] Sequence List:

[0078] SEQ ID NO: 1

[0079] 5′-TCTAGAGGCGCGCCCTCAAATGTGAAGGAATTAC-3′

[0080] SEQ ID NO: 2

[0081] 5′-GGATCCATTTAAATTTATGAGGACTGTTCTCTCA-3′

[0082] SEQ ID NO: 3

[0083] 5′-CTCAAATGTGAAGGAATTACCGAAAAGGAAGTGGAGCAGTTTCTGGACACAGTTTATGCAGCAGAAGGGCCAAAGTCATCAGTGGAGAACTGGATGGTCTACGGTACTGCCCATCAAATGGGAAGCTGTAGGATGGGGGTTAATGACAAAGAGGGTGCGG TTGACGAGAACGGGCAGAGTTGGGAAGCGGAAGGCCTATATGTTTGCGATGCTAGTGTTTTTCCAAGCGCTGTTGGTGTCAATCCCATGATCACAATCCAGTCTACTGCTTACTGTCTCTCAAAGAGAATAGCGGAATCCTTGAGAGAACAGTCCTCATAA-3′

[0084] SEQ ID NO: 4

[0085] 5′-AGATTAGCCTTTTCAATTTCAGAAAGAATGCTAACCCACAGATGGTTAGAGAGGCTTACGCAGCAGGTCTCATCAAGACGATCTACCCGAGCAATAATCTCCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGAAGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAGATTGGAGTCTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGAACACG-3′

[0086] SEQ ID NO:5

[0087] 5′-AGTCTTACTTCCATGATTTC-3′

[0088] SEQ ID NO:6

[0089] 5′-TAGGAGTTGGCCCCAATCCA-3′

[0090] SEQ ID NO:7

[0091] 5′-TGCGGTCATGGCTGTAAAAG-3′

[0092] SEQ ID NO:8

[0093] 5′-TGACTGCACCATGGTTTACG-3′

[0094] SEQ ID NO:9

[0095] 5′-CATCCCTCAGCACCTTCC-3′

[0096] SEQ ID NO:10

[0097] 5′-CCAACCTTAGCACTTCTCC-3′

Claims

1. A method for improving the resistance of late-ripening oranges to citrus canker based on gene interference, characterized in that, The method involves reducing the transcription level of the long-chain fatty alcohol oxidase CsFAO3 gene in late orange by interfering RNA (RNAi); the nucleotide sequence of the interfering RNA is shown in SEQ ID NO:

3.

2. The method for improving the resistance of late-ripening oranges to citrus canker according to claim 1, characterized in that, The procedure includes the following steps: (1) Cloning the interference sequence from the CsFAO3 gene of Late Orange: Extracting total RNA from Late Orange and then reverse transcribing it into cDNA. Using the cDNA as a template, the interference sequence of the CsFAO3 gene is amplified by PCR using primers rCsFAO3-F and rCsFAO3-R. The nucleotide sequences of the primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; (2) Constructing a CsFAO3 interference expression vector containing the interference sequence; (3) Transforming Late Orange with the CsFAO3 interference expression vector to obtain transgenic Late Orange plants.

3. The method for improving the resistance of late-ripening oranges to citrus canker according to claim 2, characterized in that, In step (2), the method for constructing the CsFAO3 interference expression vector is as follows: the pUC-RNAi vector and the T-cloning vector containing the interference sequence are double-digested with AscI and SwaI, respectively. The large fragment of the digested pUC-RNAi vector and the digested fragment of the interference sequence are ligated with T4-DNA ligase to construct a forward interference sequence vector. The forward interference sequence vector and the T-cloning vector containing the interference sequence are then double-digested with XbaI and BamHI, respectively. The large fragment of the digested forward interference sequence vector and the digested fragment of the interference sequence are ligated with T4-DNA ligase to construct a pUC-RNAi-CsFAO3 interference vector containing both forward and reverse interference sequence fragments. Finally, the pUC-RNAi-CsFAO3 interference vector and the pLGNe vector are double-digested with KpnI and SalI, respectively. The forward and reverse interference sequence fragments are ligated with T4-DNA ligase to obtain the CsFAO3 interference expression vector.

4. The method for improving the resistance of late-ripening oranges to citrus canker according to claim 2 or 3, characterized in that, In step (3), the method of transforming late-maturing oranges with the CsFAO3 interference expression vector is as follows: the CsFAO3 interference expression vector is introduced into Agrobacterium strain EHA105 by electroporation, and then the late-maturing orange explants are transformed by Agrobacterium tumefaciens. The genetically transformed explant cells are then cultured in vitro, stained and identified, and grafted to obtain transgenic late-maturing orange plants.

5. The method for improving the resistance of late-ripening oranges to citrus canker according to claim 4, characterized in that, After obtaining the transgenic Late Jin Orange plants in step (3), the transgenic plants were evaluated for resistance to determine the correlation between CsFAO3 gene interference and resistance to Late Jin Orange canker.

6. The method for improving the resistance of late-ripening oranges to citrus canker according to any one of claims 2, 3, and 5, characterized in that, Before evaluating the resistance of transgenic Late Jin Orange plants, the transgenic Late Jin Orange plants were verified by PCR using primers GUS-F and GUS-R, whose nucleotide sequences are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

7. The method for improving the resistance of late-ripening oranges to citrus canker according to claim 6, characterized in that, After PCR verification, the transcription level of the CsFAO3 gene in the transgenic Late Orange plants was verified by qRT-PCR. The primers used for the detection were qCsFAO3-f and qCsFAO3-r, and their nucleotide sequences are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively. The internal reference gene was the Late Orange Actin gene, and the primers used were Actin-F and Actin-R, and their nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

Images