Primers, kits and methods for simultaneous detection of listeria monocytogenes and listeria monocytogenes cc8 strain

Abstract

The application discloses primers, a kit and a method for simultaneously detecting Listeria monocytogenes and Listeria monocytogenes CC8 type strains. The nucleotide sequences of the primer groups are shown as SEQ ID NO:1-8. The primer groups provided by the application can simultaneously detect specific targets of Listeria monocytogenes and Listeria monocytogenes CC8 type strains, can save the amount of reagents used and reduce the detection cost, have the characteristics of high throughput, have the advantages of high sensitivity, economy, rapidness, simple operation, high accuracy and the like, and can be widely applied to fields such as the food industry and the public health industry.

Description

Technical Field

[0001] This invention belongs to the field of microbial detection technology, specifically relating to primers, kits, and methods for simultaneously detecting Listeria monocytogenes and Listeria monocytogenes CC8 strain. Background Technology

[0002] Listeria monocytogenes is an important facultative anaerobic Gram-related foodborne pathogen that can cause serious listeriosis, including sepsis, meningitis, meningoencephalitis, and pleuromyositis. In pregnant women, it can even lead to miscarriage and other serious consequences. The most vulnerable populations are the elderly, newborns, pregnant women, and those with weakened immune systems. The mortality rate is 20%-30%. In recent years, sporadic cases of listeriosis have been reported in some cities in my country, primarily affecting pregnant women and newborns, posing a certain threat to the health of Chinese residents.

[0003] Listeria monocytogenes exhibits rich genetic diversity, with 14 serotypes: 1 / 2a, 1 / 2b, 1 / 2c, 3a, 3b, 3c, 4a, 4b, 4c, 4ab, 4d, 4e, 4h, and 7. Pulse-field gel electrophoresis (PFGE) is considered the gold standard for molecular typing of Listeria monocytogenes. However, with the development of DNA sequencing technology, multilocus sequence typing (MLST) has become the popular method for analyzing the genetic diversity of Listeria monocytogenes. MLST offers comparable resolution and stability to PFGE and provides higher resolution and reliability than serotyping. According to statistics from the Pasteur Institute's BIGSdb-Lm database, 2331 sequence types (STs) have been identified for Listeria monocytogenes as of December 15, 2020. Listeria monocytogenes is widely distributed in food processing, aquatic, and soil environments due to its tolerance to low temperatures, low water activity, wide pH range, and high salinity. Currently, many Chinese scholars have reported that clonal complex (CC) 8 strains are the dominant type in both food and clinical samples, possibly related to their tolerance to certain doses of disinfectants, strong biofilm formation ability, and resistance to oxidative stress. Furthermore, studies have shown that CC8 strains are the main genotype causing long-term, persistent contamination in food production and processing, posing a serious potential threat to food safety. Therefore, there is an urgent need to develop a rapid method for detecting CC8 strains in food and food processing environments.

[0004] Several methods exist for identifying Listeria monocytogenes subtypes, including molecular biology methods and traditional colony counting. However, these methods have limitations, such as long processing times, high costs, and low throughput. While MLST (Multi-Layer Sequencing) technology can accurately identify the CC serotype of Listeria monocytogenes, DNA sequencing is currently costly and time-consuming, and the accuracy of sequencing directly affects the accuracy of MLST typing results. Therefore, it is necessary to develop a rapid, high-throughput, and low-cost method as an alternative for Listeria monocytogenes subtype identification. With the development of microbial whole-genome sequencing technology, obtaining CC serotype-specific DNA detection targets based on comparative genomics analysis can lead to the development of rapid, high-throughput, inexpensive, and highly sensitive PCR identification techniques.

[0005] Multiplex PCR is a PCR technique that uses multiple pairs of specific primers to simultaneously amplify multiple specific DNA sequence targets in the same reaction system. It is currently widely used in biological and medical fields such as microbial serotyping, molecular typing, pathogen detection, transgenic identification, and genetic disease diagnosis. Multiplex PCR has the following advantages: (1) High throughput, up to 384 samples can be identified in one operation; (2) Low cost and high efficiency, multiple specific targets can be detected simultaneously in the same PCR amplification system without DNA sequencing, and the results can be judged based on the target sequence DNA band amplification results; (3) Easy to operate and short time, multiple targets can be amplified simultaneously in one step in the same PCR reaction, and accurate results can be obtained within 150 minutes; (4) High accuracy, achieving synchronous specific amplification of multiple targets, greatly reducing the possibility of false positives. As the number of primer pairs increases, the inhibitory effect between primers reduces the detection throughput of multiplex PCR. In the practical application of multiplex PCR technology, the addition of multiple primer pairs in the same reaction tube leads to problems such as non-specific amplification of primers, formation of primer dimers, and optimization of the PCR reaction system to ensure that each target DNA sequence can be effectively amplified, which limits the application of multiplex PCR technology.

[0006] HRM qPCR is an analytical method that uses multiple pairs of specific primers to simultaneously amplify multiple specific DNA sequence targets in the same reaction system and uses high-resolution melting curves. It is an analytical method based on the different melting curves formed by the different melting temperatures of single nucleotides, and can detect multiple genes simultaneously. HRM qPCR technology has the following advantages: (1) Simple operation, achieving simultaneous specific amplification and analysis of multiple targets in the same HRM qPCR reaction, realizing true closed-tube operation and reducing the risk of contamination; (2) Short analysis time, accurate results can be obtained within 70 minutes; (3) High sensitivity and specificity, compared with PCR, the detection limit of HRM qPCR is 10 to 100 times lower and the sensitivity is higher.

[0007] Since current Listeria monocytogenes molecular detection kits rely on specific loci derived from limited Listeria monocytogenes genome analysis, our analysis confirmed the presence of target gene sequences as CC8-specific loci in CC269 and ST1197, while some CC8 strains in the NCBI database do not carry this specific locus. Therefore, this patent selected 1928 genomes belonging to 442 ST types (123 CC types) and 111 single ST types for more in-depth whole-genome analysis to obtain specific genes for Listeria monocytogenes CC8 strains. This led to the development of high-throughput, high-sensitivity, and accurate multiplex PCR and HRM qPCR detection technologies and corresponding kits for Listeria monocytogenes and Listeria monocytogenes CC8 strains, which are of significant value for food production enterprises and inspection and quarantine departments in detecting / monitoring Listeria monocytogenes contamination. Summary of the Invention

[0008] This invention utilizes multiplex PCR and HRM qPCR technologies developed based on comparative genomics analysis to simultaneously detect specific targets of Listeria monocytogenes and Listeria monocytogenes CC8 strains, enabling direct identification of Listeria monocytogenes and Listeria monocytogenes CC8 strains.

[0009] One objective of this invention is to provide a primer set for the simultaneous detection of Listeria monocytogenes and Listeria monocytogenes CC8 strain. The primer set includes primers with nucleotide sequences as shown in SEQ ID NO:1-2 and SEQ ID NO:5-6. The primers designed in this invention can amplify target bands at different positions, clearly distinguishing between Listeria monocytogenes and Listeria monocytogenes CC8.

[0010] Preferably, the target gene amplified by the primers shown in SEQ ID NO:1-2 is LM5578_1180; and the target gene amplified by the primers shown in SEQ ID NO:5-6 is LM5578_2262.

[0011] This invention designs specific amplification primers targeting specific target sequences of *Listeria monocytogenes* and *Listeria monocytogenes* CC8 strain, respectively. The reason for choosing these genes as targets for each strain is that the gene "LM5578_1180" is a specific molecular target of *Listeria monocytogenes* CC8 strain, existing only in *Listeria monocytogenes* CC8 strain; the gene "LM5578_2262" is a specific molecular target of *Listeria monocytogenes* strain. Therefore, when using primers as shown in SEQ ID NO:1-2 and SEQ ID NO:5-6 for multiplex PCR, two results will appear in the PCR products: if both the target gene dpnA (855bp) and ycnI (187bp) amplify simultaneously, the strain is identified as a CC8 strain; if only the target gene ycnI (187bp) amplifies, the strain is identified as *Listeria monocytogenes*.

[0012] A second objective of this invention is to provide a qPCR primer set for the simultaneous detection of Listeria monocytogenes and Listeria monocytogenes CC8 strain. The primer set includes primers with nucleotide sequences as shown in SEQ ID NO:3-4 and SEQ ID NO:7-8. The primers designed in this invention can obtain two melting peaks at different temperatures, clearly distinguishing between Listeria monocytogenes and Listeria monocytogenes CC8.

[0013] Preferably, the target gene amplified by the primers shown in SEQ ID NO:3-4 is LM5578_1180; and the target gene amplified by the primers shown in SEQ ID NO:7-8 is LM5578_2262.

[0014] This invention designs specific amplification primers targeting specific target sequences of *Listeria monocytogenes* and *Listeria monocytogenes* CC8 strain, respectively. The reason for choosing these genes as targets for each strain is that the gene "LM5578_1180" is a specific molecular target of *Listeria monocytogenes* CC8 strain, existing only in *Listeria monocytogenes* CC8 strain; the gene "LM5578_2262" is a specific molecular target of *Listeria monocytogenes* strain. Therefore, when using primers as shown in SEQ ID NO:3-4 and SEQ ID NO:7-8 for HRM qPCR, the high-resolution melting curve will show two results: if both melting peaks of the target gene dpnA (78.5℃) and ycnI (80.5℃) appear simultaneously, the strain is identified as a CC8 strain; if only one melting peak of the target gene ycnI (80.5℃) appears, the strain is identified as *Listeria monocytogenes*.

[0015] The third objective of this invention is to provide a specific target sequence for identifying Listeria monocytogenes and Listeria monocytogenes CC8 strains, wherein the specific target sequence includes nucleotide sequences as shown in SEQ ID NO:9-10.

[0016] The fourth objective of this invention is to provide a kit for detecting Listeria monocytogenes and Listeria monocytogenes CC8 strains, the kit comprising primer sets as shown in SEQ ID NO:1-2 and SEQ ID NO:5-6.

[0017] Preferably, the kit further includes: Taq DNA polymerase, MgCl2, PCR amplification buffer, dNTPs, and deionized water.

[0018] The fifth objective of this invention is to provide a method for detecting Listeria monocytogenes and Listeria monocytogenes CC8 strains for non-disease diagnosis and treatment purposes, comprising the following steps:

[0019] S1. Extract genomic DNA from the bacterial strain to be tested;

[0020] S2. Perform multiplex PCR: Using the genomic DNA of the test strain as a template, amplify the target sequence using primer sets as shown in SEQ ID NO:1-2 and SEQ ID NO:5-6.

[0021] S3. Determine the amplification products from step S2.

[0022] Preferably, the determination result is as follows: if two amplification bands of the target gene dpnA (855bp) and ycnI (187bp) appear simultaneously, the strain is identified as a CC8 type strain; if only one amplification band of the target gene ycnI (187bp) appears, the strain is identified as Listeria monocytogenes.

[0023] Preferably, the multiplex PCR reaction system comprises: 0.5 μL of primers shown in SEQ ID NO:1-2 and SEQ ID NO:5-6 at a concentration of 10 μM, 0.5 μL of Taq DNA polymerase at 2.5 U / μL, 2 μL of 25 mmol / L MgCl2, 2 μL of 10 mmol / L dNTP, 5 μL of 5×PCR amplification buffer, 1 μL of DNA template, and 12.5 μL of sterile deionized water.

[0024] Preferably, the reaction procedure for the multiplex PCR is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 50 s, extension at 72°C for 60 s, amplification for 35 cycles; and final extension at 72°C for 10 min.

[0025] The sixth objective of this invention is to provide an HRMqPCR kit for detecting Listeria monocytogenes and Listeria monocytogenes CC8 strains, the kit comprising primer sets as shown in SEQ ID NO:3-4 and SEQ ID NO:7-8.

[0026] Preferably, the kit further includes: TB Green Premix Ex Taq II (Tli RNaseH Plus) and deionized water.

[0027] The seventh objective of this invention is to provide a method for detecting Listeria monocytogenes and Listeria monocytogenes CC8 strains for non-disease diagnosis and treatment purposes, comprising the following steps:

[0028] S1. Extract genomic DNA from the bacterial strain to be tested;

[0029] S2. Perform HRM qPCR: Using the genomic DNA of the test strain as a template, amplify the target sequence using primer sets as shown in SEQ ID NO:3-4 and SEQ ID NO:7-8;

[0030] S3. Determine the amplification products from step S2.

[0031] Preferably, the determination result is as follows: if two melting peaks appear simultaneously at 78.5℃ and 80.5℃, the strain is identified as a CC8 type strain; if only one melting peak appears at 80.5℃, the strain is identified as Listeria monocytogenes.

[0032] Preferably, the HRM qPCR reaction system comprises: 0.5 μL of primers shown in SEQ ID NO:3-4 and SEQ ID NO:7-8 at a concentration of 10 μM, 10 μL of TB Green Premix Ex Taq II (Tli RNaseH Plus), 1 μL of DNA template, and 7 μL of sterile deionized water.

[0033] Preferably, the HRM qPCR reaction program is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s, amplification for 40 cycles; denaturation at 95℃ for 60 s, annealing at 40℃ for 60 s, then the temperature is increased from 65℃ to 97℃, the melting rate is 0.07℃ / s, and the fluorescence signal is monitored at 15 readings / ℃.

[0034] The eighth objective of this invention is to provide the application of the primer set, specific target sequence, or kit of this invention in the identification of Listeria monocytogenes and Listeria monocytogenes CC8 strains.

[0035] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0036] (1) This invention utilizes the specific target DNA sequences of Listeria monocytogenes and Listeria monocytogenes CC8 strain obtained by comparative genomics analysis, and amplifies them using multiplex PCR and HRM qPCR technology to achieve rapid identification of CC8 strains, with accurate and reliable results.

[0037] (2) The multiplex PCR and HRM qPCR kit for simultaneous detection of Listeria monocytogenes and Listeria monocytogenes CC8 strain disclosed in this invention can simultaneously detect multiple specific targets of Listeria monocytogenes and Listeria monocytogenes CC8 strain. It can not only save reagent usage and reduce detection costs, but also has high throughput, improve detection efficiency, and has the advantages of high sensitivity, economy and speed, simple operation and high accuracy.

[0038] (3) When performing detection using the multiplex PCR kit disclosed in this invention, only multiplex PCR amplification combined with agarose gel electrophoresis is required to accurately identify Listeria monocytogenes and Listeria monocytogenes CC8 strain. The steps are simple and quick, and there is no need to perform DNA sequence determination and comparison analysis. This shortens the identification time and reduces the factors that affect the reliability of the results due to the accuracy of DNA sequence determination.

[0039] (4) The multiplex PCR detection system of the present invention has high specificity. The sensitivity of the multiplex PCR kit for detecting CC8 strains reaches 99.1 fg / 25 μL. It can be performed in a single tube, which is simple and fast. It has the advantages of high sensitivity, economy, speed and high throughput. It can be used to develop related detection kits and can be applied to food inspection, inspection and quarantine departments.

[0040] (5) When the HRM qPCR kit disclosed in this invention is used for detection, only HRM qPCR amplification is required to accurately identify Listeria monocytogenes and Listeria monocytogenes CC8 strain. The steps are simple and quick, and there is no need to perform DNA sequence determination and comparison analysis. This shortens the identification time and reduces the factors that affect the reliability of the results due to the accuracy of DNA sequence determination.

[0041] (6) The HRM qPCR detection system of the present invention has high specificity. The HRM qPCR kit has a sensitivity of 0.991 fg / 20 μL for detecting CC8 strains. It can be performed in a single tube, and the operation is simple and fast. It has the advantages of high sensitivity, economy, speed and high throughput. It can be used to develop related detection kits and can be applied to food inspection, inspection and quarantine departments. Attached Figure Description

[0042] Figure 1This is a schematic diagram of the specific analysis results of multiplex PCR for Listeria monocytogenes CC8 strain (M is the DL2000 DNA standard marker, - is the negative control, lanes 1-85 are the agarose gel electrophoresis results of the PCR products, where 1-14 are Listeria monocytogenes CC8 strains, and 15-85 are other CC-type Listeria monocytogenes).

[0043] Figure 2 This is a schematic diagram of the sensitivity assay results for multiplex PCR of Listeria monocytogenes CC8 strain (M is the DL2000 DNA standard marker, - is the negative control; the DNA template concentrations corresponding to lanes 1-9 are 99.1 ng, 9.91 ng, 0.991 ng, 99.1 pg, 9.91 pg, 0.991 pg, 99.1 fg, 9.91 fg, and 0.991 fg, respectively).

[0044] Figure 3 This is a schematic diagram of the HRM qPCR specificity analysis results of Listeria monocytogenes CC8 strain (dashed line represents the melting peak of Listeria monocytogenes CC8 strain, solid line represents the melting peak of other CC strains of Listeria monocytogenes).

[0045] Figure 4 HRM qPCR was used to detect Listeria monocytogenes CC8 strain at different concentrations (99.1 ng, 9.91 ng, 0.991 ng, 99.1 pg, 9.91 pg, 0.991 pg, 99.1 fg, 9.91 fg, 0.991 fg, 99.1 ag); Figure A shows the HRM qPCR amplification curve; Figure B shows the normalized melting peak of HRM qPCR.

[0046] Figure 5 Figure A shows the results of PCR and HRM qPCR detection of Listeria monocytogenes CC8 strain contamination in food samples. Figure A shows the PCR detection results, M is the DL2000 DNA standard marker, - is the negative control, and + is the positive control. Lanes 1-12, 13-24, and 25-36 correspond to the detection results of 12 samples after 9 hours, 12 hours, and 24 hours of enrichment, respectively. Figure B shows the HRM qPCR amplification curve. Figure C shows the normalized melting peak of HRM qPCR. Detailed Implementation

[0047] To more concisely and clearly demonstrate the technical solution, purpose, and advantages of the present invention, the technical solution of the present invention is described in detail below with reference to specific embodiments. Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products and can be purchased through commercial channels.

[0048] Example 1: Specific detection of multiplex PCR system

[0049] This embodiment provides a PCR kit for simultaneously detecting Listeria monocytogenes and Listeria monocytogenes CC8 strain. The kit includes conventional PCR components and specific primers for Listeria monocytogenes and Listeria monocytogenes CC8 strain. The specific primer sequences are shown in SEQ ID NO:1-2 and SEQ ID NO:5-6. The conventional PCR components include Taq DNA polymerase, MgCl2, PCR amplification buffer, dNTPs, and deionized water.

[0050] Table 1. Specific primers for Listeria monocytogenes and Listeria monocytogenes CC8 strain.

[0051]

[0052] The sequence of the gene dpnA is shown in SEQ ID NO:9, specifically:

[0053] TTGGCAAAGATTGAACCAAAGATTTTTGATGAGTTAAAAATAGCATTATCTTCTTTTGACCAAAAATATTTTGTTGGCGAAGAATTAAATCGCTCAAAACTCACGGAGGATTTACGGAATTATGATGAAACACTACTTAGCAAATTATTTGAAGTGGAATTTATAAAGCAAAATTTTCTCAAGGAAGTTGCAGGACAGAAGTTATTTCAAATTGAACAGCTTGAGGAAACGATTATGTACAATGATTACTGG GATACAAGTTACACAAAGTATGAAAATCGTGTTGGATTAGCTTCAAAGGGGAAGTTCTTACAGGATGATCAAGACGTGGTGTTAGATTTTCCGTTCAAAGATGGTGTGCTCACAGCTTCCATGACAAAGGAAGATAACGAAGAAGGTTATGATGATGCCTTCTTAAACGAGGTGATTGAAAAGGATGAGATTGACCGTCTTTTTGATAAGAAAATATTTACGAATGTCAAACGCTTCGGATATAATTCGTCAA ACGGTGTTGCTAATGGGGA TGTTTCCTTTGATAAGGAAAAAGATAATCTGATTATCAAAGGGAATAATTTGTTGGCTCTACATACATTGAAAGATATGTATTCAGGAATGATTAAATTGATCTATATTGACCCACCATATAATACAGGGAAAGATTCATTTAGGTACAATGACAAGTTTAATCATTCAACGTGGATGACATTTATGAAGAACCGTCTTGAAATTGCTAAAGAGCTATTATCTGAAGATGGCTGTATTT GGTTGAACATAGACGATGATGAGGGA CACTATCTTAAAGTTCTTGCAGATGGTGTGTTTGGTAGAGAAAATTTTATCAATAATGTTATTTGGGAAAAAAAGTACACTATTTCAAATGACGCCAAATACTTATCTGATAACCACGACCATCTGCTATTTTATGCGAAAGATAAAAATAATTGGAAACCT AATCCTTTACCTCGCACTGCCG AAATGAATAAAGCGTATAAGAATCCAGATAATCATCCGAAAGGTGTTTGGAAGGCAACTCCTCTTCATGCCAAGAGTGGATCGATTAAAGGAGAAAGATTCATCCATACTTTTAGTAACGGGGTTACGTGGAGTCCTCCAATCGGAACATTTCCTAGGTTTTCAAAAGAGACATTGGAAAG GCTTGATATGGAAGATGCAATCTATTTTGGCAAGGACGGAAATGCAATTCCATCTCGAAAAACTTTTTTAAGTGAGCTAAACAAAGGAATTCCAGCAAGGACCGTTTGGAGATCTGATGAAGTTGGACACAATCATGAAGCCAGAGAAGAAATTAAGCATTTGAATTTGGAAACTGATT TCACAACTCCAAAACCAGAAAGGCTACTTCAACGAGTCTTGACATTGGGGAGTTTAGAAGGAGATATAATCTTGGATTTCTTTATGGGTTCGGCAACAACACAAGCTGTGGCAATGAAGATGAAGAGACGATTCATAGGCATTGAGCAAATGGACTATATCAATAGTGTATCTATTCCCAGACTAGAAAAAGTTATTGACGGCGACCAAGGTGGTATTTCAAAAGCCGTTAATTGGCAAGGTGGAGGTTCATTCGTTTATACTGAACTATTAGTTAAGAACATGAGTTACCTTAAGGATATTATCCACTCAAAAACTACCGAGGAGCTTAATTCAGTTTATGAAAGTATGCTACAAGGAACTGATACAGATGAACCTGCGGATATTTCCTTTCGTGTTGATTTATCTAAAATTGATTGGGCTCAAGGATTTGATGACAATAAGCGCCTGTTAATTAAGTTACTTGATAAGAATGGACTTTATTATAACTACTCAGAAATTGATGATATGAATGTCCGTGATTTAGTTTCTCATGAAGACTACAGCTTTAATAAAGCTTTCTATGAAGGTGGTGAGTAA。

[0054] The sequence of gene ycnI is shown in SEQ ID NO:10, specifically as follows:

[0055] ATGAAAAAAATTATGAGCTCCATCGTCGTATTATTAGCTGTCTTTATCATTCCATTTCAAGCGAGCGCGCATGTCTCAGTATTACCAAGCGAATCGACCGTAGACTCCTGGGAAACCTACACGATGAAAGTTCCATCAGAAAAAGATGCAGCATCTAAAAAAATCGTTTTAAAAGTGACAAAGGGTGTATCGTTCGAATCGTATGAACCAGTTCCAGGCTGGACAACGACGATAGATAAGAAGAACGGAACAGTAACATGGCAAACAGAAGGCAGCGGAATTGAAAAAGGTCAATTTCAGCGATTTAGTTTTATCGCTAAAAATCCAAGTGAAGAA GGAGAAGTCCCTTGGAATGCCTATCAATATTATGAAGATGGTTCCATCGT CGAATGGGTTGGGGCAGAAGA TTCTGAAACACCACATGCTACAACAAAAATCGTCAAAGAGT CTTCTAAATCAGCAACTGGCTCGC ACGGAGAGGTAGTGGCAGGAGCAGAGAAC ACAGCAGGGGATACAAGCAGCA GTGGTGATAATACGATTTTATTATGGACCGCAGTAGCTATCAGCGTTATTGCGCTTATCACGGGTATTCTTGCTATTTTAAGCCGAAAAAAATAA.

[0056] Specificity detection of the multiplex PCR system: The target DNA sequences of Listeria monocytogenes and Listeria monocytogenes CC8 strain were amplified using a PCR amplification method with multiple primer pairs and genomic DNA template. The templates for genes dpnA and ycnI were derived from the genomic DNA of each bacterium, and the template DNA concentration was 20 ng / μL.

[0057] Multiplex PCR was performed using a 25 μL reaction system, comprising: 0.5 μL of primers (SEQ ID NO: 1–2 and SEQ ID NO: 5–6) at a concentration of 10 μM; 0.5 μL of 2.5 U / μL Taq DNA polymerase; 2 μL of 25 mmol / L MgCl2; 2 μL of 10 mmol / L dNTPs; 5 μL of 5× PCR amplification buffer; 1 μL of DNA template; and sterile deionized water to a total volume of 25 μL. The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 50 s, 72℃ extension for 60 s, for 35 cycles; and a final extension at 72℃ for 10 min.

[0058] PCR results as follows Figure 1 As shown, M is the DL2000 DNA standard marker, - is the negative control, and lanes 1-85 are the agarose gel electrophoresis results of the PCR products, where lanes 1-14 represent Listeria monocytogenes CC8 strains, and lanes 15-85 represent other CC-type Listeria monocytogenes. It is evident that using the multiplex PCR system of this invention to detect target DNA can amplify a single product of the same size from the corresponding genomic DNA template, with clear bands, demonstrating the high specificity of the multiplex PCR primers of this invention.

[0059] Example 2: Sensitivity detection of multiplex PCR system

[0060] Genomic DNA templates containing target genes were subjected to template gradient PCR detection using a 10-fold dilution method. The target genes for dpnA and ycnI were LM5578_1180 and LM5578_2262, respectively. The genomic templates were serially diluted 10-fold with ddH2O to obtain genomic DNA templates of CC8 strain at different concentrations: 99.1 ng / μL, 9.91 ng / μL, 0.991 ng / μL, 99.1 pg / μL, 9.91 pg / μL, 0.991 pg / μL, 99.1 fg / μL, 9.91 fg / μL, and 0.991 fg / μL. Multiplex PCR was performed using a 25 μL reaction system, comprising: 0.5 μL of primers (SEQ ID NO: 1–2, SEQ ID NO: 5–6) at a concentration of 10 μM; 0.5 μL of 2.5 U / μL Taq DNA polymerase; 2 μL of 25 mmol / L MgCl2; 2 μL of 10 mmol / L dNTPs; 5 μL of 5× PCR amplification buffer; 1 μL of DNA template; and 12.5 μL of sterile deionized water. PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 50 s, 72℃ extension for 60 s, for 35 cycles; and a final extension at 72℃ for 10 min.

[0061] result Figure 2 As shown, M represents the DL2000 DNA standard marker, - represents the negative control, and the DNA template concentrations corresponding to lanes 1-9 are 99.1 ng, 9.91 ng, 0.991 ng, 99.1 pg, 9.91 pg, 0.991 pg, 99.1 fg, 9.91 fg, and 0.991 fg, respectively. The results indicate that using the multiplex PCR system of this invention to detect target DNA, the detection sensitivity for CC8 strain can reach up to 99.1 fg / 25 μL, demonstrating high sensitivity and applicability for the detection of Listeria monocytogenes and Listeria monocytogenes CC8 strains.

[0062] As can be seen, the target sequences (SEQ ID NO: 9-10) obtained by screening in this invention and the amplification primers (SEQ ID NO: 1-2 and SEQ ID NO: 5-6) designed for the target sequences have high specificity and can detect Listeria monocytogenes CC8 strains from Listeria monocytogenes. They also have high sensitivity, and can still amplify the target band for detection when the DNA template concentration of CC8 strain is as low as 99.1 fg.

[0063] Example 3: Specificity detection of HRM qPCR system

[0064] This embodiment provides an HRM qPCR kit for the simultaneous detection of Listeria monocytogenes and Listeria monocytogenes CC8 strain. The kit includes conventional qPCR components and specific primers for Listeria monocytogenes and Listeria monocytogenes CC8 strain. The specific primer sequences are shown in SEQ ID NO:3-4 and SEQ ID NO:7-8. The conventional qPCR components include TBGreen Premix Ex Taq II (Tli RNaseH Plus) and deionized water.

[0065] The HRM qPCR reaction system consisted of: 0.5 μL of primers (SEQ ID NO:3-4, SEQ ID NO:7-8) at a concentration of 10 μM, 10 μL of TB Green Premix Ex Taq II (Tli RNaseH Plus), 1 μL of DNA template, and 7 μL of sterile deionized water. The HRM qPCR reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s, 60℃ annealing for 30 s, amplification for 40 cycles; 95℃ denaturation for 60 s, 40℃ annealing for 60 s, then the temperature was increased from 65℃ to 97℃, the melting rate was 0.07℃ / s, and the fluorescence signal was monitored at 15 readings / ℃.

[0066] The results are as follows Figure 3 As shown, the dashed line represents the melting peak of Listeria monocytogenes CC8 strain, and the solid line represents the melting peak of other CC-type Listeria monocytogenes strains. It is evident that using the HRM qPCR system of this invention to detect target DNA, the corresponding target gene can be amplified from the corresponding genomic DNA template. Furthermore, the shape of the melting peak (double peaks indicate Listeria monocytogenes CC8 strain) can be used to determine whether the product belongs to Listeria monocytogenes CC8 strain. The results demonstrate that the HRM qPCR primers of this invention have high specificity.

[0067] Example 4: Sensitivity detection of the HRM qPCR system

[0068] Genomic DNA templates containing target genes were subjected to template gradient PCR detection using a 10-fold dilution method. The target genes for dpnA and ycnI were LM5578_1180 and LM5578_2262, respectively. The genomic templates were serially diluted 10-fold with ddH2O to obtain genomic DNA templates of CC8 strain at different concentrations: 99.1 ng / μL, 9.91 ng / μL, 0.991 ng / μL, 99.1 pg / μL, 9.91 pg / μL, 0.991 pg / μL, 99.1 fg / μL, 9.91 fg / μL, 0.991 fg / μL, and 99.1 ag / μL. HRMqPCR was performed using a 20 μL reaction system, comprising: 0.5 μL of primers (SEQ ID NO:3–4, SEQ ID NO:7–8) at a concentration of 10 μM, 10 μL of TB Green Premix Ex Taq II (Tli RNaseH Plus), 1 μL of DNA template, and 7 μL of sterile deionized water. The HRM qPCR reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s, 60℃ annealing for 30 s, for 40 cycles; 95℃ denaturation for 60 s, 40℃ annealing for 60 s, followed by increasing the temperature from 65℃ to 97℃ at a melting rate of 0.07℃ / s, with fluorescence signal monitored at 15 readings / ℃.

[0069] The results are as follows Figure 4 As shown, Figure 4 Different concentrations of HRM qPCR were used to detect Listeria monocytogenes CC8 (99.1 ng, 9.91 ng, 0.991 ng, 99.1 pg, 9.91 pg, 0.991 pg, 99.1 fg, 9.91 fg, 0.991 fg, 99.1 ag). Figure A shows the HRM qPCR amplification curve; Figure B shows the normalized melting peak of HRM qPCR. The results show that using the HRM qPCR system of this invention to detect target DNA, the highest detection sensitivity for CC8 strain can reach 0.991 fg / 20 μL, exhibiting high sensitivity and suitable for the detection of Listeria monocytogenes and Listeria monocytogenes CC8 strains.

[0070] As can be seen, the target sequences (SEQ ID NO: 9-10) obtained by screening in this invention and the amplification primers (SEQ ID NO: 3-4 and SEQ ID NO: 7-8) designed for the target sequences have high specificity and can detect Listeria monocytogenes CC8 strains from Listeria monocytogenes. They also have high sensitivity, and can still amplify the target melting peak for detection when the DNA template concentration of CC8 strain is as low as 0.991 fg.

[0071] Example 5: Detection of Listeria monocytogenes CC8 strain contamination in actual samples using a kit

[0072] The contamination status of Listeria monocytogenes CC8 strain in actual samples was detected using PCR and HRM qPCR kits. In the embodiments of this invention, the actual samples were food samples from supermarkets and markets.

[0073] The collected samples were cultured in Listeria monocytogenes LB1 enrichment broth (purchased from Guangdong Huankai Biotechnology Co., Ltd., catalog number CP0409) at 37°C to enrich Listeria monocytogenes. DNA was extracted from 1 mL of the enrichment solution at 9, 12, and 24 hours, and detected using PCR and HRM qPCR kits, respectively.

[0074] The results are as follows Figure 5 As shown, Figure 5 Figure A shows a schematic diagram illustrating the detection of Listeria monocytogenes CC8 strain contamination in food samples using PCR and HRM qPCR kits. Figure A shows the PCR detection results, with M representing the DL2000 DNA standard marker, - indicating a negative control and + indicating a positive control. Lanes 1-12, 13-24, and 25-36 correspond to the detection results of 12 samples after 9, 12, and 24 hours of enrichment, respectively. Figure B shows the HRM qPCR amplification curve, and Figure C shows the normalized melting peak of the HRM qPCR. The results indicate that the target analyte can be detected within 9 hours using this method. The high efficiency and accuracy of this method provide an effective solution for the detection of practical samples and can be widely applied in the food industry, public health, and other fields.

[0075] As can be seen, the kit of the present invention can efficiently detect the contamination of Listeria monocytogenes CC8 strain from actual sample enrichment broth, and has high sensitivity and specificity.

[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A primer set for simultaneously detecting Listeria monocytogenes and Listeria monocytogenes CC8-type strain, characterized by, The nucleotide sequences of the primer sets are shown as SEQ ID NO: 1-8.

2. The primer set of claim 1, wherein The target gene amplified by the primer with the nucleotide sequence as shown in SEQ ID NO: 1~4 is LM5578_1180 The target gene amplified by the primer with the nucleotide sequence as shown in SEQ ID NO: 5~8 is LM5578_2262 .

3. Use of specific target sequences for the detection of Listeria monocytogenes and Listeria monocytogenes CC8 type strain for the detection of Listeria monocytogenes and Listeria monocytogenes CC8 type strain for non-diagnostic and therapeutic purposes, characterized in that, The nucleotide sequences of the specific target sequences are shown as SEQ ID NO: 9-10.

4. A kit for detecting Listeria monocytogenes and Listeria monocytogenes CC8 type strain, characterized by, The kit comprises the primer sets with the nucleotide sequences shown as SEQ ID NO: 1-2, SEQ ID NO: 5-6.

5. A method for detecting Listeria monocytogenes and Listeria monocytogenes CC8 strain for non-disease diagnosis and treatment purposes, characterized by, The method comprises the following steps: S1, extracting the genomic DNA of the strain to be tested; S2, performing multiplex PCR: using the genomic DNA of the strain to be tested as the template, and using the primer sets with the nucleotide sequences shown as SEQ ID NO: 1-2, SEQ ID NO: 5-6 to amplify the target sequences; S3, determining the amplification product of step S2; If two amplification bands appear at the positions of 855 bp and 187 bp at the same time, the strain is identified as a CC8 type strain; if only one amplification band appears at the position of 187 bp, the strain is identified as L. monocytogenes.

6. A HRM qPCR kit for detecting Listeria monocytogenes and Listeria monocytogenes CC8 type strain, characterized by, The kit comprises the primer sets with the nucleotide sequences shown as SEQ ID NO: 3-4, SEQ ID NO: 7-8.

7. A method for detecting Listeria monocytogenes and Listeria monocytogenes CC8 strain for non-disease diagnosis and treatment purposes, characterized by, The method comprises the following steps: S1, extracting the genomic DNA of the strain to be tested; S2, performing HRM qPCR: using the genomic DNA of the strain to be tested as the template, and using the primer sets with the nucleotide sequences shown as SEQ ID NO: 3-4, SEQ ID NO: 7-8 to amplify the target sequences; S3, determining the amplification product of step S2; If two melting peaks appear at the positions of 78.5℃ and 80.5℃ at the same time, the strain is identified as a CC8 type strain; if only one melting peak appears at the position of 80.5℃, the strain is identified as L. monocytogenes.

8. The primer set of claim 1 or the kit of claim 4 or 6 for detecting L. monocytogenes and L. monocytogenes CC8 type strain for non-disease diagnosis and treatment purposes.

Images