Application of soybean GmPHOTs family genes in regulating isoflavone synthesis in plants

By cloning soybean GmPHOTs family genes and editing genes using the CRISPR-Cas9 system, mutants were created, solving the problem of regulating soybean isoflavone synthesis and achieving effective regulation of isoflavone content, thus obtaining plant lines with high or low isoflavone levels.

CN116535477BActive Publication Date: 2026-04-10NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2023-04-26
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

There are no reports on the regulation of soybean isoflavone synthesis in existing technologies. The influencing factors are complex, making it difficult to effectively regulate isoflavone accumulation.

Method used

By cloning soybean GmPHOTs family genes and editing GmPHOTs genes using the CRISPR-Cas9 system, three-gene knockout mutants and two-gene knockout mutants of soybean were created to reduce the accumulation of GmPHOTs protein and regulate isoflavone synthesis through gene editing.

Benefits of technology

This study achieved the ability to regulate the reduction of isoflavone content in soybeans, obtaining plant strains with high or low isoflavone levels, which has significant application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116535477B_ABST
    Figure CN116535477B_ABST
Patent Text Reader

Abstract

The application discloses application of soybean GmPHOTs family genes in regulation of synthesis of isoflavones in plants. The soybean GmPHOTs family genes include the following five members: a GmPHOT1a gene, a GmPHOT1b gene, a GmPHOT1c gene, a GmPHOT2a gene and a GmPHOT2b gene. The application creates a GmPHOT1s triple-gene knockout mutant and a GmPHOT2s double-gene knockout mutant by using a CRISPR-Cas9 gene editing technology, and obtains a gene-edited soybean plant with reduced isoflavone content, such as genistin and glycitein.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and particularly relates to application of GmPHOTs gene in regulating soybean isoflavone content accumulation. BACKGROUND

[0002] Soybean is one of the important economic crops in China, which is rich in protein, oil and various bioactive substances. Soybean extract and whole soybean are widely used in various consumer products. Soybean protein extract is an important component of infant formula.

[0003] Soybean isoflavone is a kind of flavonoid mainly existing in leguminous plants. Soybean isoflavone was first described as a phytoestrogen, which is very similar in structure to human secreted estrogen and has estrogen activity. After menopausal women intake isoflavone, the clinical symptoms of female menopausal syndrome caused by unbalanced estrogen secretion can be alleviated. However, these bioactive isoflavones may not be better for infants and protein supplement consumers.

[0004] Soybean isoflavone is derived from the branch of phenylpropanoid metabolic pathway of leguminous plants, and its synthesis process is affected by various factors, including environment and activity of various catalytic enzymes in its synthesis pathway. The remaining branches of the phenylpropanoid metabolic pathway can also produce other important plant secondary metabolites, including lignin, anthocyanin, etc. The uncertainty of field environment makes it important to study the process of soybean affecting isoflavone accumulation. Soybean isoflavone is accumulated in different degrees in various tissues of soybean, and the accumulation amount in mature seeds is the most abundant. Therefore, it is crucial to study the process of affecting isoflavone accumulation in the process of soybean seed maturation.

[0005] During plant growth and development, light signal, as an environmental factor, not only promotes plant growth and development as an important energy source, but also transduces signals through a series of light receptors. The phototropin PHOTs protein, as one of the light receptors, mainly senses blue light wavelength: 430-455nm, and regulates phototropism, chloroplast arrangement, stomatal opening and leaf growth direction of plants. These biological processes ultimately lead to more efficient use of light energy by plants, and maximize photosynthetic efficiency. Blue light signal can effectively promote plant growth and organic matter accumulation.

[0006] So far, there is no report on soybean GmPHOTs gene. Therefore, it is of great significance to clone and study the function of GmPHOTs gene. SUMMARY

[0007] In view of the deficiencies of the prior art, the purpose of the present application is to provide application of soybean GmPHOTs gene in regulating plant isoflavone synthesis.

[0008] To achieve the object of the present application, the following technical solutions can be used:

[0009] The present application first provides soybean GmPHOTs family genes, which are derived from soybean.

[0010] The soybean GmPHOTs family genes include GmPHOT1a gene, GmPHOT1b gene, GmPHOT1c gene, GmPHOT2a gene and GmPHOT2b gene.

[0011] More specifically, the CDS sequence of GmPHOT1a gene is shown in SEQ ID NO. 1, the CDS sequence of GmPHOT1b gene is shown in SEQ ID NO. 3, the CDS sequence of GmPHOT1c gene is shown in SEQ ID NO. 5, the CDS sequence of GmPHOT2a gene is shown in SEQ ID NO. 7, and the CDS sequence of GmPHOT2b gene is shown in SEQ ID NO. 9.

[0012] More specifically, the present application investigates GmPHOT1a gene, GmPHOT1b gene and GmPHOT1c gene in combination; investigates GmPHOT2a gene and GmPHOT2b gene in combination.

[0013] The present application uses CRISPR-Cas9 system to edit the GmPHOTs family genes, and creates soybean three-gene knockout mutants gmphot1s-tm and soybean double-gene knockout mutants gmphot2s-dm, respectively, and finds that reducing the accumulation of GmPHOTs protein in soybean can reduce the isoflavone content in soybean seeds.

[0014] The present application also provides the amino acid sequences of the proteins encoded by the soybean GmPHOTs family genes, which are shown in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8 and SEQ ID No. 10, respectively.

[0015] In specific embodiments, the present application also protects proteins having 80% or more identity with the proteins shown in A1) and having the same function obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequences shown above.

[0016] In specific embodiments, the present application also protects fusion proteins having the same function obtained by connecting tags to the N-terminus and / or C-terminus of the above-mentioned proteins.

[0017] The present application also protects expression cassettes, recombinant expression vectors, recombinant microorganisms or transgenic plant cell lines or transgenic plant organs containing the above-mentioned genes.

[0018] The present application also protects a method for regulating the synthesis of isoflavones in plants, which comprises reducing the content and / or activity of the protein described above in a plant of interest.

[0019] In a specific embodiment, the reduction of the content and / or activity of the protein described above in a plant of interest is achieved by editing the coding gene of said protein using the CRISPR-Cas9 system.

[0020] In a more specific embodiment, the nucleotide sequence of the gRNA of the coding gene in the CRISPR-Cas9 system is: GmPHOT1s-gRNA1: GAGTGTACGGACTCGAAGAACGG,

[0021] GmPHOT1s-gRNA1: CTGTGCGTGTTCAATCCACGTGG,

[0022] GmPHOT1s-gRNA2: CCAGTATCTCCTGATCCCAAGGG,

[0023] GmPHOT1s-gRNA3: TCATTTCCGAGAGATCCACGTGG,

[0024] GmPHOT1s-gRNA4: GCCTCTTTGGAAATCGTGGACGG,

[0025] GmPHOT2s-gRNA: TTAGGGGGAGAGAATACAAGTGG.

[0026] The present application finds that reducing the accumulation of GmPHOTs protein in soybean can reduce the content of isoflavones in soybean seeds.

[0027] The present application also protects the protein described above, and / or the gene described above, and / or the expression cassette, recombinant expression vector, recombinant microorganism or transgenic plant cell line or transgenic plant organ described above in any of the following applications:

[0028] (1) in the regulation of the synthesis of isoflavones in plants;

[0029] (2) in the preparation of products for regulating the synthesis of isoflavones in plants;

[0030] (3) in the breeding of high / low isoflavone plants;

[0031] (4) in the preparation of products for breeding high / low isoflavone plants;

[0032] (5) in plant breeding.

[0033] In specific embodiments, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0034] Preferably, the dicotyledonous plant is a legume.

[0035] In specific embodiments, the isoflavones are selected from one or more of genistin, daidzein, malonylgenistin, malonyldaidzein and malonyldaidzin, preferably genistin, daidzein.

[0036] Beneficial effects

[0037] The present application provides, for the first time, the use of the protein encoded by the GmPHOTs gene in regulating the accumulation of soybean isoflavones. Therefore, through the present application, plant lines with high soybean isoflavones and low soybean isoflavones can be obtained, which have important application value. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 Schematic diagram of the soybean gmphot1s-tm mutant gene editing form and the soybean gmphot2s-dm mutant gene editing form of the present application.

[0039] Figure 2 Schematic diagram of the soybean gmphot1s-tm mutant and the soybean gmphot2s-dm mutant seed of the present application.

[0040] Figure 3 Determination results of total isoflavone content after mutation of soybean GmPHOT1s and GmPHOT2s of the present application.

[0041] Figure 4 Determination results of genistin content after mutation of soybean GmPHOT1s and GmPHOT2s of the present application.

[0042] Figure 5 Determination results of daidzein content after mutation of soybean GmPHOT1s and GmPHOT2s of the present application. DETAILED DESCRIPTION

[0043] In order to make the content of the present application more convenient to understand, the technical solutions of the present application will be further described below in combination with specific embodiments, but the present application is not limited thereto.

[0044] The test materials used in the following examples are all purchased from conventional biochemical reagent stores, unless otherwise specified. The determination of vector sequencing in the following examples is determined by conventional sequencing companies.

[0045] Soybean (Glycine max) variety Wm 82 was provided by the National Center for Soybean Improvement.

[0046] The gene editing vectors used in the present application are pCas9 and JRH0645, which were provided by the National Center for Soybean Improvement.

[0047] Example 1 Construction of soybean GmPHOT1s gene editing vector.

[0048] The present application provides primers for constructing expression vectors, which include primers for amplifying guide RNA sequences:

[0049] GmPHOT1s-gRNA1-F: GGATTGTGTGCGTGTTCAATCCACG;

[0050] GmPHOT1s-gRNA1-R: AAACCGTGGATTGAACACGCACACA;

[0051] GmPHOT1s-gRNA2-F: GGATTGCAGTATCTCCTGATCCCAA;

[0052] GmPHOT1s-gRNA2-R: AAACTTGGGATCAGGAGATACTGCA;

[0053] GmPHOT1s-gRNA3-F: GGATTGCATTTCCGAGAGATCCACG;

[0054] GmPHOT1s-gRNA3-R: AAACCGTGGATCTCTCGGAAATGCA;

[0055] GmPHOT1s-gRNA4-F: GGATTGCCTCTTTGGAAATCGTGGA;

[0056] GmPHOT1s-gRNA4-R: AAACTCCACGATTTCCAAAGAGGCA;

[0057] Construction of intermediate vectors PUC1-GmPHOT1s-gRNA1, PUC3-GmPHOT1s-gRNA2, PUC5-GmPHOT1s-gRNA3, and PUC6-GmPHOT1s-gRNA4.

[0058] The vectors PUC1, PUC3, PUC5 and PUC6 were digested with the restriction enzyme BsaI.

[0059] Obtaining of the annealing product. The reaction system of the annealing product of the intermediate vector PUC1-GmPHOT1s-gRNA1 was 10 μL, which was composed of 1 μL GmPHOT1s-gRNA1-F, 1 μL GmPHOT1s-gRNA1-R and 8 μL annealing buffer (1.461 g NaCl was dissolved in 1×TE Buffer 500 mL) (the method for obtaining the annealing product of other intermediate vectors was consistent).

[0060] Connection of the intermediate vector. The reaction system of the four intermediate vectors was 20 μL, which was composed of 10 μL of the annealing product, 1 μL of the BsaI-digested PUC vector, 2 μL of 10×T4 buffer, 1 μL of T4 ligase (Takara) and 6 μL of ddH2O. The reaction procedure was 25℃ for 2 h. The connection product was transformed into the competent cells of Escherichia coli DH5α (Tolo Harbor), a plurality of single clones were obtained, and the positive clone was obtained by sending the bacterial liquid for sequencing, and the intermediate vector was extracted for the next reaction.

[0061] Construction of the gene editing vector pCas9-GmPHOT1s. The reaction system was 20 μL, which was composed of 11 μL of PUC1-GmPHOT1s-gRNA1, 1 μL of PUC3-GmPHOT1s-gRNA2, 1 μL of PUC5-GmPHOT1s-gRNA3, 1 μL of PUC1-GmPHOT16-gRNA4, 1 μL of pCas9 plasmid, 0.4 μL of AarI (Thermoscientific), 50×oligo, 2 μL of 10×T4 buffer, 1 μL of T4 ligase and 10.6 μL. The reaction procedure was: 37℃ for 5 min, 25℃ for 10 min, 15 cycles; 50℃ for 15 min; 80℃ for 10 min; 4℃ storage. The connection product was transformed into the competent cells of Escherichia coli DH5α (Tolo Harbor), a plurality of single clones were obtained, and the positive clone was obtained by sending the bacterial liquid for sequencing.

[0062] The positive single clone was inoculated into LB liquid medium, cultured, and the bacterial liquid was obtained; then the plasmid was extracted from the bacterial liquid, that is, the recombinant plasmid pCas9-GmPHOT1s.

[0063] Example 2. Construction of a soybean GmPHOT2s gene editing vector

[0064] The present application provides primers for constructing a gene editing vector, which include primers for amplifying a U6 fragment sequence:

[0065] U6-Xbal-F: GGAAGCTTAGGCCTTCTAGAAAAATAAATGGTAAAATGTC

[0066] U6-R: CAATCCATGTGGTGGCACAT

[0067] GmPHOT2s+sgRNA-F:

[0068] AATGTGCCACCACATGGATTGTAGGGGGAGAGAATACAAGGTTTTAGAGCTAGAAATAGCAA

[0069] (gRNA+sgRNA)-R: GCTCGGCAACGCGTTCTAGAAAAAAAAGCACCGACTCGGT

[0070] A reaction system for amplifying U6 sequence was prepared. The reaction system was 50 μL, which was composed of 1 μL KOD Plus (TOYOBO), 5 μL 10x PCR Buffer, 5 μL dNTP, 25 mM MgSO4, 1.5 μL primer U6-Xbal-F aqueous solution (concentration of 10 μM), 1.5 μL primer U6-R aqueous solution (concentration of 10 μM), 1 μL vector JRH0951 and 34 μL ddH2O. The reaction procedure was as follows: 94 °C for 2 min; 94 °C for 15 s, 57 °C for 30 s, 68 °C for 10 s, 35 cycles; 12 °C for preservation. The PCR amplification product was taken and the target fragment was recovered by agarose gel recovery kit (Zhuangmeng International Biological Gene Technology Co., Ltd.).

[0071] The vector JRH0951 is described in the following document: Sun X, Hu Z, Chen R, Jiang Q, Song G, Zhang H, Xi Y. (2015). Targeted 845 mutagenesis in soybean using the CRISPR-Cas9 system. Sci. Rep. 5(1), 1-10.

[0072] Preparation of reaction system for amplifying GmPHOT2s+sgRNA sequence. The reaction system is 50 μL, which is composed of 1 μL KOD Plus, 5 μL 10×PCR Buffer, 5 μL dNTP, 25 mM MgSO4, 1.5 μL primer GmPHOT2s+sgRNA-F aqueous solution (concentration is 10 μM), 1.5 μL primer (gRNA+sgRNA)-R aqueous solution (concentration is 10 μM), 1 μL vector JRH0951 and 34 μL ddH2O. The reaction program is: 94°C for 2 min; 94°C for 15 s, 57°C for 30 s, 68°C for 10 s, 35 cycles; 12°C storage. The PCR amplification product is recovered by agarose gel recovery kit to recover the target fragment.

[0073] Obtaining of U6+GmPHOT2s+sgRNA fragment. Preparation of reaction system for amplifying sequence. The reaction system is 50 μL, which is composed of 1 μL KOD Plus, 5 μL 10×PCR Buffer, 5 μL dNTP, 25 mM MgSO4, 1.5 μL primer U6-XbaI-F aqueous solution (concentration is 10 μM), 1.5 μL primer (gRNA+sgRNA)-R aqueous solution (concentration is 10 μM), 0.5 μL GmPHOT2s+sgRNA fragment, 0.5 μL U6 fragment and 34 μL ddH2O. The PCR amplification product is recovered by agarose gel recovery kit to recover the target fragment.

[0074] The vector JRH0641 is digested with restriction endonuclease XbaI, and the target fragment is recovered by agarose gel recovery kit.

[0075] Obtaining of ligation product. 1 μL U6+GmPHOT2s+sgRNA fragment (about 100 ng), 05 μL recovered digestion product (50 ng) and 2.5 μL 2×ClonExpress Mix (Vazyme, C115) are mixed to obtain a ligation system. The ligation product is obtained by 50°C reaction for 30 min. The ligation product is transformed into E. coli DH5α competent cells (Toloo Bay), and several single colonies are obtained and sent for bacterial liquid sequencing to obtain a positive clone.

[0076] The positive single colony is inoculated into LB liquid medium, cultured to obtain bacterial liquid, and then the plasmid is extracted from the bacterial liquid, i.e. recombinant plasmid JRH0645-GmPHOT2s.

[0077] Example 3 Obtaining of soybean mutant plant

[0078] 1. After the constructed recombinant plasmid is transformed into Agrobacterium EHA105, soybean stable genetic transformation is carried out.

[0079] 2. The recombinant plasmid is transformed into soybean variety Wm 82, hereinafter referred to as soybean, after screening, differentiation and rooting, the T0 generation of transgenic soybean plants is obtained. The specific steps are as follows:

[0080] (1) Sterilize the soybean with chlorine gas obtained by reacting 15 mL of concentrated hydrochloric acid and 100 mL of sodium hypochlorite for 2.5-3 h. Take out and dry the chlorine gas in the clean bench.

[0081] (2) Seed germination: evenly sow soybeans in germination medium, about 20-30 seeds per dish.

[0082] (3) Agrobacterium infection: cut the soybean in half, remove part of the embryo tip, and make a cut in the meristem area, which is the infection object: soybean explants, place in recombinant Agrobacterium liquid with OD600 nm of about 0.6, shake at room temperature for 30 min; take out the explants and blow for 10 min under sterile conditions, then spread on co-culture medium and dark culture for 5 days.

[0083] (4) Wash the explants with sterile water and liquid induction medium with added hormones for 4-5 times to ensure that the Agrobacterium is washed off. Cut off the elongated embryo and only keep 3-4 mm, insert the embryo downward into the solid bud induction medium, and culture in a 25°C culture room with 16h light / 8h dark for 2 weeks.

[0084] (5) After 15 days, some explants start to sprout, and the sprouts are cut from the peg and transferred to new solid bud induction medium. The ones without sprouts are discarded and continue to be cultured in the greenhouse.

[0085] (6) After 15 days, the sprouted explants are subcultured to new solid bud induction medium, and the ones without sprouts are discarded. Culture in the greenhouse for 15 days. The explants are cultured in solid bud induction medium for a total of 30 days.

[0086] (7) Separate the callus from the soybean and discard the explants. Scrape off the black surface of the callus and transfer it to solid bud elongation medium. Replace the new solid elongation medium every 15 days. Generally subculture 4-5 times, for a total of 60-80 days. The callus is also screened during elongation, and some seedlings will grow during the screening process.

[0087] (8) When the seedlings grow to about 4-5 cm, cut them from the callus and transfer them to rooting medium.

[0088] (9) Culture in the rooting medium for about 20-30 days. The seedlings that grow strong and have developed root systems can be transplanted into a pure vermiculite environment in a disposable cup and placed in weak light for hardening. Cover the seedlings with another disposable plastic cup to achieve the purpose of moisture retention. Generally, harden for 5 days.

[0089] (10) After several days of acclimation, the disposable cup used for moisture retention is removed when the roots are observed to be growing visibly. It is moved to a large pot containing nutrient soil and continues to be cultivated.

[0090] Example 4. Obtaining of transgenic soybean positive plants and molecular identification of mutation type

[0091] For the CRISPR knock-out vector, we detected its basta resistance gene. And according to the location of its gRNA, PCR amplification was carried out for sequencing.

[0092] After Sanger sequencing, gmphotls and gmphot2s plants were obtained. Their editing forms are shown as Figure 1

[0093] Example 5. Determination of isoflavone content of mutant soybean and transgenic soybean

[0094] The experiment was repeated three times to take the average value, and the steps of each repetition were as follows:

[0095] After the soybeans to be tested (Wm 82, gmphotls-tm and gmphot2s-dm) in the greenhouse matured, the seeds were harvested and placed in a 37°C oven to dry to constant weight. 50 seeds were randomly selected, with 5 seeds as a repeat, and the isoflavone content was determined.

[0096] The steps for extracting isoflavones are as follows: (1) 0.02 g of soybean powder was weighed into a 2 mL centrifuge tube. (2) 1.0 mL of 80% chromatographic grade methanol solution (1:50 of solid to liquid) was added, vortexed for 30 s, placed on a floating plate, and ultrasonically extracted (frequency 40 kHz, power 300 W) at 50°C for 1 h, during which the tube was inverted every ten minutes to mix. (3) Centrifuged at 12000 rpm for 10 min at 4°C. (4) The supernatant was passed through a 0.22 μm organic phase needle filter and injected into an Agilent automatic sample injection special vial (2 mL), which was stored at -20°C for machine detection.

[0097] The isoflavone content was determined by ultra-high performance liquid chromatography (UPLC): DIONEX Ultimate 3000, column temperature 40°C, DAD detector, detection wavelength 254 nm, chromatographic column: ACQUITY UPLC HSS T3 1.8 μm, 2.1 mm*100 mm column). Injection volume: 2 μL, mobile phase: A: 0.5% acetic acid (analytical pure), B: 100% acetonitrile (Merck). Mobile phase flow rate: 0.4 mL / min, gradient elution: 0-16 min 15%-26% B (v / v), 16-16.1 min 26%-15% B, 16.1-18 min 15% B.

[0098] ​The total isoflavone content in soybean Wm 82 seeds, gmphotls-tm mutant seeds and gmphot2s-dm mutant seeds is shown in Table 1. Figure 2 The total isoflavone content in gmphotls-tm mutant seeds is 0.66 times the total isoflavone content in Wm 82 seeds. The total isoflavone content in gmphot2s-dm mutant seeds is 0.69 times the total isoflavone content in Wm 82 seeds.

[0099] The genistin content in soybean Wm 82 seeds, gmphotls-tm mutant seeds and gmphot2s-dm mutant seeds is shown in Table 2. Figure 3 The genistin content in gmphotls-tm mutant seeds is 0.58 times the genistin content in Wm 82 seeds. The genistin content in gmphot2s-dm mutant seeds is 0.61 times the genistin content in Wm 82 seeds.

[0100] The daidzin content in soybean Wm 82 seeds, gmphotls-tm mutant seeds and gmphot2s-dm mutant seeds is shown in Table 3. Figure 4 The daidzin content in gmphotls-tm mutant seeds is 0.64 times the daidzin content in Wm 82 seeds. The daidzin content in gmphot2s-dm mutant seeds is 0.70 times the daidzin content in Wm 82 seeds.

[0101] The scope of protection of the present application is not limited to the above-mentioned embodiments. Changes and modifications that can be conceived by those skilled in the art without departing from the spirit and scope of the present application are included in the present application and are protected by the scope of the appended claims.

Claims

1. A method of reducing the isoflavone content of soybean seed, characterized by, The method comprises simultaneously knocking out soybean GmPHOT1a gene, GmPHOT1b gene and GmPHOT1c gene, wherein: the CDS sequence of the GmPHOT1a gene is shown as SEQ ID NO. 1; the CDS sequence of the GmPHOT1b gene is shown as SEQ ID NO. 3; and the CDS sequence of the GmPHOT1c gene is shown as SEQ ID NO.

5. The amino acid sequences are shown as SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6 respectively. The isoflavones are selected from one or more of genistin and daidzein.

2. The method of claim 1, wherein, The simultaneous knocking out of the soybean GmPHOT1a gene, GmPHOT1b gene and GmPHOT1c gene is achieved by using a CRISPR-Cas9 system to edit the coding gene of the protein.

3. The method of claim 2, wherein, The nucleotide sequence of the gRNA of the coding gene in the CRISPR-Cas9 system is: GmPHOT1s-gRNA1: CTGTGCGTGTTCAATCCACGTGG, GmPHOT1s-gRNA2: CCAGTATCTCCTGATCCCAAGGG, GmPHOT1s-gRNA3: TCATTTCCGAGAGATCCACGTGG, GmPHOT1s-gRNA4: GCCTCTTTGGAAATCGTGGACGG.

4. The biological material for simultaneously knocking out the soybean GmPHOT1a gene, GmPHOT1b gene and GmPHOT1c gene according to claim 1 is applied in any of the following uses: (1) in reducing soybean isoflavone synthesis; (2) in preparing a product for reducing soybean isoflavone synthesis; (3) in cultivating low-isoflavone soybeans; (4) in preparing a product for cultivating low-isoflavone soybeans; The isoflavones are selected from one or more of genistin and daidzein.