A strain of Bacillus atrophaeus and its application

Abstract

The present invention discloses a strain of Bacillus atrophaeus and its application, and relates to the technical field of plant biological pesticides. The Bacillus atrophaeus is classified and named as Bacillus atrophaeus, and the strain number is NWS-01. It has been deposited in the General Microbiological Center of China Microbiological Culture Collection Committee, and the deposit number is CGMCC No. 29755. In the present invention, the microbial agent is derived from the fermentation of Bacillus atrophaeus NWS-01, which can inhibit the growth of pathogenic fungi and reduce the incidence of plants; reduce the content of malondialdehyde in plants and enhance stress resistance; enhance plant photosynthesis, promote the accumulation of plant chlorophyll, and enhance the resistance and prevention ability of plants to diseases.

Description

Technical Field

[0001] The invention relates to the technical field of plant biological pesticides, and in particular to a strain of Bacillus atrophaeus and an application thereof. The invention also provides a method for preparing a microbial agent based on the Bacillus atrophaeus. Background Art

[0002] Fusarium oxysporum, a fungus that causes wilt, is a worldwide epidemic and important soil-borne disease that is common in fruit and vegetable cultivation. In recent years, the number of crops it harms has continued to increase, and it has become the main disease or primary disease of fruits and vegetables such as tomatoes, cucumbers, strawberries, grapes, zucchini, and peppers. It often causes the roots to turn black and brown, rot severely, and the plants die, resulting in serious losses. At present, most of the fruit and vegetable production processes still rely on the use of chemical agents. However, it is easy to cause plant resistance, excessive pesticide residues in fruits and vegetables, and a continuous decline in prevention and control effects. For the prevention and control of plant diseases, the most considerable benefits can be achieved at the lowest environmental and economic cost. Biological control is a safe prevention and control method of "using bacteria to treat bacteria". Because it conforms to the concept of green and sustainable development, it has attracted more and more attention. Using microorganisms instead of chemical pesticides to prevent and control fungal diseases is an important research and development direction in the future.

[0003] Plant growth promoting rhizobacteria (PGPR) have been proposed as one of the most promising alternatives to chemical agents from an environmental and health perspective. Plant roots are inhabited by a wide variety of microorganisms, constituting a huge source of PGPR. Since the rhizosphere gives roots a frontier resistance against pathogen attacks, plant rhizosphere microorganisms have great potential as biocontrol agents. Over the past 20 years, researchers have screened a large number of biocontrol strains from plant rhizospheres and conducted a series of studies. These PGPRs cover bacteria, fungi, and actinomycetes. At present, many PGPRs have been verified and registered for commercial use under greenhouse and field conditions, and a large number of strains have been identified and proven to be effective biocontrol agents (BCAs) under environmentally friendly conditions. The enthusiasm of researchers to screen beneficial microorganisms from plant rhizospheres for the development of biocontrol agents (BCAs) to replace chemical agents has expanded, and the industry related to biocontrol agents has developed rapidly, which is the trend of future development.

[0004] As the most representative strain successfully used in commerce, Bacillus has a long history in biological control and crop growth promotion applications. The reported biological control Bacillus mainly include Bacillus subtilis, Bacillus polymyxa, Bacillus cereus, Bacillus amyloliquefaciens, Bacillus megaterium, Bacillus pumilus and Bacillus lincheniformis. As a genus of Gram-positive bacteria, Bacillus can produce spores with strong stress resistance. In the process of biological control, it can often be compounded with chemical pesticides or fertilizers to enhance its application effect. At the same time, Bacillus biocontrol agents are rich in product types and can be processed into a variety of dosage forms, which greatly facilitates production, storage and transportation.

[0005] Therefore, Bacillus is the most widely used source of biological control agents. Exploring new potential biological control strains and developing them into new biological control agents is an inevitable trend and development trend based on the current situation of modern agriculture, and is also a demand for sustainable agricultural development in the future. Exploring the plant biocontrol properties derived from PGPR is of great significance and can lay the foundation for the commercial application of plant biocontrol bacteria. Summary of the invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a strain of Bacillus atrophaeus in view of the shortcomings of the prior art.

[0007] The technical problem that the present invention needs to solve is to provide a microbial agent and a preparation method thereof.

[0008] The final technical problem to be solved by the present invention is to provide the application of the above-mentioned Bacillus atrophaeus and microbial agent.

[0009] In order to solve the above technical problems, the present invention discloses a strain of Bacillus atropheaus, which is classified and named Bacillus atropheaus, the strain name is NWS-01, and has been deposited in the General Microbiology Center of China Microorganism Culture Collection Committee with a deposit number of CGMCC No.29755. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0010] The strain was screened by the inventor in June 2023 from the cotton rhizosphere soil of a cotton planting farm in Hutubi County, Xinjiang Uygur Autonomous Region. The 16S rRNA of B. atropheaus NWS-01 is shown in the sequence table SEQ ID No. 1, and the full length of the sequence is 1429 bp. By comparing the blastN sequence alignment tool in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the strain of the present invention was identified as Bacillus atropheaus and named NWS-01.

[0011] In a second aspect, the present invention discloses a microbial agent, wherein the microbial agent contains the Bacillus atrophaeus NWS-01 described in the first aspect.

[0012] In a third aspect, the present invention discloses a method for preparing the microbial agent described in the second aspect, and also discloses the optimal growth conditions of Bacillus atrophaeus NWS-01.

[0013] The preparation method comprises the following steps: the Bacillus atrophaeus NWS-01 is inoculated into a fermentation medium for fermentation culture. The microbial agent is the fermentation liquid obtained by fermentation culture.

[0014] Wherein, the fermentation medium comprises a carbon source, a nitrogen source and an inorganic salt; the carbon source is any one or more combinations of glucose, maltose, lactose, sucrose, glycerol, starch, molasses or mannitol; the carbon source concentration is 10-30 g / L; the nitrogen source is any one or more combinations of glycine, ammonium sulfate, beef extract, peptone, yeast extract, corn steep liquor, soybean meal powder or urea; the nitrogen source concentration is 5-20 g / L; the inorganic salt is any one or more combinations of K2HPO4, KH2PO4, MgSO4, MnSO4, CaCl2; the inorganic salt concentration is 0.1-0.4 g / L.

[0015] Preferably, the fermentation medium has a formula of: 10-30 g / L maltose, 5-20 g / L yeast extract, 0.1-0.3 g / L MgSO4, and 0.03-0.08 g / L MnSO4; more preferably, 20 g / L maltose, 10 g / L yeast extract, 0.15 g / L MgSO4, and 0.06 g / L MnSO4, and an initial pH of 7.0.

[0016] The fermentation culture has a culture temperature of 24-37°C, a culture time of 24-60 hours, a fermentation speed of 100-220 rpm, and a fermentation pH of 5.0-8.0. Preferably, 30°C, 200 rpm, pH 7.0, and culture for 24 hours.

[0017] Preferably, the preparation method of the microbial agent is: inoculate the seed liquid of Bacillus atrophaeus at an inoculation rate of 2% (v / v) into the fermentation medium, and ferment at a constant temperature of 30°C and 200rpm for 24h to obtain a fermentation liquid containing Bacillus atrophaeus. Preferably, the number of live Bacillus atrophaeus in the fermentation liquid is ≥1×10 9 CFU / mL. The seed solution is prepared by adding a selected single colony of B. atropheaus NWS-01 to a fresh LB liquid culture medium, and culturing it at 30°C and 200rpm overnight to obtain the seed solution.

[0018] In a fourth aspect, the present invention provides use of the Bacillus atrophaeus NWS-01 described in the first aspect or the microbial agent described in the second aspect in the preparation of a plant stress resistance agent.

[0019] In a fifth aspect, the present invention provides the use of the Bacillus atrophaeus NWS-01 described in the first aspect or the microbial agent described in the second aspect in preventing and treating plant diseases caused by plant fungal disease pathogens. The Bacillus atrophaeus NWS-01 or the microbial agent can reduce the incidence of plant fungal diseases.

[0020] Wherein, the plant fungal disease pathogens include Fusarium oxysporum, Fusarium graminearum, Alternaria alternata, Colletotrichum, Fusarium solani or Verticillium dahliae.

[0021] Preferably, the Bacillus atrophaeus NWS-01 or the microbial agent is used in preventing and treating plant wilt caused by Fusarium oxysporum.

[0022] In a sixth aspect, the present invention provides the use of the Bacillus atrophaeus NWS-01 described in the first aspect or the microbial agent described in the second aspect in enhancing plant respiration and photosynthesis.

[0023] In the applications described in the fourth to sixth aspects, the application method is to prepare the microbial agent into a certain concentration of agent solution, and then soak it in seeds, irrigate the roots of plants, or spray it on the leaves of crops to make it work. The concentration of the agent solution is generally 1×10 7 -1×10 9 CFU / mL, the dosage of the microbial agent is 1%-10% (mL / g soil), and when the roots are irrigated to the rhizosphere of the plant, the bacterial content in the soil is 1×10 6 -1×10 8 CFU / g soil.

[0024] The plants include but are not limited to food crops such as rice, corn, and wheat; they also include but are not limited to fruit vegetables such as tomatoes, cucumbers, eggplants, peppers, strawberries, and watermelons; and they also include but are not limited to leafy vegetables such as Chinese cabbage, rapeseed, and celery.

[0025] The microbial agent inhibits the growth of pathogenic fungi, reduces the content of malondialdehyde in plants, promotes the accumulation of plant chlorophyll, and enhances plant photosynthesis (leaf net photosynthetic rate, stomatal conductance, transpiration rate, etc.), thereby enhancing the plant's ability to resist and prevent diseases, improves the plant's physiological condition, and at the same time can enhance the plant's ability to cope with abiotic stress and improve stress resistance.

[0026] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0027] The present invention provides a novel biocontrol bacterium Bacillus atrophaeus, with a strain number of NWS-01, which is screened from rhizosphere soil of cotton in Xinjiang. It has good stress resistance, a broad-spectrum inhibitory effect on plant rhizosphere pathogenic fungi, a wide range of applications, and outstanding antagonism to wilt pathogens. After the strain NWS-01 is made into a biocontrol microbial agent by fermentation, it can not only inhibit wilt pathogens and effectively reduce the disease index of plant fungal diseases; it can also reduce the malondialdehyde content in the plant body, reduce the degree of membrane lipid peroxidation caused by biological stress, and thus protect the plant and enhance stress resistance. The biocontrol microbial agent can also promote the accumulation of plant chlorophyll, enhance plant photosynthesis, promote gas exchange and photosynthesis, improve the physiological condition of the plant, and enhance the plant's resistance and prevention ability to diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0029] Figure 1 This is the screening source and in vitro antibacterial effect evaluation of Bacillus atrophaeus NWS-01 in Example 1. Figure 1 A is the mycelium growth plate diagram of mycelium growth rate inhibition method, Figure 1 B is the in vitro antibacterial effect evaluation diagram.

[0030] Figure 2 This is a diagram showing the antagonistic effect of Bacillus atrophaeus NWS-01 on Fusarium oxysporum in the in vitro antibacterial experiment in Example 2.

[0031] Figure 3 This is a graph showing the growth of Bacillus atrophaeus NWS-01 at different temperatures.

[0032] Figure 4 This is a graph showing the growth status of Bacillus atrophaeus NWS-01 under different carbon and nitrogen sources. Figure 4 A is the growth status of Bacillus atrophaeus NWS-01 under different carbon sources. Figure 4 B is a graph showing the growth of Bacillus atrophaeus NWS-01 under different nitrogen sources.

[0033] Figure 5 This is the result of the effect of Bacillus atrophaeus NWS-01 on the incidence of cucumber wilt and the content of malondialdehyde.

[0034] Figure 6 These are the chlorophyll, stomatal conductance, net photosynthetic rate and transpiration rate indicators of cucumber plants in the biocontrol experiment of cucumber wilt disease using Bacillus atrophaeus NWS-01. DETAILED DESCRIPTION

[0035] Example 1 Screening of plant rhizosphere biocontrol bacteria NWS-01

[0036] Healthy plants adjacent to the diseased plants were selected from the cotton planting base. The loose and large soil at the roots of the cucumber plants were shaken off vigorously. The roots were then cut off and placed in 10 mL of sterile water for full shaking. The roots were centrifuged at 4000 × g for 2 min. The supernatant was taken for gradient dilution and the concentration was 10 -3 , 10 -4 , 10 -5 Take 100 μL of the dilution and spread it on NA solid plates, and incubate it at 30℃ for 24h to isolate rhizosphere bacteria. Take the plate confrontation method, take Fusarium oxysporum as the indicator strain, pick the isolated single colony with a sterilized toothpick, and inoculate it on the PDA plate 3cm away from Fusarium oxysporum. After incubation at 25℃ for 72h, observe the formation of the inhibition zone. Pick the strain with antagonistic ability and purify it by streaking, and store it at -80℃ in 15% v / v sterile glycerol.

[0037] The mycelium growth rate inhibition method was used to evaluate the antagonistic ability of the screened strains against Fusarium oxysporum. A pathogen cake with a diameter of 6 mm was inoculated in the center of the PDA plate. A sterile hole with a diameter of 6 mm was punched at 3 cm from the center of the plate and inoculated with 20 μL of the test bacterial solution cultured overnight. An equal amount of sterile NA liquid culture medium was added to the control well. After culturing at 25°C for 72 hours, the mycelium diffusion distance was measured, and the mycelium growth inhibition rate MGI was calculated as (mycelium diffusion distance of the control group - mycelium diffusion distance of the experimental group) / mycelium diffusion distance of the control group × 100%, which was used to evaluate the antagonistic ability of biocontrol bacteria against pathogens. Figure 1 As shown in A. Each treatment was repeated three times.

[0038] Experimental results:

[0039] Potential strains with antibacterial ability in the rhizosphere soil of cotton were isolated by dilution and coating, and finally 180 cotton rhizosphere bacteria with different morphologies were isolated. Using Fusarium oxysporum as an indicator strain, the antibacterial ability of the 180 rhizosphere bacteria screened was verified by plate confrontation, and finally 30 antagonistic strains with antibacterial ability were obtained. The antagonistic ability of the 30 screened strains against Fusarium oxysporum was evaluated by the mycelium growth rate method. The results showed that 4 strains (numbered JF-4, JFM-8, Sa, Sl) showed excellent antagonistic ability, and their relative inhibition rates against the mycelium of Fusarium oxysporum were 36.03%, 44.98%, 46.18% and 41.1%, respectively (such as Figure 1 B).

[0040] The strain numbered Sa with the highest relative inhibition rate of Fusarium oxysporum hyphae was selected for physiological and biochemical property analysis. The DNA of strain Sa was extracted using a genomic DNA extraction kit, and PCR amplification was performed using the 16S rDNA gene universal primer pair 27F and 1492R (27F: 5'-3'AGAGTTTGATCCTGGCTCAG, 1492R: 5'-3'TACGGCTACCTTGTACGACTT). The obtained PCR product was sequenced by Anhui General Biological Company, and the measured sequence (as shown in SEQ ID No. 1) was 1429 bp in length. By comparing the blastN sequence alignment tool in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the strain of the present invention was identified as Bacillus atropheaus, named NWS-01. The strain has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit number CGMCC No.29755. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0041] Example 2 NWS-01 has the highest inhibitory effect on cucumber wilt pathogens

[0042] Furthermore, we investigated the antagonistic effect of strain NWS-01 on different Fusarium oxysporum genotypes (including beans, strawberries, cotton, cucumbers, lotus roots, and watermelons) against Fusarium wilt caused by Fusarium oxysporum. The antagonistic ability of strain NWS-01 was evaluated by measuring the interval between the interaction zone between biocontrol bacteria and pathogens. Figure 2 As shown, NWS-01 has good antagonistic effects on different specialized types of Fusarium oxysporum, among which it has the strongest antagonistic effect on the cucumber specialized type of Fusarium oxysporum, with an inhibition zone of more than 10 mm, and also has a certain antagonistic effect on other plants. The present invention takes cucumber wilt disease as an example for demonstration.

[0043] Example 3 Preparation method of microbial agent based on Bacillus atrophaeus NWS-01

[0044] The method for preparing the NWS-01 seed solution is as follows: a single colony of NWS-01 is selected and placed in a fresh LB liquid culture medium, and cultured overnight at 30°C and 200 rpm to obtain the seed solution.

[0045] 1) Optimum growth temperature of NWS-01

[0046] The NWS-01 seed solution was inoculated into a 50 mL conical flask containing fermentation medium at a 2% v / v inoculation rate, and different temperature gradients (24°C, 28°C, 30°C, 32°C, 37°C) were set and shaken at 200 rpm for 24 h. The inoculation time was taken as the initial time, and samples were taken every 2 h thereafter and their OD 600 The fermentation medium formula was obtained by optimizing the following carbon source and nitrogen source.

[0047] Experimental results:

[0048] like Figure 3 As shown in the figure, within the culture temperature range of 24℃-37℃, the growth difference of strain NWS-01 is not large. The results show that in the first 8h of strain growth, the growth rate of the bacteria accelerates with the increase of temperature. This shows that in the early stage of strain growth, appropriately increasing the temperature can accelerate the time for the strain to enter the exponential growth phase. As the culture time is further extended, too high a temperature is not conducive to the growth of the bacteria. At 30℃, the strain can reach the maximum biomass.

[0049] 2) Optimal carbon and nitrogen sources for the growth of NWS-01

[0050] Prepare NWS-01 seed solution, add 1g / L of different nitrogen sources (glycine, (NH4)2SO4, beef extract, peptone, yeast extract, urea) to the nitrogen source utilization basic medium (KH2PO4 1.36g / L, CaCl2 0.005g / L, NaH2PO4 2.13g / L, anhydrous glucose 10.0g / L, MgSO4·7H2O 0.2g / L, FeSO4·7H2O 0.0005g / L). Place 10mL of culture solution with different nitrogen sources in a 50mL conical flask, inoculate at 2% v / v at 30°C, shake at 200rpm for 24h. Measure the OD of the culture solution with a spectrophotometer. 600 The culture medium without inoculation was set as blank control, and three parallel groups were set up.

[0051] Prepare NWS-01 seed solution, add 10g / L of different carbon sources (glucose, maltose, lactose, sucrose, glycerol, mannitol) to the carbon source utilization basic medium (MgSO4·7H2O 0.2g / L, (NH4)2SO42.0g / L, NaH2PO4·2H2O 0.5g / L, CaCl2 0.1g / L, K2HPO4 0.5g / L). Place 10mL of culture solution with different carbon sources in a 50mL conical flask, inoculate at 2% v / v at 30°C, shake at 200rpm for 24h. Measure the OD of the culture solution with a spectrophotometer 600 The culture medium without inoculation was set as blank control, and three parallel groups were set up.

[0052] Experimental results:

[0053] The results are as follows Figure 4 As shown. The strain NWS-01 showed the ability to efficiently utilize multiple carbon sources. When maltose was used as the only carbon source, the fermentation broth showed the highest biomass, while when lactose was used as the only carbon source, the bacterial growth was slow. It was proved that the most suitable carbon source for the growth of strain NWS-01 was maltose ( Figure 4 A).

[0054] Furthermore, the effects of different nitrogen sources on bacterial growth were investigated. The results showed that when yeast extract was the only nitrogen source, the bacterial biomass reached the highest level, while when (NH4)2SO4 was the only nitrogen source, the bacterial growth was not favorable ( Figure 4 B).

[0055] Based on the above experimental results, the fermentation medium formula used in the fermentation of the microbial biocontrol agent proposed in the present invention is: 10-30 g / L maltose, 5-20 g / L yeast extract, 0.1-0.3 g / L magnesium sulfate, 0.03-0.08 g / L manganese sulfate, and an initial pH of 7.0, preferably, 20 g / L maltose, 10 g / L yeast extract, 0.15 g / L magnesium sulfate, 0.06 g / L manganese sulfate, and an initial pH of 7.0. The fermentation broth obtained by the above preferred fermentation method is the NWS-01 microbial agent, and the number of live Bacillus atrophaeus in the fermentation broth is ≥1×10 9 CFU / mL.

[0056] Example 4 The biocontrol agent based on NWS-01 has a significant in situ biocontrol effect on cucumber wilt

[0057] In view of the fact that NWS-01 has the highest in vitro inhibitory effect on the pathogen of cucumber wilt, the present invention takes cucumber plants as an example to investigate the biocontrol effect of NWS-01 on cucumber wilt. We judged the disease index of cucumber by the incidence rate, and measured the malondialdehyde content, chlorophyll content and photosynthetic parameters such as transpiration rate, stomatal conductance and net photosynthetic rate of the leaves of cucumber plants to evaluate the biocontrol effect.

[0058] Four weeks after inoculation with the Fusarium oxysporum cucumber-specific (FOC) pathogen, the severity of the disease of each plant was evaluated on a scale of 0 to 4 according to the disease index (0 = healthy plant, 1 = 1-33%, 2 = 34-66%, 3 = 67-97%, 4 = dead plant) and calculated according to the following formula: Incidence = ∑ (disease index × number of plants with the disease index) / (total number of plants investigated × 4). The microbial inoculant prepared in Example 3 was used to treat the wilt cucumbers. The concentration of the inoculant solution was adjusted to 1×10 7 -1×10 9 CFU / mL, the dosage of the microbial agent is 1%-10% (mL / g), and when the roots are irrigated to the rhizosphere of the plant, the bacterial content in the soil is 1×10 6 -1×10 8 CFU / g soil. Cultivation continued for four weeks after inoculation. Then samples were collected. All plants were cultured in a greenhouse with a photoperiod of 16h (28℃, 4000lx), a relative humidity of 65%, and fertilized twice a week with 1 / 4MS liquid fertilizer. For each treatment, there were three replicates, each with six seedlings.

[0059] Experimental result 1:

[0060] The results are as follows Figure 5 As shown, compared with the pathogen treatment group, the addition of NWS-01 significantly alleviated the disease caused by the infection of Fusarium oxysporum cucumber type (FOC), and its incidence rate was 26.39% (NWS-01+FOC group), which was significantly lower than the 51.39% of the FOC treatment group. At the same time, yellow spots can be observed on the surface of the cucumber leaves, which is a symptom of the early stage of the disease. The above results show that NWS-01 significantly alleviates the symptoms of cucumber wilt caused by FOC infection.

[0061] At the same time, this example also tested the malondialdehyde (MDA) content of the NWS-01 microbial agent treatment group and the control group using the TBA colorimetric method. Figure 5As shown, compared with the blank control group, there was no significant difference in the malondialdehyde content of cucumber plants in the NWS-01 microbial agent treatment group, while the malondialdehyde content in the cucumber plants in the NWS-01+FOC group was significantly reduced by 42.70% compared with the FOC group. The above results show that the application of NWS-01 has no adverse effects on healthy plants. At the same time, the inoculation of NWS-01 can significantly alleviate the increase of MDA content in cucumbers caused by pathogen infection, reduce the degree of membrane lipid peroxidation caused by biological stress, and thus protect plants.

[0062] In addition, we also explored the improvement of photosynthetic capacity of cucumbers infected with Fusarium wilt by using NWS-01-based biocontrol agents. The dosage of microbial agents and the planting conditions of plants were the same as above. A portable chlorophyll meter was used to detect the chlorophyll content of cucumber leaves, and a portable photosynthetic system (LI-800, LI-COR, USA) was used to measure stomatal conductance, net photosynthetic rate, and transpiration rate.

[0063] Experimental result 2:

[0064] The results are as follows Figure 6 As shown, the chlorophyll content of cucumber leaves in the NWS-01 microbial agent treatment group increased by 12.71% compared with the blank control group, and the chlorophyll content of cucumber leaves in the NWS-01+FOC group increased by 27.21% compared with the FOC group, indicating that the application of NWS-01 can significantly improve the health of cucumber leaves and increase the chlorophyll content in plants.

[0065] On the other hand, the net photosynthetic rate, stomatal conductance and transpiration rate of cucumber seedlings in the pathogen FOC treatment group were the lowest among the three treatments, only 58.27%, 33.47% and 32.36% of the blank control group, which were significantly reduced. The co-application of biocontrol bacteria NWS-01 and pathogen FOC changed this phenomenon. The net photosynthetic rate, stomatal conductance and transpiration rate of cucumber seedlings in the NWS-01+FOC group increased by 81.57%, 143.68% and 215.38% respectively compared with the pathogen treatment group. This shows that the application of NWS-01 significantly improved the damage to the photosynthetic function of cucumber plants caused by pathogen infection, promoted gas exchange and photosynthesis, and thus improved the physiological condition of the plants. In addition, the net photosynthetic rate, stomatal conductance and transpiration rate of the NWS-01 microbial agent treatment group were significantly higher than those of the blank control group, indicating that in healthy plants, the application of NWS-01 can also significantly improve the gas exchange and photosynthesis of the plants, and further improve the physiological condition of the plants.

[0066] The present invention provides a strain of Bacillus atrophaeus and its application ideas and methods. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A strain of Bacillus atrophaeus, whose classification name is Bacillus atrophaeus, strain number is NWS-01, deposit number is CGMCC No.29755, deposit address is General Microbiology Center of China Microorganism Culture Collection Administration, deposit time is January 24, 2024, and the Bacillus atrophaeus is used to prepare plant stress resistance agents, to prevent and treat plant wilt caused by Fusarium oxysporum, or to enhance plant photosynthesis.

2. A microbial agent, comprising the Bacillus atrophaeus NWS-01 according to claim 1.

3. The method for preparing the microbial agent according to claim 2, characterized in that: The method comprises the following steps: inoculating the Bacillus atrophaeus NWS-01 into a fermentation medium for fermentation culture.

4. The preparation method according to claim 3, characterized in that: The fermentation medium comprises a carbon source, a nitrogen source and an inorganic salt; The carbon source is any one or more of glucose, maltose, lactose, sucrose, glycerol, starch, molasses or mannitol; the carbon source concentration is 10-30 g / L; The nitrogen source is any one or more of glycine, ammonium sulfate, beef extract, peptone, yeast extract, corn steep liquor, soybean meal powder or urea; the concentration of the nitrogen source is 5-20 g / L; The inorganic salt is any one or more combinations of K2HPO4, KH2PO4, MgSO4, MnSO4, and CaCl2; the concentration of the inorganic salt is 0.1 to 0.4 g / L.

5. The preparation method according to claim 4, characterized in that: The fermentation medium has the following formula: 10-30 g / L maltose, 5-20 g / L yeast extract, 0.1-0.3 g / L MgSO4, and 0.03-0.08 g / L MnSO4; The fermentation culture has a culture temperature of 28 to 37° C. and a culture time of 24 to 60 hours.

6. Use of the Bacillus atrophaeus NWS-01 according to claim 1 or the microbial agent according to claim 2 in the preparation of plant stress resistance agents.

7. Use of the Bacillus atrophaeus NWS-01 according to claim 1 or the microbial agent according to claim 2 in preventing and controlling plant diseases caused by plant fungal disease pathogens; the plant diseases caused by the plant fungal disease pathogens are plant wilt caused by Fusarium oxysporum.

8. Use of the Bacillus atrophaeus NWS-01 according to claim 1 or the microbial agent according to claim 2 in enhancing plant photosynthesis.

Images