Preparation and application of co-delivery nanopesticide targeting CYP6CY13 gene of aphid

Abstract

The application discloses a kind of co-delivery nano-pesticide preparation and its application targeted to aphid CYP6CY13 gene, the nucleotide sequence of the gene is as shown in SEQ ID NO:1;The raw materials of the co-delivery nano-pesticide include 1 portion of imidacloprid, 20-50 portions of acetone, 0.05-0.3 portions of co-delivery nano-carrier RHMS-NH2 and 0.05-0.3 portions of dsCYP6CY13 by weight fraction ratio.The application improves the environmental stability of dsRNA, interferes with the expression of aphid enzyme gene, improves the sensitivity of aphid to imidacloprid, and realizes efficient prevention and control of aphid.The nano-pesticide has the advantages of simple synthesis method, low cost, high biological activity and good biocompatibility.

Description

Technical Field

[0001] This invention relates to the field of biological control, specifically to targeting cotton aphids. CYP6CY13 Preparation and application of gene co-delivery nanopesticides. Background Technology

[0002] Pesticides play an irreplaceable role in ensuring agricultural production and food security. However, due to the 3Rs (residue, resistance, and rampant spread) and the growing environmental awareness of the public, traditional pesticides are gradually losing their advantages. Therefore, our demand for highly efficient, low-toxicity green crop protection products is increasing. RNAi technology was first discovered in *Nematodeus elegans*, and its mechanism of action was elucidated in 1998. Double-stranded RNA (dsRNA) induces the degradation of homologous messenger RNA (mRNA) to reduce or inhibit gene expression, thereby affecting insect growth, development, and reproduction, and even leading to death. Therefore, RNAi shows great potential in green pest management strategies, but the main challenges lie in improving the environmental stability of dsRNA and reliable delivery vectors. These challenges lead to low RNAi efficiency, especially in some Lepidoptera and Hemiptera pests, limiting the development and application of RNAi-based pest management strategies.

[0003] In recent years, nanotechnology has been widely used in medicine, energy, environment, and agriculture. Its unique physical and chemical properties make it a unique tool for researching and developing agricultural technologies. Furthermore, nucleic acid / drug co-delivery systems developed based on nanotechnology have shown numerous advantages and have been widely applied in the pharmaceutical field. Nanoparticles can simultaneously load drugs and nucleic acids, improving the stability of nucleic acids and achieving synergistic therapeutic effects. Based on this, we have developed a dsRNA / insecticide co-delivery system, aiming to utilize nanotechnology to co-deliver dsRNA and insecticides to delay pesticide resistance in pests and achieve synergistic effects and reduced pesticide dosage.

[0004] The cotton aphid is a significant, globally distributed agricultural pest that has developed resistance to 51 active ingredients in insecticides, with 283 reported resistance events, ranking 15th on the list of arthropod insecticide resistance. Cytochrome P450 (P450) multifunctional oxidases, as the most important detoxification and metabolic enzyme system in the cotton aphid, play a crucial role in its resistance to insecticides. Therefore, selecting genes related to detoxification metabolism as RNAi targets is a potential novel pest control strategy. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a targeted cotton aphid treatment. CYP6CY13This invention relates to the preparation and application of gene co-delivery nanopesticides. It improves the environmental stability of dsRNA, interferes with the expression of cotton aphid hydrolase genes, and enhances the sensitivity of cotton aphids to imidacloprid, thus achieving highly efficient control of cotton aphids. This nanopesticide has advantages such as simple synthesis method, low cost, high bioactivity, and good biocompatibility. It also addresses existing technical problems. 1) Existing methods for managing pesticide resistance in agricultural pests are insufficient to address the increasingly serious problem of pesticide resistance in pests; 2) The creation of new pesticides is a relatively effective method for controlling pest resistance, but the creation of new pesticides is costly and time-consuming; 3) How to find reliable delivery vectors to improve the stability of dsRNA in the environment.

[0006] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a cotton aphid P450 gene. CYP6CY13 The partial sequence of the nucleotide sequence is shown in SEQ ID NO: 1.

[0007] The present invention also provides a method for obtaining the above-mentioned cotton aphids. CYP6CY13 Primer pairs for partial gene sequences, wherein the primer pairs are: Upstream primer: 5'-GGA AGATCT TCCACCGGAAGTTATGGAATA -3'; Downstream primer: 5'-CCC AAGCTT GGGGACCTTACGCAATGTTTC -3'.

[0008] Among them, the recombinant vector pESI-T- CYP6CY13 Contains the above-mentioned cotton aphids CYP6CY13 A gene expression vector, wherein the expression vector is a pESI-T vector.

[0009] The present invention also provides a recombinant vector L4440- CYP6CY13 The recombinant vector contains the aforementioned cotton aphid. CYP6CY13 A gene expression vector, wherein the expression vector is L4440.

[0010] The present invention also provides a recombinant vector L4440- containing the above-mentioned recombinant vector. CYP6CY13 The host cell, wherein the host cell is an HT115 competent cell.

[0011] ds was extracted using the above-mentioned host cell induction. CYP6CY13 The method, said method, involves placing a substance containing the recombinant vector L4440- CYP6CY13 Host cell culture, shaken to OD 600Add approximately 0.40 g of IPTG to a final concentration of 1 mM, induce expression, and culture at 37°C with shaking for 4 h. Extract total RNA from the bacteria, and purify the resulting dsRNA, which is the dsRNA. CYP6CY13.

[0012] This invention also provides a targeted cotton aphid CYP6CY13 Gene co-delivery nanopesticides, wherein the raw materials for the co-delivery nanopesticides, by weight, include 1 part imidacloprid, 20-50 parts acetone, 0.05-0.3 parts co-delivery nanocarrier RHMS-NH2, and 0.05-0.3 parts ds CYP6CY1 3.

[0013] Furthermore, the raw materials for the co-delivery nanocarrier RHMS-NH2 include, by weight, 1 part RHMS, 1-5 parts 3-aminopropyltriethoxysilane (APTES), and 100-200 parts toluene; The raw materials for the rough-surfaced hollow mesoporous silica nanoparticles RHMS include, by weight, 1 part tetraethyl orthosilicate (TEOS), 1-2 parts resorcinol, 1-2 parts formaldehyde, 10-15 parts ammonia, 30-50 parts distilled water, and 250-300 parts anhydrous ethanol.

[0014] Furthermore, the raw materials for the co-delivered nanopesticide, by weight, include 1 part imidacloprid, 30 parts acetone, 0.2 parts co-delivered nanocarrier RHMS-NH2, and 0.2 parts ds CYP6CY1 3; wherein, the raw materials for the co-delivery nanocarrier RHMS-NH2 include, by weight, 1 part RHMS, 2 parts 3-aminopropyltriethoxysilane (APTES) and 150 parts toluene; The raw materials for the rough-surfaced hollow mesoporous silica nanoparticles RHMS include, by weight, 1 part tetraethyl orthosilicate (TEOS), 1.4 parts resorcinol, 1.96 parts formaldehyde, 12 parts ammonia, 40 parts distilled water, and 280 parts anhydrous ethanol.

[0015] The above-mentioned cotton aphid CYP6CY13 A method for preparing gene-co-delivered nanopesticides includes the following steps: 1) Preparation of Rough-surfaced Hollow Mesoporous Silica Nanoparticles (RHMS) a. Weigh out 1 part tetraethyl orthosilicate (TEOS), 1-2 parts resorcinol, 1-2 parts formaldehyde, 10-15 parts ammonia, 30-50 parts distilled water, and 250-300 parts anhydrous ethanol by weight ratio. b. A mixed solution is obtained by mixing distilled water, anhydrous ethanol and ammonia. A portion of resorcinol and a portion of formaldehyde are dispersed in the mixed solution and stirred at room temperature to obtain a mixed reactant. c. Add tetraethyl orthosilicate (TEOS) to the mixed reactants and stir to react; then add the other part of resorcinol and the other part of formaldehyde to the mixed reactants, stir to react, and collect the reaction product by centrifugation; d. The reaction product was washed multiple times with anhydrous ethanol and distilled water to remove free impurities, centrifuged to obtain a solid, dried in a vacuum drying oven, and then calcined in a muffle furnace to obtain rough-surfaced hollow mesoporous silica nanoparticles (RHMS). 2) Preparation of co-delivered nanocarrier RHMS-NH2 a. Weigh out 1 part by weight of RHMS, 1-5 parts by weight of 3-aminopropyltriethoxysilane (APTES), and 100-200 parts by weight of toluene, and set aside. b. RHMS, 3-aminopropyltriethoxysilane (APTES) and toluene were stirred at high temperature. After the reaction was completed, the precipitate was washed with acetone several times and then dried under vacuum to obtain the co-delivered nanocarrier RHMS-NH2. 3) Co-delivery of nanopesticides RHMS / IMI / ds CYP6CY13 Preparation a. Weigh out 1 part imidacloprid, 20-50 parts acetone, 0.05-0.3 parts co-delivered nanocarrier RHMS-NH2, and 0.05-0.3 parts ds according to the following weight ratio. CYP6CY13 .

[0016] b. Imidacloprid was dissolved in acetone to obtain an acetone solution of imidacloprid. The co-delivered nanocarrier RHMS-NH2 was added to the imidacloprid acetone solution, and the mixture was stirred continuously at room temperature in the dark. After stirring, the precipitate was collected by centrifugation, washed with distilled water, and then vacuum dried to obtain the nanopesticide RHMS / IMI. c. The nano-pesticides RHMS / IMI and ds CYP6CY1 3. Room temperature mixing to obtain co-delivered nanopesticides RHMS / IMI / ds CYP6CY13 .

[0017] As a preferred option, the above-mentioned targeted cotton aphid CYP6CY13 A method for preparing gene-co-delivered nanopesticides includes the following steps: 1) Preparation of Rough-surfaced Hollow Mesoporous Silica Nanoparticles (RHMS) a. Weigh out 1 part tetraethyl orthosilicate (TEOS), 1.4 parts resorcinol, 1.96 parts formaldehyde, 12 parts ammonia, 40 parts distilled water, and 280 parts anhydrous ethanol by weight ratio. b. A mixed solution was obtained by mixing distilled water, anhydrous ethanol and ammonia. 0.4 parts of resorcinol and 0.56 parts of formaldehyde were dispersed in the mixed solution and stirred at 37°C for 6 h to obtain a mixed reactant. c. Add tetraethyl orthosilicate (TEOS) to the mixed reactants and stir to react; then add 1 part resorcinol and 1.4 parts formaldehyde to the mixed reactants, stir to react, and centrifuge to collect the reaction product; d. The reaction product was washed multiple times with anhydrous ethanol and distilled water to remove free impurities, centrifuged to obtain a solid, dried in a vacuum drying oven, and then calcined in a muffle furnace to obtain rough-surfaced hollow mesoporous silica nanoparticles (RHMS). 2) Preparation of co-delivered nanocarrier RHMS-NH2 a. Weigh out 1 part by weight of RHMS, 2 parts by weight of 3-aminopropyltriethoxysilane (APTES), and 150 parts by weight of toluene, and set aside. b. RHMS, 3-aminopropyltriethoxysilane (APTES) and toluene were stirred in a vacuum at 80°C for 24 h. After the reaction was completed, the precipitate was washed with acetone several times and dried in a vacuum at 60°C for 12 h to obtain the co-delivered nanocarrier RHMS-NH2. 3) Co-delivery of nanopesticides RHMS / IMI / ds CYP6CY13 Preparation a. Weigh out 1 part imidacloprid, 30 parts acetone, 0.2 parts co-delivered nanocarrier RHMS-NH2, and 0.2 parts ds according to the following weight ratio. CYP6CY13 .

[0018] b. Imidacloprid was dissolved in acetone to obtain an acetone solution of imidacloprid. The co-delivered nanocarrier RHMS-NH2 was added to the acetone solution of imidacloprid. The mixture was stirred continuously at room temperature for 12 hours under light-protected conditions. After stirring, the precipitate was collected by centrifugation, washed with distilled water, and dried under vacuum at 60°C for 12 hours to obtain the nanopesticide RHMS / IMI. c. The nano-pesticides RHMS / IMI and ds CYP6CY1 3. Mix at room temperature for 10 min to obtain co-delivered nanopesticides RHMS / IMI / ds CYP6CY13 .

[0019] The present invention also provides an application of the above-mentioned co-delivered nanopesticide in the control of cotton aphids.

[0020] The principle of this invention: cotton aphids CYP6CY13 Genes play an important role in the detoxification metabolism of imidacloprid by cotton aphids, and silencing them is crucial. CYP6CY13The gene can significantly increase the cotton aphid's susceptibility to imidacloprid.

[0021] Rough-surfaced hollow mesoporous silica (RHMS) possesses excellent physicochemical properties and is widely used in the pharmaceutical field. Its hollow mesoporous structure endows it with drug loading capabilities, while its rough surface grooves enable it to load nucleic acids. Therefore, this invention utilizes the superior properties of RHMS to... CYP6CY13 By co-loading imidacloprid with RHMS, a co-delivery nanopesticide based on dsRNA and insecticide was obtained. Compared with traditional pesticides, the co-delivery system showed better control efficacy against cotton aphids under the premise of the same active ingredient, which is due to the dsRNA... CYP6CY13 The synergistic effect.

[0022] The beneficial effects of this invention are: (1) This invention utilizes the HT115-L4440 system to induce expression of dsRNA, which greatly reduces the synthesis cost of dsRNA; (2) This invention utilizes RNAi technology to silence genes related to cotton aphid resistance, thereby increasing the sensitivity of cotton aphids to insecticides, and delivers ds via RHMS. CYP6CY13 Improved ds CYP6CY13 RNAi efficiency and duration of action; (3) This invention constructs a nanopesticide co-delivered with insecticide and dsRNA, utilizing RHMS to simultaneously load dsRNA. CYP6CY13 Compared with imidacloprid, it has a simple synthesis method and mild reaction conditions, and has the potential for practical application; In summary, this invention improves the environmental stability of dsRNA, interferes with the expression of cotton aphid hydrolase genes, and enhances the sensitivity of cotton aphids to imidacloprid, thus achieving highly efficient control of cotton aphids. This nanopesticide has advantages such as simple synthesis method, low cost, high biological activity, and good biocompatibility. Attached Figure Description

[0023] Figure 1 To induce expression of purified ds CYP6CY13 Gel electrophoresis image M: Marker; 1: ds GFP ;2:ds CYP6CY13 ; Figure 2 RHMS transmission electron microscope image Figure 3 RHMS scanning electron microscope image Figure 4 RHMS / IMI Fourier transform infrared spectrum Figure 5 Transmission electron microscopy energy dispersive spectroscopy (TEM) images of RHMS / IMI / dsRNA Figure 6Transmission electron microscopy images of RHMS / IMI / dsRNA Figure 7 The protective effect of RHMS / dsRNA on dsRNA In the chart, the bars represent the mean ± standard deviation, and different lowercase letters indicate significant differences. P < 0.05; Figure 8 The interference efficiency of RHMS / dsRNA on cotton aphids In the chart, the bars represent the mean ± standard deviation. Indicates significant difference P < 0.05, Indicates significant difference P < 0.01; Figure 9 To disrupt the cotton aphid's sensitivity to imidacloprid. In the chart, the bars represent the mean ± standard deviation. Indicates significant difference P < 0.01; Figure 10 To assess the control efficacy of different treatments against cotton aphids In the figure, the line graph represents the mean ± standard deviation. Indicates significant difference P < 0.01; Detailed Implementation

[0024] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0025] Example 1: Cotton Aphid CYP6CY13 Gene dsRNA synthesis 1. Escherichia coli HT115(DE3) induces dsRNA expression 1.1 CYP6CY Cloning of gene fragments and construction of vectors Design and synthesize primers, with Bgl II and Hind III restriction enzyme sites inserted at both ends. Upstream primer: 5'- GGA ​ TCCACCGGAAGTTATGGAATA -3' Downstream primer: 5'- CCC ​ GGGGACCTTACGCAATGTTTC -3' The underlined part indicates the introduction of enzyme cleavage sites. Using the first-strand cDNA of cotton aphid as a template, a DNA fragment of 388 bp was amplified by PCR. The PCR product was detected by agarose gel electrophoresis and the target fragment was recovered using an E.Z.N.A. gel recovery kit.

[0026] The target fragment was ligated into the pESI-T vector. The ligation product was transformed into Trelief TM5α competent cells and plated on solid LB agar plates containing ampicillin. After incubation for approximately 12 h, single white colonies were picked and cultured in LB+Amp liquid medium. Preliminary validation was performed using 2×Hieff PCR Mester Mix (YEASEN). Samples with correct validation were then subjected to further sequencing verification. Plasmids were extracted from the sequenced positive clones using the OMEGA EZNAPlasmid Mini Kit to obtain the pESI-T-T vector. ​ .

[0027] The already constructed pESI-T- ​ The vector and the L4440 vector were simultaneously digested with Bgl II and Hind III (TaKaRa), recovered, ligated, and transformed into Trelief™ 5α competent cell strains. The transformed cells were then plated on solid LB agar plates containing ampicillin and cultured for approximately 12 h. Single white colonies were picked and cultured in LB+Amp liquid medium. Using 2×Hieff... TM Preliminary validation of bacterial culture PCR was performed using PCR Master Mix (YEASEN), and plasmids were extracted using OMEGA's EZNAPlasmid Mini Kit.

[0028] 1.2 dsRNA induction expression and extraction and purification The already constructed L4440- ​ After the vector was transformed into HT115 competent cells, it was plated on solid LB agar plates containing ampicillin and cultured for approximately 12 h. Single white colonies were then picked and cultured in LB+Amp liquid medium. Preliminary validation was performed using 2×Hieff PCR Mester Mix (YEASEN). Positive colonies were selected for sequencing and the bacterial strains were cryopreserved. Cells containing L4440- were cultured at 37℃ with shaking. ​ The bacterial culture containing the plasmid was shaken to OD 600 Add approximately 0.40 g of IPTG to a final concentration of 1 mM, and induce expression. Incubate at 37°C with shaking for 4 h. Extract total bacterial RNA and purify to obtain dsRNA (ds ​ The concentration and quality of dsRNA were detected by spectrophotometry and 1% agarose gel electrophoresis.​ Store at -80℃ for later use.

[0029] Example 2: Targeting cotton aphids ​ Preparation method of gene co-delivery nanopesticides 1) Preparation of Rough-surfaced Hollow Mesoporous Silica Nanoparticles (RHMS) a. Weigh out 1 part tetraethyl orthosilicate (TEOS), 1.4 parts resorcinol, 1.96 parts formaldehyde, 12 parts ammonia, 40 parts distilled water, and 280 parts anhydrous ethanol by weight ratio. b. A mixed solution was obtained by mixing distilled water, anhydrous ethanol and ammonia. 0.4 parts of resorcinol and 0.56 parts of formaldehyde were dispersed in the mixed solution and stirred at 37°C for 6 h to obtain a mixed reactant. c. Add 1 part of tetraethyl orthosilicate (TEOS) to the mixed reactants and stir to react; then add 1 part of resorcinol and 1.4 parts of formaldehyde to the mixed reactants, stir to react, and centrifuge to collect the reaction product; d. The reaction product was washed multiple times with anhydrous ethanol and distilled water to remove free impurities, centrifuged to obtain a solid, dried in a vacuum drying oven, and then calcined in a muffle furnace to obtain rough-surfaced hollow mesoporous silica nanoparticles (RHMS). 2) Preparation of co-delivered nanocarrier RHMS-NH2 a. Weigh out 1 part by weight of RHMS, 2 parts by weight of 3-aminopropyltriethoxysilane (APTES), and 150 parts by weight of toluene, and set aside. b. RHMS, 3-aminopropyltriethoxysilane (APTES) and toluene were stirred in a vacuum at 80°C for 24 h. After the reaction was completed, the precipitate was washed with acetone several times and then dried in a vacuum at 60°C for 12 h to obtain the co-delivered nanocarrier RHMS-NH2. 3) Co-delivery of nanopesticides RHMS / IMI / ds ​ Preparation a. Weigh out 1 part imidacloprid, 30 parts acetone, 0.2 parts co-delivered nanocarrier RHMS-NH2, and 0.2 parts ds according to the following weight ratio. ​ .

[0030] b. Imidacloprid was dissolved in acetone to obtain an acetone solution of imidacloprid. The co-delivered nanocarrier RHMS-NH2 was added to the acetone solution of imidacloprid. The mixture was stirred continuously at room temperature for 12 h under light-protected conditions. After stirring, the precipitate was collected by centrifugation, washed with distilled water, and dried under vacuum at 60℃ for 12 h to obtain the nanopesticide RHMS / IMI. c. The nano-pesticides RHMS / IMI and ds​ 3. Mix at room temperature for 10 min to obtain co-delivered nanopesticide RHMS / IMI / ds ​ .

[0031] Example 3: Determination of the protective effect of the co-delivered nanopesticide prepared in Example 2 against dsRNA. 200, 400, 600, 800, and 1000 ng of dsRNA were mixed with 16 μg of RHMS-HN2 and incubated at room temperature for 10 min. RNase A solution was then added to bring the final concentration to 2 ng / μL. -1 Incubate at 37℃ for 10 min. After incubation, add 1 μL of 0.5% sodium dodecyl sulfate (SDS) to each centrifuge tube to depolymerize dsRNA with RHMS-MH2. Use agarose gel electrophoresis to determine the protective ability of RHMS-NH2 on dsRNA.

[0032] The results are as follows ​ As shown, the addition of RHMS-NH2 can improve the stability of dsRNA in RNase A compared with the control group dsRNA.

[0033] Example 4: Delivery of dsRNA by the co-delivery nanocarrier prepared in Example 2 above. ds configuration ​ and RHMS / ds ​ A sucrose aqueous solution was prepared, resulting in a dsRNA concentration of 200 ng / μL and a sucrose solution concentration of 0.5 mol / L. -1 , with ds ​ As a control, an in vitro dsRNA feeding experiment was conducted using double-pass tubes. Three independent biological replicates were set up for each treatment. Cotton aphids were collected after 48 h; one portion was used for interference efficiency assays, and the other portion was used to assess the sensitivity of the interfered cotton aphids to imidacloprid using the leaf film method. Results are as follows: ​ As shown, compared with the control group, ds ​ and RHMS / ds ​ It can significantly reduce ​ The expression levels of these substances decreased by 44.6% and 30.0%, respectively.

[0034] In addition, such as ​ The RNAi assay showed a significant increase in the cotton aphid's sensitivity to imidacloprid. Using imidacloprid LC50... 50 (350.06mg L) -1 As a diagnostic dose, the mortality rate of cotton aphids increased by 19.5% and 14.0%, respectively.

[0035] Example 5: Bioactivity of the co-delivered nanopesticide prepared in Example 2 against cotton aphids. 1) Based on the above results, a gene-targeted nanopesticide RHMS / IMIds was constructed. ​ Using cotton aphid-resistant strains, the bioactivity of cotton aphids was determined using the leaf film method. The results are shown in Table 1. Compared with imidacloprid, the use of RHMS / IMI / ds ​ Subsequently, the cotton aphid's sensitivity to imidacloprid increased by 1.95 times, indicating that the gene-targeted nanopesticide we constructed can significantly improve the sensitivity of resistant cotton aphid strains to insecticides.

[0036] 2) Based on the recommended field dosage of imidacloprid (75 mg L / L) -1 Gene-targeted nanopesticides were constructed. Cotton seedlings with a growth cycle of 25-30 days and four true leaves were selected. Each cotton seedling was inoculated with 120 aphids. Each plant was treated by spraying 2 mL of aphids. Each treatment was repeated 6 times. The mortality rate of cotton aphids was observed daily and the control effect was calculated.

[0037] The results are as follows ​ As shown, gene-targeted nanopesticides RHMS / IMI / ds ​ The 5-day control efficacy against cotton aphids was 82.47%, higher than that of imidacloprid (62.52%) and RHMS / IMI / ds. ​ The percentage was 62.71%, which shows that the gene-targeted nanopesticide RHMS / IMI / ds we constructed... ​ It has a good control effect on cotton aphids.

[0038] Table 1 RHMS / IMI / ds ​ Toxicity to cotton aphids a Synergistic effect ratio = LC of insecticide 50 / LC of the processing group 50 If the 95% confidence interval of the synergy ratio does not include 1.0, it indicates a significant synergy effect.

[0039] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A targeted cotton aphid CYP6CY13 Gene co-delivery nanopesticides, characterized by: The raw materials for the co-delivered nanopesticide, by weight, include 1 part imidacloprid, 20-50 parts acetone, 0.05-0.3 parts co-delivered nanocarrier RHMS-NH2, and 0.05-0.3 parts ds CYP6CY13 ; where ds CYP6CY1 3 was extracted using the following method: The recombinant vector L4440- CYP6CY13 Host cell culture, shaken to OD 600 =0.40% IPTG was added to bring the final concentration to 1mM, and expression was induced. The cells were cultured at 37°C with shaking for 4 hours. Total RNA was extracted from the bacteria, and the purified dsRNA was obtained as dsRNA. CYP6CY13 Furthermore, the host cells are HT115 competent cells; the recombinant vector... L4440-CYP6CY13 Contains cotton aphids CYP6CY13 The gene expression vector L4440, CYP6CY13 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The targeted cotton aphid as described in claim 1 CYP6CY13 Gene co-delivery nanopesticides, characterized by: The raw materials for the co-delivered nanocarrier RHMS-NH2 include, by weight, 1 part of surface-roughened hollow mesoporous silica nanoparticles RHMS, 1 to 5 parts of 3-aminopropyltriethoxysilane, and 100 to 200 parts of toluene; The raw materials for the rough-surfaced hollow mesoporous silica nanoparticles RHMS include, by weight, 1 part tetraethyl orthosilicate, 1-2 parts resorcinol, 1-2 parts formaldehyde, 10-15 parts ammonia, 30-50 parts distilled water, and 250-300 parts anhydrous ethanol.

3. The targeted cotton aphid as described in claim 2 CYP6CY13 Gene co-delivery nanopesticides, characterized by: The raw materials for the co-delivered nanopesticide, by weight, include 1 part imidacloprid, 30 parts acetone, 0.2 parts co-delivered nanocarrier RHMS-NH2, and 0.2 parts ds CYP6CY13 ;in, The raw materials for the co-delivered nanocarrier RHMS-NH2 include, by weight, 1 part of surface-roughened hollow mesoporous silica nanoparticles RHMS, 2 parts of 3-aminopropyltriethoxysilane, and 150 parts of toluene. The raw materials for the rough-surfaced hollow mesoporous silica nanoparticles RHMS include, by weight, 1 part tetraethyl orthosilicate, 1.4 parts resorcinol, 1.96 parts formaldehyde, 12 parts ammonia, 40 parts distilled water, and 280 parts anhydrous ethanol.

4. A targeted cotton aphid as described in claim 1 or 2 CYP6CY13 A method for preparing gene-co-delivered nanopesticides, characterized in that: Includes the following steps: 1) Preparation of Rough-surfaced Hollow Mesoporous Silica Nanoparticles (RHMS) a. Weigh out 1 part tetraethyl orthosilicate, 1-2 parts resorcinol, 1-2 parts formaldehyde, 10-15 parts ammonia, 30-50 parts distilled water, and 250-300 parts anhydrous ethanol by weight ratio. b. A mixed solution is obtained by mixing distilled water, anhydrous ethanol and ammonia. A portion of resorcinol and a portion of formaldehyde are dispersed in the mixed solution and stirred at room temperature to obtain a mixed reactant. c. Add tetraethyl orthosilicate to the mixed reactants and stir to react; then add the other part of resorcinol and the other part of formaldehyde to the mixed reactants, stir to react, and collect the reaction product by centrifugation; d. The reaction product was washed multiple times with anhydrous ethanol and distilled water to remove free impurities, centrifuged to obtain a solid, dried in a vacuum drying oven, and then calcined in a muffle furnace to obtain rough-surfaced hollow mesoporous silica nanoparticles RHMS. 2) Preparation of co-delivered nanocarrier RHMS-NH2 a. Weigh out 1 part RHMS, 1-5 parts 3-aminopropyltriethoxysilane, and 100-200 parts toluene by weight, and set aside. b. RHMS, 3-aminopropyltriethoxysilane and toluene were stirred at 80°C. After the reaction was completed, the precipitate was washed with acetone several times and then dried under vacuum to obtain the co-delivered nanocarrier RHMS-NH2. 3) Co-delivery of nanopesticides RHMS / IMI / ds CYP6CY13 Preparation a. Weigh out 1 part imidacloprid, 20-50 parts acetone, 0.05-0.3 parts co-delivered nanocarrier RHMS-NH2, and 0.05-0.3 parts ds according to the following weight ratio. CYP6CY13 ; b. Imidacloprid was dissolved in acetone to obtain an acetone solution of imidacloprid. The co-delivered nanocarrier RHMS-NH2 was added to the acetone solution of imidacloprid. The mixture was stirred continuously at room temperature in the dark. After stirring, the precipitate was collected by centrifugation, washed with distilled water, and then vacuum dried to obtain the nano-pesticide RHMS / IMI. c. RHMS / IMI and ds nanopesticides CYP6CY13 Room temperature mixing yields co-delivered nanopesticides RHMS / IMI / ds CYP6CY13 .

5. The targeted cotton aphid as described in claim 4 CYP6CY13 A method for preparing gene-co-delivered nanopesticides, characterized in that: Includes the following steps: 1) Preparation of Rough-surfaced Hollow Mesoporous Silica Nanoparticles (RHMS) a. Weigh out 1 part tetraethyl orthosilicate, 1.4 parts resorcinol, 1.96 parts formaldehyde, 12 parts ammonia, 40 parts distilled water, and 280 parts anhydrous ethanol by weight ratio. b. A mixed solution was obtained by mixing distilled water, anhydrous ethanol and ammonia. 0.4 parts of resorcinol and 0.56 parts of formaldehyde were dispersed in the mixed solution and stirred at 37°C for 6 hours to obtain a mixed reactant. c. Add tetraethyl orthosilicate to the mixed reactants and stir to react; then add 1 part resorcinol and 1.4 parts formaldehyde to the mixed reactants, stir to react, and centrifuge to collect the reaction product; d. The reaction product was washed multiple times with anhydrous ethanol and distilled water to remove free impurities, centrifuged to obtain a solid, dried in a vacuum drying oven, and then calcined in a muffle furnace to obtain rough-surfaced hollow mesoporous silica nanoparticles RHMS. 2) Preparation of co-delivered nanocarrier RHMS-NH2 a. Weigh out 1 part RHMS, 2 parts 3-aminopropyltriethoxysilane, and 150 parts toluene by weight, and set aside. b. RHMS, 3-aminopropyltriethoxysilane and toluene were stirred in a vacuum at 80°C for 24 h. After the reaction was completed, the precipitate was washed with acetone several times and then dried in a vacuum at 60°C for 12 h to obtain the co-delivered nanocarrier RHMS-NH2. 3) Co-delivery of nanopesticides RHMS / IMI / ds CYP6CY13 Preparation a. Weigh out 1 part imidacloprid, 30 parts acetone, 0.2 parts co-delivered nanocarrier RHMS-NH2, and 0.2 parts ds according to the following weight ratio. CYP6CY13 ; b. Imidacloprid was dissolved in acetone to obtain an acetone solution of imidacloprid. The co-delivered nanocarrier RHMS-NH2 was added to the acetone solution of imidacloprid and stirred continuously at room temperature for 12 h under light-protected conditions. After stirring, the precipitate was collected by centrifugation, washed with distilled water, and dried under vacuum at 60 °C for 12 h to obtain the nano-pesticide RHMS / IMI. c. RHMS / IMI and ds nanopesticides CYP6CY13 The co-delivered nanopesticide RHMS / IMI / ds was obtained by mixing at room temperature for 10 min. CYP6CY13 .

6. A targeted cotton aphid as described in claim 1 CYP6CY13 Application of gene co-delivery nanopesticides in the control of cotton aphids.

Images