A kind of Huxiang F3 shiitake mushroom strain and liquid strain cultivation method thereof

Abstract

The present invention provides a Huxiang F3 shiitake mushroom strain and a liquid strain cultivation method thereof, and relates to shiitake mushroom strain detection technology and the field of cultivation. The present invention provides a fingerprint spectrum of the Huxiang F3 shiitake mushroom strain, and the fingerprint spectrum is composed of a combination of specific allele fragments of 7 pairs of SSR markers, and can be used for the identification of the Huxiang F3 strain. The shiitake mushroom strain "Huxiang F3" of the present invention can tolerate high-concentration CO2 culture, has strong stress resistance, and under the culture conditions of an environmentally controlled warehouse, the mycelium is strong and thick white, the color change is uniform, and the mushrooms can be normally produced without a large temperature difference stimulation during the fruiting stage. The method provided by the present invention is used for liquid strain cultivation, which can greatly shorten the seed production cycle, improve the strain vitality, shorten the mushroom cultivation time, save investment, and the mushrooms are more uniform and the mushroom shape is better. The factory production of shiitake mushrooms using the present invention is economically feasible, and the production cost can be reduced and the production efficiency of shiitake mushrooms can be improved.

Description

Technical Field

[0001] The invention relates to the field of detection technology and cultivation of shiitake mushroom strains, and in particular to an SSR marker fingerprint spectrum of Huxiang F3 shiitake mushroom strains and a liquid strain cultivation method thereof. Background Art

[0002] Lentinula edodes, also known as Xiangxin and Hua Mushroom, is known as the "Queen of Mushrooms" and has always been loved by consumers. Lentinula edodes has high nutritional value, contains 18 kinds of amino acids and rich provitamin D. It is also a well-known medicinal mushroom with the effects of improving immunity, anti-tumor, anti-virus, and lowering cholesterol. According to statistics, the total output of shiitake mushrooms in 2021 was 12.9572 million tons, accounting for more than 90% of the world's total output of shiitake mushrooms, with a total output value of more than 100 billion yuan, and more than 10 million people employed in related industries. It is my country's edible fungus product with the widest production area, the largest total output, and the greatest influence.

[0003] With the rapid development of the mushroom industry, the production mode of mushrooms is also gradually transforming and upgrading. Many mushroom producing areas have changed from traditional family workshops to intensive or even factory production, which puts forward higher requirements for mushroom varieties, production processes, yields and quality. In the farmer's small workshop model, most traditional mushroom varieties such as 808, 9015 and 9608 are used. After inoculation, the mushrooms are cultivated in greenhouses. The fruiting requires stimulation from temperature difference, humidity difference and mechanical vibration. Some varieties have poor resistance to high temperature and stress. With the increasing frequency of extreme weather in summer, the pollution rate and bad stick rate are becoming more serious during the cultivation process, with losses reaching 20% ​​to 30%, and sometimes even up to 50%, causing serious losses to farmers. In intensive or factory production, the inoculated mushroom sticks are placed in an environmentally controlled warehouse for cultivation, and the temperature, light, water and air are fully controllable, so the mushroom sticks are of good quality and high yield. However, traditional varieties have poor tolerance to CO2. The high CO2 concentration in controlled-environment culture causes lack of oxygen in the mushroom sticks, resulting in yellow mycelium, no nodules or too many nodules, low mushroom yield, and many deformities. Therefore, breeding excellent varieties with short mushroom age, high CO2 concentration tolerance, and strong stress resistance is the basis for promoting industrial development.

[0004] In terms of production technology, the production of strains is the first process of the edible fungi industry, which is related to the success or failure of the industry. Its importance is self-evident. At present, traditional mushroom farmers and shiitake mushroom production enterprises still mainly use solid strains to expand and propagate step by step to produce mother strains, original strains and cultivated strains. However, the above methods generally have the disadvantages of long seed production cycle (more than 90 days), large seed volume, high labor intensity, cumbersome process, high contamination rate, inconsistent bacterial age, etc. Therefore, the method of solid strains expanding and propagating step by step can no longer meet the needs of large-scale and factory-based shiitake mushroom production enterprises. Liquid strains have the advantages of fast seed production (20d~25d), low cost, low contamination rate, high inoculation efficiency, short fermentation cycle, and uniform bacterial age. They are particularly suitable for large-scale and factory-based production of edible fungi and have become the development trend of the edible fungi seed production industry. Therefore, the selection and breeding of high-yield and stress-resistant excellent shiitake liquid strains in order to realize intensive and factory-based production of shiitake mushrooms is a technical problem that needs to be solved at present. Summary of the invention

[0005] In order to solve the above problems, the present invention provides Huxiang F3 shiitake mushroom strain and a liquid strain cultivation method thereof.

[0006] The Huxiang F3 shiitake mushroom strain of the present invention is deposited in the China Center for Type Culture Collection (CCTCC), with a deposit number of CCTCC NO: M 2020323, Lentinus edodes Huxiang F3, unit address: Wuhan University, Wuhan, China, and a deposit date of July 16, 2020.

[0007] The fingerprint spectrum of the Huxiang F3 shiitake mushroom strain of the present invention is composed of a combination of specific allele fragments of 7 pairs of SSR markers, and the combination of DNA amplification bands distinguishes the Huxiang F3 shiitake mushroom strain from other shiitake mushroom strains.

[0008] The SSR marker amplification information of Huxiang F3 shiitake mushroom strain is as follows:

[0009] Primer name Allelic fragment number and molecular weight (bp) Amplified band type Le_fp0001 1：204；2：207；3：216；4：218 1 Le_fp0002 1：127；2：132；3：135；4：139；5：141 1 Le_fp0007 1：220；2：241；3：244；4：247 2，3 Le_fp0008 1：207；2：209；3：219；4：221；5：232 1，2，3，4 Le_fp0010 1：226；2：229；3：240；4：244；5：248 1，2 Le_fp0011 1：260；2：262；3：271；4：273 1，2，3，4 Le_fp0012 1：190；2：193；3：196 1

[0010] The 7 pairs of SSR markers are specifically:

[0011] Le_fp0001 forward primer: ACGCGTATCCTCCCCTAAGT;

[0012] Reverse primer: AAGCGATATGGATTTGACGC;

[0013] Le_fp0002 forward primer: GGGCGAAACAATTTCAGGTA;

[0014] Reverse primer: ATGCCATCGTAAGGAACTCG;

[0015] Le_fp0007 forward primer: CATTGCTCGGATCCTTCATT;

[0016] Reverse primer: TACCTCGTGCGGACTTTGAT;

[0017] Le_fp0008 forward primer: CTCTTTGCACCCTCAACCTC;

[0018] Reverse primer: CAGCAGTCTCCTCTTGGCTC;

[0019] Le_fp0010 forward primer: CGCATTGAGCTCCAAAAACT;

[0020] Reverse primer: AGGAGGAGAAGGAGGTCGAG;

[0021] Le_fp0011 forward primer: ATAGGATGATTGAACGAGCAG;

[0022] Reverse primer: ACCGTAAGGTGGGAAGAAA;

[0023] Le_fp00012 forward primer: ATGCCGTTCCAAAGATAC;

[0024] Reverse primer: TCTGTAACGCTTGTGGACTA.

[0025] The specific numbering combination of the 7 pairs of SSR marker allele fragments is: 11(23)(1234)(12)(1234)1.

[0026] The present invention also provides a liquid cultivation method for the Huxiang F3 shiitake mushroom strain, comprising the following steps:

[0027] (1) Stock production: The Huxiang F3 stock was inoculated onto a sterilized culture medium under aseptic conditions and cultured at 23°C to 25°C in a ventilated and dark environment for 10 to 14 days to obtain the stock;

[0028] (2) Shake flask liquid culture production: The sterilized liquid culture medium is placed in a shake flask, with the liquid volume being 50% to 60% of the total volume of the shake flask. After cooling to below 25°C, the mother culture is inoculated into the liquid culture medium under sterile conditions. After magnetic disruption, the culture is cultured in a shaker or magnetic stirrer in the dark to obtain the shake flask liquid culture.

[0029] (3) Production of liquid strains in a fermenter: After screening the liquid culture medium, add it to a fermenter, the liquid volume of which is 70% to 80% of the volume of the fermenter, add 0.03% to 0.05% of the total volume of the liquid culture medium as a defoamer, and sterilize it. After sterilization, reduce the temperature of the culture solution to 23° C. to 26° C., and culture the liquid strains in a shake flask in a fermenter under sterile conditions to obtain a liquid strain;

[0030] (4) Production of mushroom sticks: Pour all raw materials into a blender, add water until the water content of the mixture is 50wt% to 60wt%, stir thoroughly, then pack and sterilize, and cool to below 26°C for later use;

[0031] (5) Inoculation, culture and fruiting: Inoculation is performed using an inoculator. Before inoculation, holes are punched on the mushroom sticks. After the holes are punched, the liquid spawn obtained in step (3) is inoculated. After inoculation, the mushroom sticks are covered with an outer bag, sealed and moved to a culture warehouse for mushroom stick culture. After the mycelium is fully grown, holes are punched. After 80 to 90 days of culture, mushroom fruiting management is carried out in a timely manner on the mushroom sticks that have reached physiological maturity;

[0032] During the cultivation process of mushroom sticks, they need to be kept away from light before the mycelium grows fully, and then cultured in light after puncturing to promote color change of the mushroom sticks. Increasing ventilation and light during the fruiting stage can improve the quality of shiitake mushrooms.

[0033] Furthermore, the mother culture medium is PDA culture medium or CPDA culture medium.

[0034] Furthermore, the liquid culture medium is composed of the following raw materials: 15g-20g of molasses, 10g-20g of wheat bran, 1g of potassium dihydrogen phosphate, 1g of magnesium sulfate, and 1000mL of water. The pH value of the liquid culture medium after sterilization is 5.0-5.5.

[0035] Furthermore, the culture temperature in step (2) is 23° C. to 26° C., the culture time is 5 d to 7 d, the shaking speed is 110 r / min to 170 r / min, and the magnetic stirrer speed is 400 r / min to 800 r / min.

[0036] Furthermore, the culture temperature in step (3) is 23° C. to 26° C., the culture time is 6 d to 8 d, the fermentation tank pressure during the culture process is 0.03 MPa to 0.05 MPa, and the ventilation ratio is 0.2 vvm to 0.3 vvm.

[0037] Furthermore, the inoculation amount in step (3) is 0.05% to 0.5% of the total volume of the liquid culture medium.

[0038] Furthermore, the mushroom sticks are composed of the following raw materials in percentage by weight: 79% of broadleaf hardwood chips, 20% of wheat bran, and 1% of gypsum.

[0039] Furthermore, the water content of the mushroom stick is 50wt% to 60wt%, and the pH value after sterilization is 5.5 to 5.8.

[0040] Furthermore, in step (4), the number of holes punched is 4 to 6, the hole diameter is 1 cm to 2 cm, the punching depth is 5 cm to 9 cm, and the inoculation volume of the liquid bacteria in each hole is 5 mL to 10 mL.

[0041] Furthermore, the culture temperature of the mushroom stick is 21°C to 23°C, the CO2 concentration is 0.3% to 0.5%, and the center temperature of the mushroom stick is ≤26°C.

[0042] Furthermore, in step (5), 60 to 100 holes are punctured in each bag, and the hole depth is 3.0 cm to 5.0 cm.

[0043] Furthermore, during the mushroom production management process, water needs to be replenished by spraying, injecting or immersing water according to the state of the mushroom sticks. The amount of water replenished is 30% to 50% of the weight of the mushroom sticks before replenishment. The temperature of the mushroom house is maintained at 16°C to 20°C. Buds can appear in 4d to 5d under scattered light. When the mushroom buds grow to about 1cm, they are thinned out according to the formation of mushroom buds and the required number of buds. After thinning out, the temperature is lowered to 10°C to 14°C, and the buds are left to linger for 2d to 3d. After the lingering period ends, the temperature is controlled to 14°C to 18°C, ventilation and light are increased, and the mushrooms are harvested in time before the mycelium film opens. After harvesting, mushroom cultivation management is carried out.

[0044] Furthermore, the mushroom culture management temperature is 20°C-25°C, the mushroom culture management time is 2-3 weeks, and then water is added to carry out the next wave of mushroom production management, and the bud urging, bud thinning, bud squatting, growth and harvesting management are all the same as above, and finally 4 to 6 waves of mushrooms can be produced.

[0045] Compared with the prior art, the beneficial technical effects of the present invention are:

[0046] Compared with common shiitake mushroom varieties, the Huxiang F3 of the present invention is suitable for intensive and factory production, can be cultured under environmentally controlled warehouse conditions, is resistant to high CO2 concentrations, has strong stress resistance, has uniform color change, and can produce mushrooms normally with a small temperature difference;

[0047] The Huxiang F3 mushroom buds of the present invention have a moderate number, a round mushroom shape, a medium-short mushroom stem, a firm mushroom flesh, a light color, a high yield, and a uniform fruiting and fast tide change.

[0048] Compared with the traditional solid spawn production method, the Huxiang F3 liquid spawn production method provided by the present invention has a seed production cycle shortened by more than 70%, a seed production cost reduced by more than 50%, a mushroom stick culture time shortened by 8% to 10%, and fewer broken sticks and rotten sticks during fruiting, with evenly distributed mushroom buds, a bud thinning cost saved by 70%, and a yield increased by 12%. It has a significant effect of "saving labor, time and money", and is suitable for intensive and factory production. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] The present invention will be further described below in conjunction with the accompanying drawings.

[0050] Figure 1 The capillary electrophoresis diagram of 7 pairs of SSR primers;

[0051] Figure 2 This is a comparison of Huxiang F3 liquid spawn sticks and solid spawn sticks cultured for 30 days. The two sticks on the left are the back and front of the solid spawn stick, and the two sticks on the right are the front and back of the liquid spawn stick;

[0052] Figure 3 This is a comparison of the yield of Huxiang F3 liquid spawn sticks and solid spawn sticks. DETAILED DESCRIPTION

[0053] The technical solution provided by the present invention is further described below in conjunction with embodiments.

[0054] Example 1 SSR molecular identification of Lentinula edodes strain Huxiang F3

[0055] 1. Mycelium culture: transfer the mushroom strains to potato dextrose medium (PDB), culture in a shake flask at 23℃~25℃ in the dark, and collect the mycelium after 3d~4d;

[0056] 2. Extraction of genomic DNA: The genomic DNA of the hyphae was extracted by CTAB (cetyltrimethylammonium bromide) method, and the total genomic DNA concentration and purity were detected by UV spectrophotometry, and the concentration of the sample DNA was adjusted to be consistent;

[0057] 3. Detection of SSR molecular markers: PCR amplification of gene SSR markers was performed on the above-extracted DNA. The PCR amplification system: total volume 20 μL, including: 10×PCR buffer 2 μL, 25mmol / LMgCl2 2 μL, 10mmol / L dNTP 0.4 μL, 5U / μL Taq DNA enzyme 0.2 μL, 10μmol / L SSR marker forward primer and reverse primer total volume 1.5 μL each, 20ng / μL extracted template DNA 2 μL, ddH2O 10.4 μL;

[0058] PCR reaction conditions: 94°C for 5 min; 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, 30 cycles; 72°C for 5 min;

[0059] 4. Capillary electrophoresis detection and analysis results.

[0060] Seven pairs of SSR primers were used to perform PCR amplification on the Huxiang F3 strain. The product was diluted 30 times with sterile water, and 1uL was taken and mixed with 30uL loading buffer. Then 0.3uL of molecular weight internal standard was added. After covering with 1 drop of mineral oil, the product was placed in the GenomeLab GeXP genetic analysis system of SCIEX Company for capillary electrophoresis. The electrophoresis results are shown in Figure 1 shown.

[0061] By comparing with the molecular weight internal standard of each primer, the number and relative molecular weight of the allele fragments amplified by each SSR primer can be determined. The strain that meets the specific number combination of 11 (23) (1234) (12) (1234) 1 can be determined to be Lentinula edodes Huxiang F3. To ensure the accuracy of identification, three repeated tests were performed.

[0062] Example 2 Liquid spawn cultivation of shiitake mushroom strain Huxiang F3

[0063] (1) Mother seed production

[0064] The prepared culture medium was dispensed into test tubes and Erlenmeyer flasks according to the formula, sterilized at 121°C for 30 min, and the test tubes were made into bevels after sterilization, the length of the bevels did not exceed 2 / 3 of the length of the test tubes, and the culture medium in the Erlenmeyer flasks was dispensed into 90 mm diameter culture dishes, with 20 mL of culture medium dispensed into each dish. The inoculation process was strictly carried out in accordance with the aseptic operation procedures, and the culture was carried out at 25°C in a ventilated and dark environment for 12 days;

[0065] The culture medium is PDA culture medium or CPDA culture medium;

[0066] Potato dextrose agar medium (PDA medium): 200 g peeled potato (extracted juice), 20 g glucose, 20 g agar, add water to make up to 1000 mL;

[0067] Comprehensive potato dextrose agar medium (CPDA medium): 200 g peeled potato (extract juice), 20 g glucose, 2 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate, 20 g agar, add water to make up to 1000 mL;

[0068] (2) Shake flask liquid strain production

[0069] Liquid culture medium formula: 20g molasses, 15g wheat bran, 1g potassium dihydrogen phosphate, 1g magnesium sulfate, 1000mL water, pH value after sterilization is 5.5;

[0070] The liquid culture medium was placed in a shake flask and sterilized at 121°C for 30 minutes. After sterilization, the shake flask was placed in a clean bench and cooled to below 25°C for standby use. According to the aseptic operation procedures, 24 mother culture blocks with a diameter of 5 mm were inoculated into the liquid culture medium. After inoculation, the culture was magnetically broken at 1200r / min for 1 hour, and then magnetically stirred and cultured in the dark at a temperature of 25°C and a speed of 600r / min for 6 days. The volume of the bacterial pellets was not less than 90% of the entire bacterial liquid. The color of the bacterial liquid and the morphology of the bacterial pellets were observed daily, and the bacterial strains with turbid culture liquid and abnormal foam were detected in time.

[0071] (3) Liquid strain production in fermentation tanks

[0072] The formula of liquid strain in fermentation tank is the same as that of liquid strain in shake flask;

[0073] The liquid culture medium is stirred evenly, and added to the tank after passing through a sieve. The liquid volume is 75% of the tank volume. 0.03% of the total volume of the liquid culture medium is added with polyether-modified silicone. After the air tightness inspection is good, sterilization is performed. The sterilization pressure is 0.11MPa, 121°C, and 60min. After the sterilization is completed, the culture medium temperature is reduced to 26°C through the cooling system. The flame inoculation method is used and inoculation is performed according to the aseptic operation procedures. The inoculation volume is 0.5% (v / v) of the total amount of the culture medium in the tank. The tank pressure is maintained at 0.05MPa, the ventilation ratio is 0.2vvm, and the culture is performed at 26°C for 6 days. The volume of the bacterial ball accounts for no less than 90% of the entire bacterial liquid. After inoculation, the color of the bacterial liquid, the morphology of the bacterial ball and the exhaust odor are checked daily. If any problems are found, they should be dealt with as soon as possible.

[0074] (4) Mushroom stick production: Mushroom stick formula: 79% hardwood chips, 20% wheat bran, 1% gypsum;

[0075] Accurately weigh the weight of each raw material according to the proportion of the formula, pour it into the mixer and mix it thoroughly for 10 minutes, then add water and mix it thoroughly to make the water content reach 55%, the pH value is 6.2, and use a bagging machine to bag the culture bags. The specifications of the cultivation bags are 17cm×58cm, and the bag weight is 2.7kg~2.8kg. The material rods are required to be tight and the bags are not damaged. After the loading is completed, the bag mouth is mechanically tied. The bag mouth is required to be tightly tied without air leakage. After tying, a small hole with a diameter of 5mm~6mm is pierced at 1 / 4 of the bottom of the material rod, and a ventilation tape is attached;

[0076] The assembled material rods should be sterilized in time. The process from adding water and stirring to the start of sterilization should be completed within 4 hours. High-pressure steam sterilization should be used at 116℃ for 300min. The sterilized material rods should be moved into a cooling room at 20℃ and a purification level of 100,000, and cooled to below 26℃ for use.

[0077] (5) Inoculation: Inoculation is performed using an inoculator. Before inoculation, the liquid culture pipeline is steam sterilized, and the inoculator, conveyor belt, and operator's hands are fully disinfected. During inoculation, holes are punched according to the specifications of the bacterial sticks, generally 6 holes with a hole diameter of 1.5 cm; inoculation is performed according to the specifications of the bacterial sticks, the inoculation depth is 5 cm, and 10 mL is inoculated in each hole. After inoculation, the outer bag is put on, sealed, and moved to the culture warehouse for culture, and the inoculation room and inoculator are thoroughly disinfected;

[0078] (6) Culture of mushroom sticks: The temperature of the culture room should be controlled at 21°C, the carbon dioxide concentration should be controlled within 0.35%, and the center temperature of the mushroom sticks should be controlled not to exceed 26°C. After the mycelium is fully grown, holes should be punctured. Each bag should have 100 holes with a hole depth of 5.0 cm. The holes should be arranged neatly and evenly spaced. The mycelium should be cultured in the dark before it is fully grown, and cultured in light after puncturing to promote color change.

[0079] (7) Fruiting: Cultivate for 90 days according to the mushroom stick specifications, and manage the mushroom sticks that have reached physiological maturity in time;

[0080] The mushroom sticks are removed from the bags and put on the shelves, with a distance of 10 cm between the mushroom sticks. Water is added according to the state of the mushroom sticks by injecting water, and the amount of water added is about 30% of the weight of the mushroom sticks before water addition. The temperature of the mushroom house is 18℃, with scattered light, and buds appear in 4d to 5d;

[0081] In accordance with the principle of keeping even, neat, good and removing inferior mushroom buds, thin out the buds in time. According to the formation of mushroom buds and the required number of buds, thin out the buds for many times. The first thinning starts when the buds are about 1 cm. According to the specifications of mushroom sticks, select 7 to 10 round and strong mushroom buds on each stick, with a spacing of more than 3 cm. Continue to thin out the buds for 2 to 3 days, and finally select 10 to 15.

[0082] After thinning the buds, lower the temperature to 12℃ for bud dormancy, which lasts for 2 days. This allows the buds to grow slowly and form high-quality mushrooms with thick caps, dense flesh, and short and thick stipes. Lower air humidity is conducive to bud dormancy. When the bud dormancy is over, the temperature should be 16℃, and ventilation and light should be increased to improve the quality of shiitake mushrooms.

[0083] According to market requirements, the mushrooms are harvested in time before the mycelium opens, and the mushroom stems, dead mushrooms and mushroom bodies that have fallen on the ground are removed in time.

[0084] After harvesting, we will start mushroom cultivation management at 25℃ for 2 weeks. During the cultivation period, we will promptly remove the sporadic mushrooms and the mushroom stems left by the last tide harvest to prevent them from rotting and breeding diseases and insect pests. Shiitake mushrooms can produce 5 waves of mushrooms. After each wave of cultivation, we will replenish water and carry out the next wave of mushroom production management. The management of bud urging, bud thinning, bud squatting, growth and harvesting is the same as above.

[0085] The principles and implementation methods of the present invention are described in this article using specific examples. The description of the above embodiments is only used to help understand the method and core idea of ​​the present invention. At the same time, for those skilled in the art, according to the idea of ​​the present invention, there will be changes in the specific implementation methods and application scope. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A Huxiang F3 mushroom strain, characterized in that: The fingerprint of the mushroom strain is composed of 7 pairs of SSR markers with specific allele fragments. The allele fragments amplified by the 7 pairs of SSR markers on the "Huxiang F3" strain are specifically: Le_fp0001 allele is 1; Le_fp0002 allele is 1; Le_fp0007 alleles are 2, 3; Le_fp0008 alleles are 1, 2, 3, 4; Le_fp0010 alleles are 1, 2; Le_fp0011 alleles are 1, 2, 3, 4; Le_fp0012 allele is 1; The specific numbering combination of the allelic fragments is: 11(23)(1234)(12)(1234)1; The Huxiang F3 shiitake mushroom strain is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 2020323.

2. A Huxiang F3 shiitake mushroom strain according to claim 1, characterized in that: The 7 pairs of SSR markers are specifically: Le_fp0001 forward primer: ACGCGTATCCTCCCCTAAGT, reverse primer: AAGCGATATGGATTTGACGC; Le_fp0002 forward primer: GGGCGAAACAATTTCAGGTA, reverse primer: ATGCCATCGTAAGGAACTCG; Le_fp0007 forward primer: CATTGCTCGGATCCTTCATT, reverse primer: TACCTCGTGCGGACTTTGAT; Le_fp0008 forward primer: CTCTTTGCACCCTCAACCTC, reverse primer: CAGCAGTCTCCTCTTGGCTC; Le_fp0010 forward primer: CGCATTGAGCTCCAAAAACT, reverse primer: AGGAGGAGAAGGAGGTCGAG; Le_fp0011 forward primer: ATAGGATGATTGAACGAGCAG, reverse primer: ACCGTAAGGTGGGAAGAAA; Le_fp00012 forward primer: ATGCCGTTCCAAAGATAC, reverse primer: TCTGTAACGCTTGTGGACTA.

3. The liquid spawn cultivation method of the Huxiang F3 shiitake mushroom spawn according to any one of claims 1 to 2, characterized in that: The following steps are involved: (1) Stock production: The Huxiang F3 stock was inoculated onto a sterilized culture medium under aseptic conditions and cultured at 23°C to 25°C in a ventilated and dark environment for 10 to 14 days to obtain the stock; (2) Shake flask liquid strain production: Sterilized liquid culture medium is placed in a shake flask, with the liquid volume being 50% to 60% of the total volume of the shake flask. After cooling to below 25°C, the mother culture is inoculated into the liquid culture medium under sterile conditions. After magnetic disruption, the culture is cultured in a shaker or magnetic stirrer in the dark to obtain a shake flask liquid strain. (3) Production of liquid strains in a fermenter: After screening the liquid culture medium, add it to a fermenter, the liquid volume of which is 70% to 80% of the volume of the fermenter, add 0.03% to 0.05% of the total volume of the liquid culture medium as a defoamer, and sterilize it. After sterilization, reduce the temperature of the culture solution to 23° C. to 26° C., and culture the liquid strains in a shake flask in a fermenter under sterile conditions to obtain a liquid strain; (4) Production of mushroom sticks: Pour all raw materials into a blender, add water until the water content of the mixture is 50wt% to 60wt%, stir thoroughly, then pack and sterilize, and cool to below 26°C for later use; (5) Inoculation, culture and fruiting: Inoculation is performed using an inoculator. Before inoculation, holes are punched in the mushroom sticks. After the holes are punched, the liquid spawn obtained in step (3) is inoculated. After inoculation, the mushroom sticks are covered with an outer bag, sealed and moved to a culture warehouse for mushroom stick culture. After the mycelium is fully grown, holes are punched. After 80 to 90 days of culture, mushroom sticks that have reached physiological maturity are promptly managed for fruiting.

4. The liquid spawn cultivation method of the Huxiang F3 shiitake mushroom spawn according to claim 3, characterized in that: The liquid culture medium is composed of the following raw materials: 15g-20g of molasses, 10g-20g of wheat bran, 1g of potassium dihydrogen phosphate, 1g of magnesium sulfate, and 1000mL of water. The pH value of the liquid culture medium after sterilization is 5.0-5.

5.

5. The liquid spawn cultivation method of the Huxiang F3 shiitake mushroom spawn according to claim 3, characterized in that: The culture temperature in step (2) is 23° C. to 26° C., the culture time is 5 d to 7 d, the shaking speed is 110 r / min to 170 r / min, and the magnetic stirrer speed is 400 r / min to 800 r / min.

6. The liquid spawn cultivation method of the Huxiang F3 shiitake mushroom spawn according to claim 3, characterized in that: The culture temperature in step (3) is 23° C. to 26° C., the culture time is 6 days to 8 days, the fermentation tank pressure during the culture process is 0.03 MPa to 0.05 MPa, and the ventilation ratio is 0.2 vvm to 0.3 vvm.

7. The liquid spawn cultivation method of the Huxiang F3 shiitake mushroom spawn according to claim 3, characterized in that: The inoculation amount in step (3) is 0.05% to 0.5% of the total volume of the liquid culture medium.

8. The liquid spawn cultivation method of the Huxiang F3 shiitake mushroom spawn according to claim 3, characterized in that: The defoaming agent in step (3) is polyether-modified silicone.

9. The liquid spawn cultivation method of the Huxiang F3 shiitake mushroom spawn according to claim 3, characterized in that: The mushroom sticks are composed of the following raw materials in percentage by weight: 79% of broadleaf hardwood chips, 20% of wheat bran and 1% of gypsum.

10. The liquid spawn cultivation method of the Huxiang F3 shiitake mushroom spawn according to claim 3, characterized in that: The water content of the bacterial stick is 50wt%-60wt%, and the pH value of the bacterial stick after sterilization is 5.5-5.8.

Images