Application of pineapple AcZFP1 gene in improving plant cold tolerance

By cloning and overexpressing the pineapple AcZFP1 gene, constructing a recombinant vector and transferring it into Arabidopsis thaliana, the problem of pineapple's susceptibility to damage at low temperatures was solved, and the plant's cold resistance and tolerance were significantly improved.

CN116590302BActive Publication Date: 2026-03-03SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-13
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

Pineapples are susceptible to damage under low-temperature stress and lack effective cold-resistance regulatory genes, which limits their production, distribution, and industrial development.

Method used

The pineapple C2H2 type zinc finger protein gene AcZFP1 was cloned and overexpressed, and a recombinant expression vector was constructed. The vector was then transformed into Arabidopsis thaliana using Agrobacterium-mediated transformation to improve the plant's cold resistance.

Benefits of technology

It significantly enhanced the cold resistance of Arabidopsis thaliana, increased the survival rate, enhanced the activity of SOD and POD enzymes, reduced the MDA content, promoted the expression of endogenous cold response genes, and improved the plant's resistance to low temperature stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116590302B_ABST
    Figure CN116590302B_ABST
Patent Text Reader

Abstract

The application discloses application of a pineapple AcZFP1 gene in improving cold resistance of plants. The nucleotide sequence of the AcZFP1 gene is shown in SEQ ID NO. 1; compared with a wild type control, an Arabidopsis thaliana strain overexpressing the AcZFP1 has a higher survival rate and Fv / Fm value after low-temperature treatment, the content of soluble protein is increased, the activities of SOD and POD enzymes are enhanced, the content of MDA is reduced, the cold resistance of the plant is significantly enhanced, and the AcZFP1 can promote expression of an endogenous cold response gene in the Arabidopsis thaliana, indicating that the AcZFP1 is a gene with a positive cold resistance regulation function and can be applied to genetic improvement of cold resistance of the pineapple.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of the pineapple AcZFP1 gene in improving plant cold resistance. Background Technology

[0002] Pineapple, a well-known tropical fruit, is susceptible to various abiotic stresses during cultivation, with low-temperature stress being the most severe. Sustained extreme low temperatures can cause varying degrees of damage, including yellowing leaves, necrosis of shoot tip meristems, and stem and leaf rot. Low temperatures have become a significant environmental factor limiting pineapple production, distribution, and industrial development. Low temperatures induce plants to activate defense mechanisms, making adaptive adjustments at multiple levels—molecular, cellular, physiological, and biochemical—to alleviate and resist the damage caused by low temperatures. At the molecular level, transcription factors can regulate the expression of a series of downstream low-temperature response genes, enhancing the plant's ability to resist low-temperature stress and playing a crucial role in the low-temperature stress response process. Identifying and identifying low-temperature stress-related transcription factors is of great significance for cold-resistant pineapple breeding.

[0003] Zinc finger proteins are one of the largest and most widespread transcription factor families in plants, with C2H2-type zinc finger proteins being the most numerous and extensively studied. These transcription factors play a wide range of regulatory roles in a series of biological processes, including artemisinin synthesis, starch metabolism, leaf senescence, and anther development. Furthermore, C2H2-type zinc finger proteins also play important roles in regulating abiotic stresses such as drought, high salinity, and low temperature. The C2H2-type zinc finger protein family has numerous members involved in multiple aspects of plant growth, development, and abiotic responses. A large number of genes and functions within this family remain unknown, and their functions exhibit significant species specificity across different plants. This necessitates further in-depth research into plant C2H2-type zinc finger proteins.

[0004] To date, there are no functional reports on C2H2 zinc finger protein genes in pineapple, and functional studies on cold resistance-regulating genes in pineapple are extremely limited. Therefore, it is urgent to identify and discover cold resistance-related genes in pineapple, laying the foundation for molecular methods to regulate the low-temperature stress resistance of pineapple and for the breeding of new varieties. Summary of the Invention

[0005] In view of the above-mentioned shortcomings of the prior art, the purpose of this invention is to provide a pineapple cold-resistant gene AcZFP1 and its application.

[0006] This invention uses 'Shenwan' pineapple as material to clone a C2H2 type zinc finger protein gene, named AcZFP1, with an open reading frame of 816 bp encoding 271 amino acids and containing two typical zinc finger protein domains. Gene expression analysis revealed that AcZFP1 can be induced by various abiotic stresses such as low temperature and ABA, as well as hormone treatment. Compared with the wild-type control, Arabidopsis thaliana lines overexpressing AcZFP1 showed higher survival rates and Fv / Fm values ​​after low-temperature treatment, increased soluble protein content, enhanced SOD and POD enzyme activities, and decreased MDA content, significantly enhancing the cold resistance of the plants. Furthermore, AcZFP1 can promote the expression of endogenous cold response genes in Arabidopsis thaliana, indicating that AcZFP1 is a gene with a positive cold resistance regulatory role.

[0007] The AcZFP1 gene of the present invention has the nucleotide sequence shown in SEQ ID NO.1.

[0008] The present invention also provides a protein encoded by the AcZFP1 gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] The present invention also provides an expression vector containing the AcZFP1 gene described above.

[0010] The present invention also provides host cells containing an expression vector of the AcZFP1 gene described above.

[0011] The present invention also provides the application of the AcZFP1 gene in improving plant cold resistance.

[0012] Preferably, the application described is the application of overexpression of the AcZFP1 gene to improve plant cold resistance.

[0013] Preferably, in the application described, the plant is pineapple or Arabidopsis thaliana.

[0014] This invention constructs a recombinant expression vector pK7WG2D-AcZFP1 for the pineapple cold-resistance gene AcZFP1, and transforms this recombinant expression vector into Arabidopsis thaliana using Agrobacterium-mediated transformation. Overexpressing lines of the AcZFP1 gene are then screened and obtained. Further biological functional verification revealed that the transgenic overexpressing lines exhibited significantly improved cold resistance compared to wild-type plants, indicating that the AcZFP1 gene cloned in this invention possesses cold-resistance functionality.

[0015] This invention provides a method for improving the cold resistance of plants, laying the foundation for the research on regulating the low-temperature stress resistance of pineapples using molecular means and the breeding of new varieties. Attached Figure Description

[0016] Figure 1 This is an electrophoresis image of AcZFP1 amplified by PCR.

[0017] Figure 2 Figure 1 shows the expression of AcZFP1 under various abiotic stresses and hormone treatments; Figure A shows the low temperature treatment, Figure B shows the NaCl treatment, Figure C shows the PEG treatment, Figure D shows the ABA treatment, Figure E shows the SA treatment, and Figure F shows the MeJA treatment.

[0018] Figure 3 PCR verification of AcZFP1 transgenic Arabidopsis thaliana (A) and observation of green fluorescent protein expression (B).

[0019] Figure 4 Phenotypic characteristics (A) and Fv / Fm chlorophyll fluorescence images (B) of wild-type and AcZFP1-overexpressing Arabidopsis thaliana under low-temperature treatment; WT is the wild-type line, and OE-1, OE-2, and OE-3 are AcZFP1-overexpressing lines.

[0020] Figure 5 Survival (A) and Fv / Fm (B) of wild-type and AcZFP1-overexpressing Arabidopsis thaliana after cold treatment. Asterisks indicate significant differences from wild-type control plants (P<0.05).

[0021] Figure 6 The changes in physiological parameters of Arabidopsis thaliana and wild-type plants before and after cold treatment were measured by overexpression of AcZFP1; asterisks indicate significant differences from wild-type control plants (P<0.05).

[0022] Figure 7 This is a graph showing the expression analysis of the AcZFP1 cold response gene in Arabidopsis thaliana under cold treatment conditions; asterisks indicate significant differences compared to wild-type control plants (P<0.05). Detailed Implementation

[0023] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0024] Example 1: Cloning and Overexpression Vector Construction of AcZFP1 Gene

[0025] I. Experimental Methods

[0026] 1. RNA extraction

[0027] The material was selected from the pineapple germplasm resource nursery of the College of Horticulture, South China Agricultural University, using the 'Shenwan' variety. Pineapple plants in good growth condition were selected, and 0.1g of leaf samples were randomly weighed and flash-frozen in liquid nitrogen. Total RNA was extracted from 'Shenwan' pineapples using the TsingZol Total RNA Extraction Reagent kit. The specific method is as follows:

[0028] (1) Sample preparation: Take 0.1g of fresh or liquid nitrogen-frozen sample, grind it into powder, transfer it to a centrifuge tube, add 1mL of TsingZol Reagent, and homogenize. Let stand for 5min to allow the nucleic acid-protein complex to be completely separated.

[0029] (2) Add 200 mL of chloroform to the above lysis solution, cover the tube and shake vigorously for 15 seconds. The solution is milky and let it stand at room temperature for 5 minutes.

[0030] (3) Centrifuge at 12000×g at 4℃ for 15 min. At this point, the sample will separate into 3 layers: an upper colorless aqueous phase (containing RNA), a middle layer, and a lower pink organic phase. Carefully aspirate the upper aqueous phase and transfer it to a new centrifuge tube.

[0031] (4) Add an equal volume of isopropanol, invert the container to mix, and let stand at room temperature for 10 minutes.

[0032] (5) Centrifuge at 12000×g at 4℃ for 10min, remove the supernatant, and a white gelatinous precipitate will appear at the bottom of the tube.

[0033] (6) Add 1 mL of 75% ethanol (prepared with RNA-free water) to wash the precipitate. Centrifuge at 7500×g at 4℃ for 5 min and discard the supernatant.

[0034] (7) Repeat step 6.

[0035] (8) Air dry at room temperature for 5-10 minutes. Add 20 μL of RNA-free water to dissolve the precipitate. If necessary, gently pipette or incubate at 55-60℃ for 5-10 minutes. Once the precipitate is completely dissolved, you will obtain pineapple RNA.

[0036] (9) The extracted pineapple RNA was stored in an ultra-low temperature freezer at -80℃ for later use.

[0037] 2. cDNA Synthesis

[0038] Follow the YEASEN reverse transcription kit instruction manual. Product name: III. First Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus), the specific method is as follows:

[0039] (1) Prepare the following mixture in an RNase-free centrifuge tube: 3 μL of 5×g DNA digester mix, 1 μg of total RNA, and add RNA-free H2O to a final volume of 15 μL. Gently mix by pipetting. Incubate at 42°C for 2 min to remove residual genomic DNA.

[0040] (2) Add directly to the reaction tube in step (1) above Add 5 μL of SuperMix plus and gently mix with a pipette. Set the reverse transcription program as follows: 25℃ for 5 min, 55℃ for 15 min, and 85℃ for 5 min. The resulting reaction product is pineapple cDNA, which is used for amplification of the AcZFP1 gene.

[0041] 3. Cloning of the AcZFP1 gene

[0042] The target fragment was amplified using Kangwei Century 2×Flash PCR MasterMix (Dye), and the specific method is as follows:

[0043] Prepare the following mixture in a centrifuge tube: 10 μL of 2×Flash PCR MasterMix (Dye), 0.8 μL of forward primer, 0.8 μL of reverse primer, 1 μL of template (cDNA), and 7.4 μL of ddH2O.

[0044] Forward primer (AcZFP1-F): ATGGCAATTGATGCTTTAGA;

[0045] Reverse primer (AcZFP1-R): TCAGCCGGGATTAGGAGCC.

[0046] Then perform PCR amplification according to the following reaction procedure: pre-denaturation 98℃ for 30s; denaturation 94℃ for 10s, annealing 55℃ for 15s, extension 72℃ for 8s, 30-35 cycles; final extension 72℃ for 1min.

[0047] 4. Target strip recovery

[0048] After PCR amplification, the target band was detected by 1% agarose gel electrophoresis. Once the band size was confirmed to be correct, the PCR products were recovered using a DNA gel recovery kit (Qingke Biotechnology), and the recovered products were then detected by electrophoresis. The specific method is as follows:

[0049] (1) Add Buffer GL (not less than 150 μL) to the PCR product according to the ratio of PCR stock solution: Buffer GL = 1:3 and mix by pipetting;

[0050] (2) Transfer the solution into the adsorption column, centrifuge at 12,000×g for 1 min, discard the waste liquid, and put the adsorption column back into the empty collection tube.

[0051] (3) Add 700 μL Buffer W2 to the adsorption column (please check first whether the specified volume of anhydrous ethanol has been added), centrifuge at 12,000×g for 1 min, and discard the waste liquid;

[0052] (4) Repeat step (3) once.

[0053] (5) Place the adsorption column back into the empty collection tube and centrifuge at 12,000×g for 2 min;

[0054] (6) Take out the adsorption column and place it in a clean 1.5mL centrifuge tube. Add 35μL Eluent to the middle of the adsorption membrane (preheating Eluent at 60-65℃ will improve the effect). Place at 20-25℃ for 2min and centrifuge at 12,000×g for 2min to obtain the PCR recovery product.

[0055] 5. Target band transforms DH5α competent cells

[0056] The PCR product was purified and ligated into the pClone 007 vector, and then the ligation product was transformed into DH5α competent cells. The specific steps are as follows:

[0057] (1) Take 50 μL of competent colon cells thawed in an ice bath, add 5 μL of ligation product to the competent cells, gently tap the tube wall a few times to mix, and let stand on ice for 30 min.

[0058] (2) Heat shock at 42℃ for 90s, then quickly transfer to ice and let stand for 2min.

[0059] (3) Add 900 μL of antibiotic-free LB liquid medium and incubate at 37°C and 200 rpm for 45 min on a shaker.

[0060] (4) Centrifuge at 5000 rpm for 3 min, discard 900 μL of supernatant, resuspend the bacterial cells and spread them on LB+Amp culture plates, and incubate overnight at 37°C.

[0061] After the bacteria have grown on the culture plate, single clones are picked for PCR detection. The positive result is determined using Kangwei reagent 2×Flash PCR MaterMix (Dye) with AcZFP1-F and AcZFP1-R primers. The bacterial culture of positive clones is sent to Qingke Company for sequencing. The sequencing results are compared with the reference gene sequence. BLAST alignment of the sequencing results shows that if the size and base sequence of the target fragment match AcZFP1, the AcZFP1 cloning is successful. Plasmids are then extracted from the amplified bacterial culture for later use.

[0062] 6. Construction of overexpression vectors

[0063] Using the AcZFP1 gene obtained from previous cloning as a template, an AcZFP1 overexpression vector was constructed using Gateway series technology, and the target fragment was placed downstream of the 35S promoter of pK7WG2D plasmid.

[0064] The first step is to perform a BP reaction, designing primers attB1-AcZFP1-F and attB2-AcZFP1-R:

[0065] attB1-AcZFP1-F:ggggacaactttgacaaaaaagttggcATGGCAATTGATGCTTTAGA;

[0066] attB2-AcZFP1-R:ggggactttgacaagaaagttgggcaTCAAGCCGGGATTAGGAGCC.

[0067] The BP reaction system consisted of: 2.5 μL of 2×Gateway BP cloning enzyme, 1.5 μL of the target gene attB-PCR product, and 1 μL of pDONR intermediate vector.

[0068] The BP reaction product was transformed into E. coli competent cells, and colonies were picked for PCR detection. After confirming successful ligation, the second step, the LR reaction, was performed. The LR reaction system consisted of: 2.5 μL of 2×Gateway LR cloning enzyme, 1.5 μL of entry vector or ORF vector, and 1 μL of target vector.

[0069] After mixing the reaction system, the reaction solution was collected by centrifugation and incubated overnight at 25°C. 0.5 μL of 10× proteinase K was added to the reaction solution, and the mixture was incubated at 37°C for 10 min. The product was then transformed into competent E. coli cells for detection and electrophoresis verification. After confirming consistency with sequencing alignment results, the plasmid was extracted for later use. The recombinant vector was named pK7WG2D-AcZFP1.

[0070] 7. Overexpression vector transformed into Agrobacterium

[0071] (1) Take the competent Agrobacterium cells stored at -80℃ and let them partially melt at room temperature or in the palm of your hand. When they are in an ice-water mixture, insert them into ice.

[0072] (2) Add 0.01-1 μg of plasmid DNA to each 100 μL of competent cells, mix by hand by tapping the bottom of the tube, and incubate on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0073] (3) Add 700 μL of antibiotic-free YEP liquid culture medium and incubate at 28°C with shaking for 2-3 hours.

[0074] (4) Centrifuge at 6000 rpm for one minute to collect the bacteria. Take about 100 μL of supernatant, gently pipette and resuspend the bacterial block, spread it on a YEP plate containing kanamycin (Kan), and incubate upside down in a 28℃ incubator for 2-3 days.

[0075] II. Experimental Results

[0076] Using cDNA from 'Shenwan' pineapple leaves as a template, the full-length AcZFP1 sequence was amplified by PCR. The band was consistent with expectations, approximately 816 bp. Figure 1 Sequence analysis revealed that AcZFP1 contains a complete open reading frame of 816 bp (its nucleotide sequence is shown in SEQ ID NO.1), encoding 271 amino acids (the amino acid sequence is shown in SEQ ID NO.2). Protein sequence characterization analysis indicated that the molecular formula of AcZFP1 is C0. 1217 H 1890 N 362 O 387 S 10 The AcZFP1 protein has a molecular weight of 28.11 kDa and a theoretical isoelectric point of 6.14, classifying it as an acidic protein. Its lipid coefficient is 48.82, and its instability coefficient is 84.66, classifying it as an unstable protein. Amino acid analysis of the AcZFP1 protein shows that it consists of 20 amino acids, with Ala (alanine) and Gly (glycine) being the most abundant, and Asn (asparagine) and Trp (tryptophan) being the least abundant. The AcZFP1 protein contains two zinc finger domains, classifying it as a C2H2 type zinc finger protein.

[0077] The recombinant plasmid was named pK7WG2D-AcZFP. Primers 35S-F (CGACAGTGGTCCCAAAGA) and Det-AcZFP-R (TCAAGCCGGGATTAGGAGCC) were designed for PCR detection, and a band of the expected size, approximately 1100 bp, was obtained, proving that the vector was successfully constructed.

[0078] Example 2: Expression analysis of AcZFP1 under different stress and hormone treatments

[0079] I. Experimental Methods

[0080] Callus tissue from 'Shenwan' pineapple was used as material and cultured at 28±2℃ under 16h light / 8h darkness conditions to maintain good growth. This tissue was then used for subsequent experiments involving low-temperature stress treatments and exogenous hormone treatments such as ABA. Samples were rapidly frozen in liquid nitrogen after collection and stored at -80℃. The expression of AcZFP1 (primer qAcZFP1-F / R, see Table 1) was detected by qRT-PCR, with the AcActin gene (primer qAcActin-F / R, see Table 1) serving as a reference gene.

[0081] Low-temperature treatment: The callus tissue, along with the tissue culture bottle, was placed directly into a 4°C culture chamber for tissue culture. Samples were collected after 4, 12, 24, and 48 hours of cold treatment.

[0082] Salt treatment: Callus tissue was treated in 150 mM sodium chloride (NaCl) solution for 4, 8, 16, 24 and 48 h;

[0083] PEG treatment: Callus tissue was treated in 15% polyethylene glycol (PEG6000) solution for 4, 8, 16, 24 and 48 h;

[0084] ABA treatment: Callus tissue was treated in MS liquid medium containing abscisic acid (ABA, 100 μM) for 4, 8, 16, 24 and 48 h, respectively.

[0085] SA treatment: Callus tissue was treated in MS liquid medium containing salicylic acid (SA, 100 μM) for 4, 8, 16, 24 and 48 h, respectively.

[0086] MeJA treatment: Callus tissue was treated in MS liquid medium containing methyl jasmonate (MeJA, 100 μM) for 4, 8, 16, 24 and 48 h, respectively.

[0087] The reaction system was operated according to the Hieff qPCR SYBR Green Master Mix (No Rox) (Yisheng) manual, and qRT-PCR was performed on a 384 (BIO-RAD) real-time PCR instrument. The reaction volume was 10 μL, and the reaction program was: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 35 s, with a cycle number of 40. The quantitative primer sequences are shown in Table 1, and 2... -△△Ct The relative expression level of genes was calculated using a method with three replicates per sample.

[0088] II. Experimental Results

[0089] qRT-PCR results showed ( Figure 2With increasing low-temperature treatment time, AcZFP1 gene expression gradually increased, reaching a maximum at 48 hours, indicating a strong response of the AcZFP1 gene to low-temperature stress. NaCl treatment induced AcZFP1 expression, reaching a maximum after 8 hours, decreasing to the initial level after 24 hours, and slightly recovering after 48 hours. After PEG treatment, AcZFP1 gene expression gradually increased, reaching a maximum at 8 hours, then decreasing, and was below the initial level at 48 hours. After SA treatment, AcZFP1 expression rapidly increased, reaching a maximum at 4 hours, then gradually decreased, and was far below the initial level at 48 hours. After MeJA treatment, AcZFP1 expression gradually increased, decreased slightly at 16 hours, and reached a maximum at 24 hours. After ABA treatment, expression increased, reaching a maximum at 16 hours, and returned to the initial level at 48 hours. It can be seen that AcZFP1 gene expression can respond to various abiotic stresses and hormonal treatments, suggesting that AcZFP1 may participate in multiple stress signaling pathways and play multiple functional roles.

[0090] Example 3: Genetic transformation and positive identification in Arabidopsis thaliana

[0091] I. Experimental Methods

[0092] 1. Genetic transformation in Arabidopsis thaliana

[0093] 1.1 Arabidopsis thaliana sowing

[0094] Take an appropriate amount of Arabidopsis thaliana seeds (200-300 seeds) on a clean bench and put them into a sterile 1.5mL centrifuge tube. Treat the seeds twice with 70% alcohol, 30s each time. Suspend the seeds with anhydrous ethanol and pour them onto a sterile filter paper. After the anhydrous ethanol has evaporated, sow the seeds evenly on the seed germination medium. Seal the petri dish with Parafilm and treat it at 4℃ for 24h. Then, place it under 16h light / 8h dark conditions for 7-10 days before transplanting.

[0095] 1.2 Cultivation of Arabidopsis thaliana

[0096] Moisten the peat moss with Horgland nutrient solution and divide it into seedling pots (do not compact). Use tweezers to remove the Arabidopsis seedlings from the culture medium (avoid damaging the plant) and plant them in the center of the seedling pots filled with peat moss. Use a suction bottle to water a small amount of tap water around the Arabidopsis seedlings, cover the seedlings with a transparent plastic lid, and place them in a greenhouse for cultivation. After 2 days, remove the plastic lid and water every 2-3 days. When most of the Arabidopsis seedlings begin to flower, secure them with bamboo skewers and transparent tape for later use.

[0097] 1.3 Activation of Agrobacterium tumefaciens

[0098] The bacterial strain preserved in glycerol was streaked onto YEP solid agar plates containing kanamycin (Kan) and cultured. A single fresh colony of Agrobacterium containing the target gene was picked and added to 3 mL of YEP liquid medium (rifampicin 50 mg / L, kanamycin 50 mg / L), and cultured overnight at 28°C with shaking at 220 rpm. In 200 mL of YEP medium containing 50 mg / L kanamycin (Kan), 1 mL of the overnight-cultured Agrobacterium culture was inoculated and cultured overnight at 28°C with shaking until OD600 = 1.0. The cells were collected by centrifugation at 4000 rpm for 15 min, and diluted in a 500 mL beaker with flower immersion medium to approximately OD600 = 0.8 for later use.

[0099] 1.4 Transformation of Arabidopsis thaliana

[0100] Select robust Arabidopsis thaliana plants in full bloom. Lay the plants flat, ensuring the flower buds are completely immersed in the Agrobacterium suspension for 1 minute. Remove the culture pots and invert them onto a large dish to drain excess liquid. Cover the treated Arabidopsis with a plastic lid and incubate in the dark for 24 hours. Then, place the treated Arabidopsis plants under light conditions of 23–25°C to allow them to grow normally. A second infection can be performed after one week.

[0101] Cultivate the treated Arabidopsis plants under light conditions of 23–25°C for 3–4 weeks. Once individual pods begin to wither and turn yellow, cut them off and place them in a petri dish to dry. After most of the Arabidopsis pods have withered and turned yellow, collect all the seeds and store them in 1.5 mL centrifuge tubes (make a small hole in the cap for drying). After the seeds are completely dry, store them in new 1.5 mL centrifuge tubes at 4°C for short-term storage. If necessary, they can be stored long-term at -20°C.

[0102] 2. Screening and identification of transgenic Arabidopsis thaliana

[0103] After harvesting T0 generation seeds, selection was performed on selective medium containing 30 mg / L hygromycin. Transgenic plants with a segregation ratio close to 3:1 were selected for subsequent analysis and identification. The selected T3 generation Arabidopsis thaliana positive plants were cultured in an artificial greenhouse at 22℃ with a photoperiod of 16 h light / 8 h dark. After the positive Arabidopsis thaliana plants matured, leaf DNA was extracted as a template. Specific primers Det-AcZFP1-F / R were designed for positive identification, and GFP green fluorescence was observed using a handheld (portable) LUYOR-3415 dual-wavelength fluorescence excitation light source.

[0104] DNA was extracted from positive Arabidopsis thaliana plants using the CTAB method. The specific steps are as follows:

[0105] (1) Take 0.1g of leaf and place it in a 2mL centrifuge tube. Add 2 sterile steel beads, freeze in liquid nitrogen and grind into powder.

[0106] (2) Add 800 μL of CTAB extract preheated at 65℃, keep warm at 65℃ for 30 min, and invert and mix several times during the process.

[0107] (3) Pre-cool on ice for 5 min, add 800 μL chloroform:isoamyl alcohol (24:1), mix by inverting, and centrifuge at 12000×g for 10 min.

[0108] (4) Transfer the upper aqueous phase to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix well, and let stand on ice for 10 min.

[0109] (5) Centrifuge at 12000×g for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash twice, then open the lid and dry at 37℃ for 10 min.

[0110] (6) Add 100 μL of ddH2O containing RNase (99 μL ddH2O + 1 μL RNase), and gently pipette to dissolve the precipitate. Once fully dissolved, Arabidopsis DNA can be obtained.

[0111] Using Arabidopsis DNA as a template, AcZFP1 gene-specific primers were designed to identify positive seedlings. The PCR reaction system was as follows: 10 μL of 2×Flash PCR MasterMix (Dye), 0.8 μL of forward primer, 0.8 μL of reverse primer, 1 μL of template (cDNA), and 7.4 μL of ddH2O. The PCR amplification program was as follows: pre-denaturation at 98℃ for 30 s; denaturation at 94℃ for 10 s, annealing at 55℃ for 15 s, extension at 72℃ for 8 s, for 30-35 cycles; final extension at 72℃ for 1 min. The AcZFP1 gene-specific primers were designed as follows:

[0112] Forward primer (Det-AcZFP1-F): CGCAGTACAAGTGCTCCGTA;

[0113] Reverse primer (Det-AcZFP1-R): CGGGGCTTCTTGAAAGGGT.

[0114] II. Experimental Results

[0115] PCR positive identification result ( Figure 3A) shows that the fragments amplified by the three AcZFP1 transgenic Arabidopsis lines (OE-1, OE-2, and OE-3) were the same size as the recombinant plasmid (positive control), approximately 500 bp, while WT and water (blank control) did not amplify the corresponding fragments. Compared to the wild-type control, the roots of the transgenic Arabidopsis showed obvious green fluorescence under ultraviolet light. Figure 3 B) indicates that the green fluorescent protein gene on the vector was expressed normally. These results all indicate that the recombinant plasmid pK7WG2D-AcZFP1 has been successfully integrated into the Arabidopsis genome.

[0116] Example 4: Cold resistance analysis and determination of corresponding indicators of AcZFP1

[0117] I. Experimental Methods

[0118] 1. Cold tolerance analysis and chlorophyll fluorescence determination of AcZFP1 transgenic Arabidopsis thaliana

[0119] Four-week-old wild-type and T3 generation transgenic Arabidopsis thaliana with uniform growth were selected and treated at -6℃ for 4 hours without cold acclimatization. After 3 days of recovery at room temperature, the survival rate was calculated. Phenotypic observations were performed before and after cold treatment, as well as on the first and third days of recovery. Relevant parameters were measured using the PlantExplorer chlorophyll fluorescence imaging system.

[0120] 2. Determination of physiological parameters in AcZFP1 transgenic Arabidopsis thaliana

[0121] Four-week-old wild-type and T3 generation transgenic Arabidopsis thaliana with uniform growth were selected and treated at 4℃ for 24 hours. Leaves were collected before and after the cold treatment for the determination of cold-resistance-related physiological indicators such as TP (soluble protein), SOD (superoxide dismutase), POD (peroxidase), and MDA (malondialdehyde). Specific indicators were measured using the total protein (TP) assay kit (A045-2-2), total superoxide dismutase (T-SOD) assay kit (A001-1-1), peroxidase (POD) assay kit (A084-3-1), and malondialdehyde (MDA) assay kit (A003-1-2), respectively, following the instructions of the kits. All kits were purchased from Nanjing Jiancheng Biotechnology Institute. Each experiment was performed in at least three biological replicates, and the significance of differences was analyzed using t-tests with SPSS version 19.0 software. The specific methods are as follows:

[0122] (1) Determination of TP content

[0123] Add 0.1g of Arabidopsis thaliana leaf sample to 9 volumes of phosphate buffer (pH: 7.4) at a weight (g):volume (mL) ratio of 1:9. Add two small steel balls to each centrifuge tube and homogenize mechanically for 60s at low temperature in a grinder to prepare a 10% homogenate. Centrifuge at 3500rpm for 10min at low temperature, and collect the supernatant and place it on ice for testing. Add 50μL of protein standard solution, 50μL of ultrapure water, and 50μL of test supernatant to blank tubes, standard tubes, and test tubes, respectively. Add 3mL of Coomassie brilliant blue chromogenic solution to each tube, mix well, and let stand for 10 minutes. Take 200μL from each tube and add it to the 96-well microplate reader. Measure the OD value of each tube at 595nm and 1cm optical path using a microplate reader. Calculation formula: Protein concentration of sample (g / L) = (OD of test tube - OD of blank tube) / (OD of standard tube - OD of blank tube) × concentration of standard (g / L) × dilution factor of sample before testing. The protein concentration of standard is 0.524 g / L, and the dilution factor is 10 times.

[0124] (2) Determination of MDA content

[0125] 0.1g of Arabidopsis thaliana leaf sample was mixed with 9 volumes of phosphate buffer (pH: 7.4) at a weight (g):volume (mL) ratio of 1:9. Two small steel balls were added to each centrifuge tube. The mixture was mechanically homogenized for 60s at low temperature in a grinder to prepare a 10% homogenate. The homogenate was then centrifuged at 3500rpm for 10min at 4℃. The supernatant was collected and placed on ice for testing. For blank tubes, standard tubes, and test tubes, 100μL of anhydrous ethanol, 100μL of 10nmol / mL malondialdehyde standard, 100μL of the test supernatant, 1mL of reagent I, and 3mL of reagent II working solution and 1mL of reagent III working solution were added, vortexed, and incubated in a 95℃ water bath for 40min. After cooling under running water, the mixture was centrifuged at 3500rpm for 10min. The supernatant was collected and the OD value of each tube was measured at 532nm (1cm optical path) using an ELISA reader. The formula for correcting the protein concentration of the sample is as follows: MDA content of the sample to be tested (nmol / mL) = (OD of test tube - OD of control tube) / (OD of standard tube - OD of blank tube) × concentration of standard (10 nmol / mL) × dilution factor of sample before testing.

[0126] (3) Determination of SOD activity

[0127] Add 0.1g of Arabidopsis thaliana leaf sample to 9 volumes of ultrapure water at a weight (g):volume (mL) ratio of 1:9. Add two small steel balls to each centrifuge tube. Homogenize mechanically in a grinder at low temperature for 60s, centrifuge at 3500rpm for 10min, and collect the supernatant to place on ice for testing. Add 50μL of ultrapure water and 50μL of sample supernatant to the control and test tubes, respectively. Add 1mL of reagent I working solution and 100μL of reagent II, reagent III, and reagent IV working solutions to each tube. Vortex to mix, incubate at 37℃ for 40min, add 2mL of colorimetric reagent, mix well, and let stand at room temperature for 10min. Take 200μL from each tube and add it to the 96-well microplate reader. Measure the OD value of each tube at 550nm using a microplate reader. The formula for calculating the SOD activity of the sample after correction is as follows: SOD activity of the sample to be tested (U / g) = (OD of control tube - OD of test tube) / OD of control tube / 50% × total volume of reaction solution (mL) / sample volume (mL) / homogenate concentration (g / mL).

[0128] (4) Determination of POD activity

[0129] Add 0.1g of Arabidopsis thaliana leaf sample to 9 volumes of ultrapure water at a weight (g):volume (mL) ratio of 1:9. Add two small steel balls to each centrifuge tube. Homogenize mechanically in a grinder at low temperature for 60s, centrifuge at 3500rpm for 10min, and collect the supernatant to place on ice for testing. Add 200μL of ultrapure water and 200μL of reagent III working solution to each control and test tube. Add 2.4mL of reagent I, 300μL of reagent II, and 100μL of sample to each tube, mix well, and react accurately at 37℃ for 30min. Add 1mL of reagent IV, mix well, and react at 3500rpm for 10min. Take 200μL from each tube and add it to the 96-well microplate reader. Measure the OD value of each tube at 420nm using a microplate reader. The formula for correcting the protein concentration of the sample is as follows: POD activity of the sample to be tested (U / g) = (OD of test tube - OD of control tube) / 12; colorimetric path (1cm) × total reaction volume (mL) / sample volume (mL) / reaction time (30min) / homogenate concentration (g / mL) × 1000.

[0130] II. Experimental Results

[0131] Depend on Figure 4 A indicates that before cold treatment, there was no significant difference in growth status between the transgenic lines and wild-type plants. After cold treatment (-6℃, 4h), and a 3-day recovery period, it was found that the wild-type plants exhibited widespread yellowing and wilting compared to the transgenic lines, while the transgenic lines retained their bright green leaves with slightly withered and curled leaf margins. Statistical analysis revealed that the survival rate of the wild-type was 11.11%, while the survival rates of the three transgenic lines were 51.85%, 70.37%, and 37.04%, respectively. The survival rate of the transgenic lines was significantly higher than that of the wild-type. Figure 5 A). Under normal growth conditions, there was no significant difference in the maximum photochemical efficiency (Fv / Fm) between the wild-type and transgenic lines. Under cold stress, both the transgenic and wild-type lines showed a decreasing trend in Fv / Fm, but after low-temperature treatment, the Fv / Fm values ​​of the transgenic lines were 0.717, 0.700, and 0.748, respectively, while the wild-type was 0.663. The Fv / Fm values ​​of the transgenic lines were significantly higher than those of the wild-type. Figure 4 B and Figure 5 B).

[0132] After cold treatment, the transgenic lines showed significantly higher POD and SOD activities and soluble protein (TP) content than the wild type. This indicates that the transgenic lines can better mitigate the damage caused by the accumulation of reactive oxygen species (ROS) at low temperatures, while increasing the content of osmotic regulators to adapt to low-temperature stress. Figure 6 A, B, C). The MDA content of the transgenic lines after cold treatment was significantly lower than that of the wild type, indicating that the degree of membrane system damage in the transgenic lines was lower than that in the wild type. Figure 6 D).

[0133] In summary, overexpression of AcZFP1 significantly improved the cold resistance of transgenic Arabidopsis thaliana through multiple pathways, including enhancing the photosynthetic system's tolerance to low temperatures, increasing SOD and POD activity and TP content, and reducing MDA content.

[0134] Example 5: Expression analysis of cold-response genes in transgenic Arabidopsis thaliana

[0135] I. Experimental Methods

[0136] Four-week-old transgenic Arabidopsis seedlings with uniform growth were selected and treated at 4°C for 24 hours without cold acclimatization. RNA was extracted from leaf tissues and reverse transcribed into cDNA. qRT-PCR was performed using cDNA as a template, with wild-type Arabidopsis as a control and AtActin as a reference gene (primers qAtActin-F / R, see Table 1). The expression levels of endogenous cold-response genes AtRD29A, AtCOR47, AtKIN1, and AtKIN2 in Arabidopsis were detected. Details of the quantitative primers are shown in Table 1.

[0137] The reaction system was operated according to the Hieff qPCR SYBR Green Master Mix (No Rox) (Yisheng) manual, and qRT-PCR was performed on a 384 (BIO-RAD) real-time PCR instrument. The reaction volume was 10 μL, and the reaction program was: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 35 s, with a cycle number of 40. The quantitative primer sequences are shown in Table 1, and 2... -△△CtThe relative expression level of genes was calculated using a method with three replicates per sample.

[0138] II. Experimental Results

[0139] qRT-PCR results showed ( Figure 7 Under normal conditions, the expression of four endogenous genes in transgenic lines was significantly higher than that in wild-type lines. After 24 hours of cold treatment at 4°C, the expression levels of endogenous cold-response genes in both transgenic and wild-type lines were significantly increased, and the relative expression levels in most transgenic lines were higher than those in wild-type lines, indicating that AcZFP1 activated the expression of cold-response-related genes in Arabidopsis thaliana.

[0140] Table 1 Primers and sequences used for qRT-PCR

[0141]

Claims

1. overexpression AcZFP1 application of genes in improving cold tolerance in plants, characterized in that, The AcZFP1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the plant is pineapple or Arabidopsis.

2. overexpression AcZFP1 expression vector of the gene or a host cell containing the expression vector of the gene AcZFP1 application of the expression vector of the gene or a host cell containing the expression vector of the gene in improving cold tolerance of pineapple, characterized in that, The AcZFP1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1.