A method for purifying favipiravir and / or derivatives thereof
By using silica gel filtration and a specific organic solvent system to process favipiravir, the problem of substandard purification of favipiravir in existing technologies has been solved, resulting in a high-purity white powder that meets pharmaceutical standards and is suitable for industrial production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING SIHUAN PHARMA
- Filing Date
- 2020-02-28
- Publication Date
- 2026-05-29
AI Technical Summary
Existing favipiravir purification methods suffer from several problems: column chromatography is unsuitable for industrial production; conventional recrystallization is insufficient to meet drug quality standards; solvent residues increase the difficulty of drug quality control; and color does not meet standards during scale-up production.
Favipiravir is produced by combining silica gel filtration with organic solvent treatment, including silica gel filtration and recrystallization steps. A specific ratio of organic solvent system is used for dissolution, cooling crystallization and drying, and operating parameters are optimized to obtain a white or off-white powder product.
The product, favipiravir, meets pharmaceutical quality standards with a purity of 99.9%, significantly reduced impurities, simple operation, low cost, and suitability for industrial production.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
[0001] This application is a divisional application of Chinese Patent Application No. 202010131134.2, filed on February 28, 2020, entitled “A method for purifying favipiravir and / or its derivatives”. Technical Field
[0002] This invention belongs to the field of drug synthesis, specifically relating to a method for purifying favipiravir and / or its derivatives. Background Technology
[0003] Favipiravir is a broad-spectrum antiviral drug that is an RNA-dependent RNA polymerase (RdRp) inhibitor. This drug has important practical significance for humans in responding to possible highly virulent viral infectious diseases and possible bioterrorism attacks.
[0004]
[0005] Japan has proposed that favipiravir be a white to pale yellow powder in its national drug quality standards. However, the preparation of favipiravir requires multiple continuous reactions (or scale-up production), which can easily result in a solid with a darker color (such as yellow, gray, brown, or black), thus failing to meet the requirements of the drug quality standards.
[0006] CN102307865B only discloses the preparation of a solid product, but does not disclose the color of the solid. CN104496917A discloses the preparation of a yellow solid, which does not meet the drug quality standards. CN1418220A discloses a method for purifying and refining a crude product using silica gel column chromatography to obtain a light yellow solid, but this method has defects such as high cost, unsuitability for industrial production, non-powder product properties, and non-compliance with drug quality standards. CN106478528A discloses a method for obtaining a pale yellow solid through chromatographic column purification and separation, which has defects such as high cost and unsuitability for industrial production. CN101809003A discloses a method for preparing a pale yellow-white solid, which has the following defects: first, the pale yellow-white solid is a product prepared by a specific intermediate of 6-fluoro-3-hydroxy-2-cyanopyrazine dipropylamine salt, which is not a routine purification operation; second, organic amines are difficult to remove, resulting in solvent residue, increasing the difficulty of drug quality control; and third, the product properties are not powder, which does not meet the proposed quality standards of the original drug. CN107226794A and CN106866553A disclose methods for obtaining off-white solids by recrystallization of ethanol. However, when the crude product is dark in color, it is difficult to obtain white to pale yellow solids by recrystallization of alcohols, including ethanol, thus limiting the scope of application.
[0007] In summary, existing purification methods for favipiravir have the following drawbacks: First, column chromatography purification is unsuitable for industrial production; second, conventional recrystallization purification fails to yield products that meet quality standards for color and properties, even with activated carbon decolorization during recrystallization; and third, even if the product is nearly pale yellow in laboratory trials, it is highly likely to fail to meet color standards in large-scale production, resulting in unpredictable losses. Therefore, a simple, easy-to-implement, and industrially suitable decolorization and purification method is urgently needed to obtain products that meet pharmaceutical quality standards. Summary of the Invention
[0008] The purpose of this invention is to provide a method for purifying favipiravir and / or its derivatives, comprising the following steps: dissolving the favipiravir and / or its derivatives to be purified in organic solvent A, filtering with silica gel, drying, and purifying to obtain the final product.
[0009] In a preferred embodiment of the present invention, the weight ratio of favipiravir to silica gel to be refined in the method is 1:1-1:6, preferably 1:2-1:5, and more preferably 1:3-1:4.
[0010] In a preferred embodiment of the present invention, the particle size of the silica gel is selected from any one or a combination of 100-200 mesh, 200-300 mesh, and 300-400 mesh.
[0011] In a preferred embodiment of the present invention, the organic solvent A is selected from any one or a combination of ethyl acetate, dichloromethane, tetrahydrofuran, isopropanol, ethanol, methanol, acetone, and petroleum ether.
[0012] In a preferred embodiment of the present invention, when the organic solvent A is a combination of dichloromethane and ethyl acetate, the weight ratio of dichloromethane to ethyl acetate is 2:1-10:1, preferably 3:1-9:1, more preferably 4:1-8:1, and most preferably 5:1-7:1.
[0013] In the preferred embodiment of the present invention, the dissolution temperature is 20℃-40℃, preferably 25℃-35℃.
[0014] In a preferred embodiment of the present invention, the purification is selected from recrystallization, pulping, or a combination thereof.
[0015] In a preferred embodiment of the present invention, the recrystallization includes the following steps: dissolving the favipiravir to be purified in organic solvent B, cooling to crystallize, separating the solid, and drying to obtain the product.
[0016] In a preferred embodiment of the present invention, the organic solvent B is selected from any one or a combination of ethyl acetate, dichloromethane, tetrahydrofuran, isopropanol, ethanol, methanol, acetone, and petroleum ether.
[0017] In a preferred embodiment of the present invention, the dissolution temperature in the recrystallization step is 10°C below the boiling point of the recrystallization solvent system to the boiling point.
[0018] In a preferred embodiment of the present invention, the cooling temperature of the recrystallization step is -10°C to 30°C, preferably -5°C to 25°C.
[0019] In a preferred embodiment of the present invention, the cooling in the recrystallization step is selected from any one or a combination of natural cooling and forced cooling.
[0020] In a preferred embodiment of the present invention, the crystallization in the recrystallization step is selected from either static crystallization or stirred crystallization.
[0021] In a preferred embodiment of the present invention, the separation in the recrystallization step is selected from any one of filtration, centrifugation, or a combination thereof.
[0022] In a preferred embodiment of the present invention, the drying in the recrystallization step is selected from vacuum drying or reduced pressure drying.
[0023] In a preferred embodiment of the present invention, the drying temperature in the recrystallization step is 40℃-70℃, preferably 50℃-60℃.
[0024] In a preferred embodiment of the present invention, activated carbon is added during the recrystallization step.
[0025] In a preferred embodiment of the present invention, the pulping process includes the following steps: dispersing the favipiravir to be refined in organic solvent C, stirring, separating the solids, and drying to obtain the final product.
[0026] In a preferred embodiment of the present invention, the organic solvent C is selected from dichloromethane or any one or a combination of dichloromethane and ethyl acetate, tetrahydrofuran, isopropanol, ethanol, methanol, acetone, and petroleum ether.
[0027] In a preferred embodiment of the present invention, the dispersion temperature in the pulping step is from room temperature to the boiling point of the system.
[0028] In a preferred embodiment of the present invention, the separation in the pulping step is selected from any one or a combination of filtration, centrifugation, or other methods.
[0029] In a preferred embodiment of the present invention, the drying process in the pulping step is selected from either vacuum drying or reduced pressure drying.
[0030] In a preferred embodiment of the present invention, the drying temperature in the pulping step is 40℃-70℃, preferably 50℃-60℃.
[0031] Another object of the present invention is to provide a favipiravir composition, said pharmaceutical composition comprising favipiravir and impurity A in an amount not exceeding 0.1% and impurity B in an amount not exceeding 0.1%.
[0032]
[0033] In a preferred embodiment of the present invention, the content of impurity A is not higher than 0.08%, preferably not higher than 0.06%.
[0034] In a preferred embodiment of the present invention, the content of impurity B is not higher than 0.05%, and preferably not detected.
[0035] In a preferred embodiment of the present invention, the purity of favipiravir is not less than 99.9%.
[0036] Another object of the present invention is to provide the use of favipiravir and / or its derivatives in compositions for the preparation of viral RNA polymerase inhibitors.
[0037] Another object of the present invention is to provide the use of favipiravir and / or its derivatives in compositions for preparing viral lethality mutation inducers.
[0038] Another object of the present invention is to provide the use of favipiravir and / or its derivatives in the preparation of medicaments for the prevention and / or treatment of novel coronavirus (2019-nCoV) infection.
[0039] In a preferred embodiment of the present invention, the treatment for 2019-nCoV infection is selected from any one or a combination of reducing the ability of 2019-nCoV replication, reducing the 2019-nCoV load, and increasing the viral clearance rate.
[0040] In a preferred embodiment of the present invention, the method for preventing 2019-nCoV infection is selected from any one or a combination of reduced susceptibility to 2019-nCoV and reduced ability to persist infection.
[0041] In a preferred embodiment of the present invention, the prevention and / or treatment of 2019-nCoV infection is selected from improving any one or a combination of symptoms caused by 2019-nCoV infection, such as fever, fatigue, dry cough, nasal congestion, runny nose, uncomplicated infection, mild pneumonia, severe pneumonia, acute respiratory distress syndrome, sepsis, septic shock, metabolic acidosis, and coagulation dysfunction.
[0042] Another object of the present invention is to provide the use of favipiravir and / or its derivatives in the preparation of medicaments for the prevention and / or treatment of influenza virus infection.
[0043] In a preferred embodiment of the present invention, the influenza virus used for treatment is selected from any one or a combination of novel influenza viruses and recurrent influenza viruses.
[0044] In a preferred embodiment of the present invention, the treatment of influenza virus infection is selected from any one or a combination of reducing the ability of influenza virus replication, reducing the influenza virus load, and increasing the virus clearance rate.
[0045] In a preferred embodiment of the present invention, the prevention of influenza virus infection is selected from any one or a combination of reduced susceptibility to influenza virus and reduced ability to cause persistent infection.
[0046] In a preferred embodiment of the present invention, the influenza virus is selected from any one or a combination of influenza A virus, influenza B virus, influenza C virus, highly pathogenic avian influenza virus, and virus strains resistant to existing anti-influenza drugs.
[0047] In a preferred embodiment of the present invention, the type A influenza virus is selected from any one or a combination of avian influenza, H1N1 influenza A infection, or other similar infections.
[0048] In a preferred embodiment of the present invention, the virus resistant to existing anti-influenza drugs is selected from those resistant to any one or a combination of amantadine hydrochloride, oseltamivir phosphate, and zanamivir.
[0049] In a preferred embodiment of the present invention, the drug can be used for antiviral treatment of immunodeficient patients.
[0050] In a preferred embodiment of the present invention, the influenza virus infection is selected from acute respiratory infections caused by influenza viruses.
[0051] Another object of the present invention is to provide the use of favipiravir and / or its derivatives in the preparation of medicaments for the prevention and / or treatment of Ebola virus infection.
[0052] In a preferred embodiment of the present invention, the favipiravir derivative is selected from any one of pharmaceutically acceptable salts, esters, isomers, solvates, and intermediates of favipiravir.
[0053] Unless otherwise stated, when this invention relates to percentages between liquids, the percentage is volume / volume percentage; when this invention relates to percentages between liquids and solids, the percentage is volume / weight percentage; when this invention relates to percentages between solids and liquids, the percentage is weight / volume percentage; the remainder is weight / weight percentage.
[0054] Compared with the prior art, the present invention has the following beneficial technical effects:
[0055] 1. The purification method of the present invention solves the problem of the difficulty in decolorizing favipiravir, and the resulting product is a white or off-white powder that meets the relevant requirements of pharmaceutical quality standards.
[0056] 2. The favipiravir obtained by the purification method of the present invention has a purity of over 99.9%, and after purification, only two impurities remain in the crude product, namely impurity A and impurity B, which contained 15 impurities. Furthermore, impurity B was not detected in multiple batches, while the content of impurity A was only about 0.05%.
[0057] 3. The purification method of the present invention is applicable to the purification and decolorization of other products and intermediates. It has a high degree of decolorization, good purification effect, simple operation, green and environmentally friendly, low cost, and is suitable for industrial production. Attached Figure Description
[0058] Figure 1 HPLC chromatogram of crude favipiravir;
[0059] Figure 2 Comparative Example 4: HPLC chromatogram of the product;
[0060] Figure 3 Example 1: HPLC chromatogram of the product;
[0061] Figure 4 Example 2: HPLC chromatogram of the product;
[0062] Figure 5 Example 3: HPLC chromatogram of the product;
[0063] Figure 6 Example 4: HPLC chromatogram of the product;
[0064] Figure 7 MTS assay results of favipiravir's cytotoxicity against Vero cells;
[0065] Figure 8 Quantitative RT-PCR results of favipiravir inhibiting viral infection on Vero cells. Detailed Implementation
[0066] The following specific embodiments illustrate the present invention. It should be noted that these specific embodiments are only for further explanation and do not represent a limitation on the scope of protection of the present invention. Non-essential modifications and adjustments made by others based on the present invention still fall within the scope of protection of the present invention.
[0067] Comparative Example 1
[0068] Add 5g of crude favipiravir (light brown solid) and 100ml of isopropanol to a reaction flask, heat until dissolved and clear, add activated carbon, keep warm for 30min, hot filter, cool the filtrate to 0-10℃, stir to precipitate crystals, filter, dry, and the obtained product is a pale yellow powder. The yield is 68.8%.
[0069] Comparative Example 2
[0070] Add 5g of crude favipiravir (light brown solid) and 50ml of ethyl acetate to a reaction flask, heat until dissolved and clear, add activated carbon, maintain the temperature for 30min, hot filter, cool the filtrate to 0-10℃, stir to precipitate crystals, filter, and dry. The obtained product is a pale yellow powder. The yield is 62.6%.
[0071] Comparative Example 3
[0072] Add 5g of crude favipiravir (light brown solid) and 330ml of ethyl acetate / dichloromethane = 1:5 (w / w) to a reaction flask, heat until dissolved and clear, add activated carbon, keep warm for 30min, hot filter, cool the filtrate by 0-10℃ and stir to precipitate crystals, filter, dry, and the obtained product is a light yellow powder with a yield of 66.5%.
[0073] Comparative Example 4
[0074] 5.00 g of crude favipiravir (light brown solid, purity: 99.427%, 15 impurities, impurity A: 0.048%, impurity B: 0.105%) was added to a 1 L reactor. 180 ml of a 2:1 (w / w) dichloromethane / ethyl acetate mixture was added and stirred to dissolve the favipiravir. 10 g of 200-300 mesh silica gel was evenly spread in a Buchner funnel, filtered, and the filter cake was washed with 560 ml of a 2:1 dichloromethane / ethyl acetate mixture. The filtrates were combined and concentrated under reduced pressure at 40-60 °C. After concentration, the favipiravir was dried under vacuum at 60 °C with a vacuum degree ≥0.08 MPa. The dried product yielded 3.38 g of a pale yellow powder, with a yield of 67.6% and a purity of 99.825% (4 impurities, impurity A: 0.042%, impurity B: 0.013%).
[0075] Comparative Example 5: Selection of Refining Solvent
[0076] Serial Number 1:
[0077] Add 5.0 g of crude product and 100 ml of isopropanol to a reaction flask, and heat under reflux until dissolved and clear. Filter, cool the filtrate to 0–25 °C, and maintain this temperature for 1 hour to allow crystals to crystallize. Filter again, and dry the filter cake under vacuum at 60 °C to obtain the product.
[0078] Serial number 2:
[0079] Add 5.0 g of crude product and 55 ml of ethyl acetate to a reaction flask, and heat under reflux until dissolved and clear. Filter, cool the filtrate to 0–25 °C, and maintain this temperature for 1 hour to allow crystals to crystallize. Filter again, and dry the filter cake under vacuum at 60 °C to obtain the product.
[0080] Serial number 3:
[0081] Add 5.0 g of crude product and 35 ml of acetone to a reaction flask, and heat under reflux until dissolved and clear. Filter, cool the filtrate to 0–25 °C, and maintain this temperature for 1 hour to allow crystals to crystallize. Filter again, and dry the filter cake under vacuum at 60 °C to obtain the product.
[0082] Serial number 4:
[0083] 5.0 g of crude product and 125 ml of dichloromethane were added to a reaction flask, heated to reflux, the mixture was stirred and slurried, filtered, the filter cake was washed with dichloromethane, and the filter cake was dried under vacuum at 60 °C to obtain the product.
[0084] The results are shown in Table 1.
[0085] Table 1
[0086] Serial Number Refined Solvents Refining methods Refined yield Appearance Favipiravir -- -- -- brown 1 Isopropanol recrystallization 67.5% light yellow 2 Ethyl acetate recrystallization 66.4% light yellow 3 acetone recrystallization 50.4% light yellow 4 dichloromethane Hot pulping 70.8% yellow
[0087] As shown in Table 1, recrystallization with ethyl acetate, isopropanol, and acetone, followed by pulping with dichloromethane, can significantly improve the product color. However, recrystallization and pulping can only change the brown solid to a light yellow or yellow color, and cannot produce a white or off-white product, making it difficult to meet quality standards during scale-up production.
[0088] Example 1: Purification of Favipiravir
[0089] Take 5.00 g of crude favipiravir (light brown solid, purity: 99.427%, 15 impurities, impurity A: 0.048%, impurity B: 0.105%) and add it to a 1 L single-necked flask. Add 330 ml of a 5:1 (w / w) dichloromethane / ethyl acetate mixed solvent and stir to dissolve. Then, spread 25.00 g of 200-300 mesh silica gel evenly in a Buchner funnel, filter, and rinse with 40 ml of the corresponding mixed solvent. Collect the filtrate, concentrate under reduced pressure and evaporate to dryness, then add... 45 ml of ethyl acetate was heated and stirred until the system was refluxed. 0.50 g of activated carbon was added, and the mixture was stirred and heated for 1 h. The mixture was then hot-filtered, and the filter cake was washed with 5 ml of ethyl acetate. The filtrate was cooled to 0-10 °C and stirred at this temperature for 2 h to allow crystallization. The filter cake was then washed with 5 ml of pre-cooled ethyl acetate and dried under vacuum at 60 °C with a vacuum degree ≥0.08 MPa. After drying, 3.41 g of off-white powder was obtained, with a yield of 68.2% and a purity of 99.945% (two impurities: impurity A: 0.045%, impurity B: not detected).
[0090] Example 2: Purification of Favipiravir
[0091] Take 5.00 g of crude favipiravir (light brown solid, purity: 99.427%, 15 impurities, impurity A: 0.048%, impurity B: 0.105%) and add it to a 1 L single-necked flask. Add 600 ml of a 10:1 (w / w) dichloromethane / ethyl acetate mixed solvent and stir to dissolve. Then, spread 25.00 g of 200-300 mesh silica gel evenly in a Buchner funnel, filter, and rinse with 40 ml of the corresponding mixed solvent. Collect the filtrate, concentrate under reduced pressure and evaporate to dryness, then add... Add 45 ml of ethyl acetate, heat and stir until the system is refluxed, add 0.50 g of activated carbon, stir and heat for 1 h, hot filter, wash the filter cake with 5 ml of ethyl acetate, cool the filtrate to 0-10℃, keep warm and stir to precipitate crystals for 2 h, wash the filter cake with 5 ml of pre-cooled ethyl acetate, dry the filter cake under vacuum at 60℃ with a vacuum degree ≥0.08 MPa, and dry to obtain 3.40 g of off-white powder, yield 68.0%, purity 99.949% (1 impurity, impurity A: 0.051%, impurity B: not detected).
[0092] Example 3: Purification of Favipiravir
[0093] Take 5.00 g of crude favipiravir (light brown solid, purity: 99.427%, 15 impurities, impurity A: 0.048%, impurity B: 0.105%) and add it to a 3 L single-necked flask. Add 2800 ml of dichloromethane solvent and stir to dissolve. Then, spread 25.00 g of 200-300 mesh silica gel evenly in a Buchner funnel, filter, and rinse with 40 ml of the appropriate solvent. Collect the filtrate, concentrate under reduced pressure and evaporate to dryness, then add 45 ml of ethyl acetate. The mixture was heated and stirred until refluxed. 0.50 g of activated carbon was added, and the mixture was stirred and heated for 1 h. The mixture was then hot-filtered, and the filter cake was washed with 5 ml of ethyl acetate. The filtrate was cooled to 0-10 °C, and stirred at this temperature for 2 h to allow crystallization. The filter cake was then washed with 5 ml of pre-cooled ethyl acetate, and dried under vacuum at 60 °C with a vacuum degree ≥0.08 MPa. After drying, 3.46 g of white powder was obtained, with a yield of 69.2% and a purity of 99.936% (two impurities: impurity A: 0.054%, impurity B: not detected).
[0094] Example 4: Refining of Favipiravir
[0095] Take 5.00 g of crude favipiravir (light brown solid, purity: 99.427%, 15 impurities, impurity A: 0.048%, impurity B: 0.105%) and add it to a 1 L single-necked flask. Add 330 ml of a 5:1 (w / w) dichloromethane / ethyl acetate mixture and stir to dissolve. Then, spread 15.00 g of 200-300 mesh silica gel evenly in a Buchner funnel, filter, and rinse with 40 ml of the corresponding solvent. Collect the filtrate, concentrate under reduced pressure and evaporate to dryness, then add... 45 ml of ethyl acetate was heated and stirred until the system was refluxed. 0.50 g of activated carbon was added, and the mixture was stirred and heated for 1 h. The mixture was then hot-filtered, and the filter cake was washed with 5 ml of ethyl acetate. The filtrate was cooled to 0-10 °C and stirred for 2 h to allow crystallization. The filter cake was washed with 5 ml of pre-cooled ethyl acetate and dried under vacuum at 60 °C with a vacuum degree ≥0.08 MPa. 3.66 g of off-white powder was obtained, with a yield of 73.2% and a purity of 99.951% (1 impurity, impurity A: 0.049%, impurity B: not detected).
[0096] Example 5: Study on the inhibitory effect of favipiravir on novel coronavirus (2019-nCoVs)
[0097] 1. Experimental Materials
[0098] Favipiravir (obtained from Example 4); Vero cells were purchased from the American Center for Standard Biological Collections (ATCC) and preserved by the Virology Laboratory of the Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences; the Beijing isolate of the novel coronavirus (2019-nCoVBetaCoV / Beijing / AMMS01 / 2020) was isolated and preserved by the Virology Laboratory of the Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences; the culture medium for Vero cells was DMEM liquid medium containing 10% fetal bovine serum (FBS), 1% penicillin-strep antibody, and 10 mM Hepes; based on the full-length genome sequence of the virus, fluorescent quantitative RT-PCR primers and probes were designed in its conserved regions using Oligo7 and SeqBuilder software, synthesized by Shanghai Bioengineering Co., Ltd., PAGE grade, purity >98%, see Table 2.
[0099] Table 2 Primers and probes for quantitative RT-PCR detection of COVID-19
[0100] Primer name Location Primer sequence 5′-3′ Cov - Real-time - F3 22312-22333 TCCTGGTGATTCTTCTTCAGGT CoV-Real-R3 22436-22455 TCTGAGAGAGGGTCAAGTGC Cov - Real-time - P3 22334-22354 FAM-AGCTGCAGCACCAGCTGTCCA-BHQ1
[0101] 2. Experimental Methods
[0102] (1) Vero cell culture
[0103] At 75cm 2Add 12 mL of DMEM complete medium to the culture flask and incubate at 37°C in a cell culture incubator with 5% CO2 and saturated humidity. Passage the cells every 3 days. Before each passage, remove the old medium, wash the cells once with PBS, and add 2 mL of 0.25% trypsin-EDTA to digest the cells in the incubator for 3 min. Under a light microscope, observe that the cells have become rounded. Discard the trypsin and add another 9 mL of medium to stop the digestion. Use a pipette to separate the cells into single cells. Transfer the cell culture to a new culture flask at a 1:3 ratio, add fresh medium to the new flask to a final volume of 12 mL, mix well, and continue culturing in a cell culture incubator at 37°C, 5% CO2, and saturated humidity.
[0104] (2) Virus amplification culture
[0105] The day before the experiment, Vero cells were seeded into T75 culture flasks at a ratio of 1:3. Cells were used when the confluence reached over 90%. A novel coronavirus solution with an MOI of 0.1 was added to the T75 culture flasks, and the cells were incubated at 37°C with 5% CO2 for 1 hour. Then, 15 mL of 2% FBS DMEM medium was added to the culture flasks, and the cells were incubated at 37°C with 5% CO2 for 3 days. The viral solution was collected into 50 mL centrifuge tubes, centrifuged at 6000 rpm for 10 min at 4°C, and the supernatant was collected, aliquoted, and stored at -80°C.
[0106] (3) Virus TICD 50 Measurement
[0107] One day in advance, seed Vero cells into 96-well plates at a concentration of 10,000 / well. Dilute the virus solution 10-fold serially with DMEM medium containing 2% FBS. -2 ~10 -9 Discard the original cell culture medium in the 96-well plate and add 200 μL of virus solution per well, with 4 replicates. Incubate at 37°C in a 5% CO2 cell culture incubator. Observe cytopathic effect (CPE) daily for 4 days. Calculate the median infectious dose (TCID) of the virus using the Reed-Muench method. 50 ).
[0108]
[0109] (4) Drug cytotoxicity test
[0110] One day prior to the incubation, Vero cells were seeded into 96-well plates at a concentration of 10,000 cells / well. Once the cells had formed a confluent monolayer, the culture medium was discarded, and 100 μL / well of 2% FBS DMEM maintenance medium containing different concentrations of the drug (starting at 400 μM, serially diluted 3-fold to obtain 8 concentrations) was added to each well, with 3 replicates for each concentration. A culture medium control and a normal cell control group were also included. Cells were cultured and their condition was observed daily. 72 hours after drug addition, 20 μL of MTS solution was added, and the cells were incubated at 37°C with 5% CO2 for 1 hour, and the OD490 value was measured. The cytotoxicity of the drug was calculated using the following formula:
[0111]
[0112] Finally, Graphpad Prism 7 software was used to perform S-fit analysis on the data to calculate the drug's CC. 50 .
[0113] (5) Inhibitory effect of favipiravir on novel coronavirus
[0114] One day in advance, seed Vero cells at a concentration of 10,000 / well in 96-well plates. Once the cells have grown into a confluent monolayer, discard the culture medium in the 96-well plates and add DMEM maintenance medium diluted to 100 TCID with 2% FBS. 50 Novel coronavirus culture solution, 100 μL / well, was incubated at 37°C in a 5% CO2 incubator for 2 hours. The virus solution was discarded, and favipiravir solutions of 400, 200, 100, 50, 25, and 12.5 μM were prepared in DMEM maintenance medium with 2% FBS, 200 μL / well. Each drug was applied in triplicate. Virus control and normal cell control groups were also included. Cells were incubated at 37°C in a 5% CO2 incubator, and cytopathic effect (CPE) was observed daily. Two days post-infection, 100 μL of cell culture supernatant was collected from each drug treatment group, and nucleic acid was extracted. Viral RNA copy number was detected using quantitative RT-PCR. The 50% effective concentration (EC50) of the drug was calculated by fitting a dose-response curve. 50 ).
[0115] A. Viral nucleic acid extraction
[0116] Viral nucleic acid was extracted from cell supernatant using the QIAamp Viral RNA Mini Kit from QIAGEN. 1) In a biosafety cabinet, aspirate 560 μL of AVL buffer (nucleic acid extraction lysis buffer) containing vector RNA into a 1.5 mL centrifuge tube; 2) Aspirate 100 μL of cell culture supernatant treated with different concentrations of drugs (discard the pipette tip in a collector containing 75% ethanol disinfectant), add it to the AVL buffer, and vortex for 15 seconds; 3) Incubate at room temperature for 10 minutes, then centrifuge briefly to allow the liquid at the top of the tube to settle; 4) Add 560 μL of anhydrous ethanol to the sample, mix for 15 seconds, and centrifuge briefly; 5) Carefully add 630 μL of the liquid to an unwetted QIAamp column, cap it, centrifuge at 8000 rpm / min for 1 min, discard the collection tube, and place the column on a new 2 mL collection tube; open the cap of the QIAamp column and repeat step 5 until all the sample has been centrifuged; 6) Open the cap and add 500 μL of [unclear text - possibly a specific ingredient or solution] to the column. 7) Add 500 μL LAW1 buffer, cap, centrifuge at 8000 rpm for 1 min, discard the collection tube, and place the column on a new 2 mL collection tube; 8) Open the cap, add 500 μL LAW2 buffer, cap, and centrifuge at 14000 rpm for 3 min; 9) Place the column on a new 2 mL collection tube and incubate for 1 min; 10) Place the column on a new 1.5 mL centrifuge tube, add 60 μL LAVE elution buffer, incubate at room temperature for 1 min, and centrifuge at 8000 rpm for 1 min. The centrifuged solution contains viral RNA and can be detected immediately or stored below -80°C.
[0117] B. Detection of viral nucleic acid load by real-time RT-PCR
[0118] Quantitative RT-PCR detection was performed using the Takara One Step RT-PCR kit (RR064A). The 20 μL reaction volume is shown in Table 3.
[0119] Table 3. Detection system for quantitative real-time RT-PCR
[0120] reagents Volume (μL) 2×One Step RT-PCR buffer III 10 TaKaRa Ex Tap HS (5U / μL) 0.4 Prime Script RT Enzyme Mix II 0.4 PCR Forward Primer (10 μM) 0.4 PCR Reverse Primer (10μM) 0.4 TaqMan Probe 0.4 RNA 2 <![CDATA[RNase Freed H2O]]> 6
[0121] 20 μL of reaction solution was added to a Roche LightCycler 480 Multiwell Plate 96 (04729692001), centrifuged at 3000 rpm for 30 s, and then transferred to a Roche LightCycler 480 II quantitative PCR instrument for amplification. The reaction conditions were: reverse transcription at 42℃ for 5 min, pre-denaturation at 95℃ for 10 s; denaturation at 95℃ for 5 s, annealing at 60℃ for 20 s, for 40 cycles. Fluorescence signals were collected at the end of each cycle. Viral RNA load was calculated using the formula: RNA Copies / mL = CT * (-0.3) + 13.17. The 50% effective concentration (EC50) was calculated using Graphpad Prism 7 software by fitting a dose-response curve. 50 ).
[0122] (6) Selection index SI = CC 50 / EC 50
[0123] 3. Experimental Results
[0124] (1) Virus TCID 50 Titration
[0125] The cytopathic effect (CPE) of the novel coronavirus on Vero cells was observed using an inverted microscope, and the Reed-Muench method was used to calculate the median infectious dose (TCID50). See Table 4. The results in Table 4 show that the TCID50 of the virus on Vero cells... 50 The titer is Log 10 5.4 / mL.
[0126] Table 4. TCID50 titers of novel coronavirus on Vero cells
[0127] Virus dilution CPE- CPE+ Cumulative CPE↑ Cumulative survival ↓ Lesion rate (%) <![CDATA[10 -2 ]]> 0 4 13 0 100 <![CDATA[10 -3 ]]> 0 4 9 0 100 <![CDATA[10 -4 ]]> 0 4 5 0 100 <![CDATA[10 -5 ]]> 3 1 1 3 25 <![CDATA[10 -6 ]]> 4 0 0 7 0 <![CDATA[10 -7 ]]> 4 0 0 11 0 <![CDATA[10 -8 ]]> 4 0 0 15 0 <![CDATA[10 -9 ]]> 4 0 0 19 0
[0128] (2) Drug cytotoxicity assay (MTS method)
[0129] The cytotoxicity of different concentrations of favipiravir to Vero cells was determined using the MTS method, and the half-maximal toxicity concentration (CMC) of the drug was calculated. 50 (Results are attached.) Figure 7 .Depend on Figure 7 The results showed that favipiravir had an effect on the C-cell activity of Vero cells. 50 >400μM.
[0130] (3) Inhibitory effect of favipiravir on novel coronavirus (EC) 50 )
[0131] The efficacy of favipiravir in inhibiting the novel coronavirus at the cellular level was determined using a nucleic acid quantification method, and the EC50 of the drug was calculated. 50 The results are attached. Figure 8 .Depend on Figure 8 The results showed that favipiravir has an inhibitory effect on the 2019-nCoV novel coronavirus at the cellular level, and its EC50... 50 It is 67 μM.
[0132] (4) Results of favipiravir's antiviral activity on Vero cells
[0133] According to CC 50 and EC 50 The selection index (SI) for favipiravir was calculated to be >5.97. The results are shown in Table 5.
[0134] Table 5. Cytotoxicity and viral inhibition results of favipiravir on Vero cells.
[0135] cell lines compound <![CDATA[Cytotoxic CC 50 (μM)]]> <![CDATA[EC 50 (μM)]]> SI Vero Favipiravir >400 67 >5.97
[0136] As shown in Table 5, favipiravir has an inhibitory effect on the 2019-nCoV novel coronavirus in Vero cells, and its EC50 concentration is [data missing]. 50 The value is 67 μM, and its selection index SI > 5.97.
[0137] 4. Experimental Conclusions
[0138] The favipiravir obtained by the method of this invention can effectively inhibit the novel coronavirus (ECV). 50 =67), and has no toxic effect on normal cells.
[0139] The above description of specific embodiments of the present invention does not limit the present invention. Those skilled in the art can make various changes or modifications based on the present invention, and as long as they do not depart from the spirit of the present invention, they should all fall within the scope of protection of the claims of the present invention.
Claims
1. A favipiravir composition, said composition comprising favipiravir and impurity A in an amount of 0.045%-0.06% and undetected impurity B, 、 ; The purity of the favipiravir is not less than 99.9%. The preparation steps of the composition include the following steps: dissolving the favipiravir to be purified in organic solvent A, filtering with silica gel, drying, and recrystallizing to obtain the final product. The weight ratio of favipiravir to silica gel to be purified is 1:1 to 1:
6. The organic solvent A is selected from any one or a combination of ethyl acetate and dichloromethane. The recrystallization includes the following steps: dissolving favipiravir after filtration and drying in silica gel in organic solvent B, adding activated carbon, hot filtering, cooling and crystallizing, separating the solid, and drying. The organic solvent B is ethyl acetate.
2. The use of the favipiravir composition according to claim 1 in the preparation of medicaments for the prevention and / or treatment of novel coronavirus 2019-nCoV infection.
3. The use of the favipiravir composition according to claim 1 in the preparation of medicaments for the prevention and / or treatment of influenza virus infection.
4. The use of the favipiravir composition according to claim 1 in the preparation of medicaments for the prevention and / or treatment of Ebola virus infection.