Wheat molecular marker Qphr-3A and its application in nitrogen efficient breeding
The wheat SNP site 3363 was discovered through GWAS and KASP primers were developed, which solved the problem of low nitrogen utilization efficiency in wheat, achieved efficient screening and identification of nitrogen-efficient wheat materials, increased grain yield and nitrogen accumulation, and supported wheat breeding.
Patent Information
- Application Number
- CN202310760812.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-27
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2043-06-27
AI Technical Summary
Existing technologies make it difficult to effectively improve wheat nitrogen use efficiency (NUE), resulting in low fertilizer utilization and affecting the effect of increasing grain production.
Through genome-wide association analysis (GWAS), SNP site 3363 was discovered in wheat germplasm resources, and a KASP-specific primer combination was developed to detect the Qphr-3A molecular marker and screen out nitrogen-efficient haplotype wheat materials.
It has achieved efficient screening and identification of nitrogen utilization efficiency of wheat materials, significantly improved grain yield, grain nitrogen accumulation and nitrogen harvest index, and supported nitrogen-efficient molecular breeding of wheat.
Smart Images

Figure CN116622895B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of biotechnology, and relates to a wheat molecular marker Qphr-3A and application thereof in nitrogen-efficient breeding. BACKGROUND
[0002] In the past 50 years, the amount of nitrogen fertilizer applied in global crop production has increased by more than 20 times, and is expected to increase by 3 times by 2050. The problem of high fertilizer inefficiency is prominent in crop production. Since the 1990s, the effect of increased fertilizer application on grain yield increase has not been significant, and fertilizer utilization rate has decreased year by year. Genotype, environment and cultivation management measures jointly affect the nitrogen use efficiency (NUE) of crops, so the main measures to improve NUE include reasonable water and fertilizer management, promotion of efficient new fertilizers, soil fertility improvement, wheat variety genetic improvement, etc., and improving wheat NUE through genetic improvement is the most effective and sustainable solution.
[0003] NUE is a process controlled by complex multi-gene networks of nitrogen uptake, assimilation and transport, and is influenced by the environment. In the study of genes related to nitrogen uptake in wheat, researchers found a gene TaNRT2.1-6B that affects wheat NUE. This gene is a dual-affinity nitrate transporter gene that mainly affects the process of nitrogen uptake (Li M, Wang T, Zhang H, Liu S, Li W, Abou Elwafa SF and Tian H (2022) TaNRT2.1-6B is a dual-affinity nitrate transporter contributing to nitrogen uptake in bread wheat under both nitrogen deficiency and sufficiency. The Crop Journal 10:993-1005.). In addition, researchers have found that TaNAC2-5A is a transcription factor induced by nitrate, which not only positively regulates the growth of wheat roots, but also positively regulates the expression of multiple TaNRT2 genes, enhances the rate of nitrate nitrogen uptake by wheat roots, and is involved in regulating the long-distance transport of nitrate nitrogen in wheat, thus increasing the nitrate content of the grain and seed vigor (Li W, He X, Chen Y, Jing Y, Shen C, Yang J, Teng W, Zhao X, Hu W, Hu M, Li H, Miller AJ and Tong Y (2020) A wheat transcription factor positively sets seed vigour by regulating the grain nitrate signal. NEW PHYTOL 225:1667-1680.); in the study of genes related to nitrogen assimilation in wheat, researchers transformed wheat with the excellent allelic variation TaGS2-2Ab and found that the yield, nitrogen uptake capacity and nitrogen harvest index were significantly higher than those of the wild type under different nitrogen levels (Hu M, Zhao X, Liu Q, Hong X, Zhang W, Zhang Y, Sun L, Li H and Tong Y (2018) Transgenic expression of plastidic glutamine synthetase increases nitrogen uptake and yield in wheat. PLANT BIOTECHNOL J 16:1858-1867.).
[0004] Therefore, it is of great significance to breed new wheat varieties with high yield, green and high efficiency by exploring the genes related to NUE and developing the corresponding molecular markers for wheat nitrogen efficient molecular breeding. SUMMARY
[0005] The application detects a significant SNP site 3363 with stable expression and a phenotype effect value greater than 10% by performing whole genome association analysis (GWAS) on the collected 244 wheat germplasm resources NUE related trait phenotypes combined with 660K SNP chip genotyping information. The corresponding KASP specific primer combination is developed based on the SNP polymorphism of the site, and the excellent haplotype is determined combined with the NUE related phenotype. The KASP specific primer combination can provide technical support for wheat nitrogen efficient molecular breeding.
[0006] The application can be implemented by the following technical solutions:
[0007] The application finds that there is a nitrogen efficient dominant haplotype by combining the haplotype of SNP allelic variation with the correlation analysis of NUE related traits. In the reference genome Chinese Spring v1.0, there is a SNP at 67365306 of chromosome 3AL, specifically A / G. In order to apply the SNP allelic variation to all wheat germplasm resources, the SNP is represented as SEQ ID NO: 1, the SNP is located at the 51st base of the sequence, and the SNP site is named as molecular marker Qphr-3A.
[0008] SEQ ID NO: 1 is
[0009] AGAACCATCTCAACCAAACGTTTTTGTTGTCTAATATGAAGCGATCAACT N TTTTGAACT CGTTGTCTTCAACTACCAGCGCATATCCAATATCTTTTGCA, wherein N is A / G.
[0010] When the wheat material carries the SNP genotype GG detected by the above Qphr-3A molecular marker, it shows a nitrogen efficient type, and the grain yield (GY, g·m -2 ), the grain nitrogen accumulation amount (NAA, g·m -2 ) and the nitrogen harvest index (NHI, %) are significantly higher than those of the wheat material carrying the SNP site AA.
[0011] The application provides a set of KASP specific primers or a kit for detecting the molecular marker Qphr-3A.
[0012] The complete primer set comprises two upstream primers and one downstream primer, the upstream primers are designed according to the SNP at position 51 of the base sequence shown in SEQ ID NO: 1 and the sequence upstream thereof, wherein the 3' end of one upstream primer is A and the 3' end of the other upstream primer is G; the downstream primer is designed according to the SNP at position 51 of the base sequence shown in SEQ ID NO: 1 and the sequence downstream thereof.
[0013] The KASP specific primer sequence is as follows:
[0014] The primer Qphr-3A-F1 is shown in SEQ ID NO: 2;
[0015] The primer Qphr-3A-F2 is shown in SEQ ID NO: 3;
[0016] The primer Qphr-3A-R is shown in SEQ ID NO: 4.
[0017] Qphr-3A-F1: 5'-GAAGGTCGGAGTCAACGGATTTAATATGAAGCGATCAACTA-3';
[0018] Qphr-3A-F2: 5'-GAAGGTGACCAAGTTCATGCTTAATATGAAGCGATCAACTG-3';
[0019] Qphr-3A-R: 5'-GCGCTGGTAGTTGAAGACAA-3'.
[0020] In the embodiments, the specific fluorescent tag sequence A is HEX (red) as shown in SEQ ID NO: 5, and the specific fluorescent tag sequence G is FAM (blue) as shown in SEQ ID NO: 6:
[0021] The specific fluorescent tag sequence HEX is 5'-GAAGGTCGGAGTCAACGGATT-3';
[0022] The specific fluorescent tag sequence FAM is 5'-GAAGGTGACCAAGTTCATGCT-3'.
[0023] The application provides the application of the above-mentioned Qphr-3A molecular marker and KASP primer in the following aspects:
[0024] (a) breeding or screening wheat strains, lines or varieties with higher nitrogen utilization rate;
[0025] (b) identifying or assisting in identifying or comparing the nitrogen utilization rate of the wheat material to be tested;
[0026] (c) preparing a product for identifying or assisting in identifying or comparing nitrogen utilization efficiency of the wheat material to be tested;
[0027] (d) preparing a product for breeding or screening wheat lines, strains or varieties with higher nitrogen utilization efficiency;
[0028] In some embodiments, the specific operation steps are as follows: PCR reaction is performed on the genomic DNA of the wheat material to be tested using the KASP specific primer described above, and the fluorescence color of the PCR amplification product is read to determine whether the 51st base pair of the sequence shown in SEQ ID NO: 1 on chromosome 3AL in the sample material genome corresponds to the genotype AA, GG or AG.
[0029] If the fluorescence of the PCR amplification product to be tested shows red, it represents that the detection genotype is AA;
[0030] If the fluorescence of the PCR amplification product to be tested shows blue, it represents that the detection genotype is GG;
[0031] If the fluorescence of the PCR amplification product to be tested shows green, it represents that the detection genotype is AG;
[0032] In some embodiments, the wheat material is selected to design a general PCR specific primer for amplification according to the sequence shown in SEQ ID NO: 1, and the PCR amplification product is sequenced and compared. The primer pair is as follows:
[0033] The upstream primer F3 is shown in SEQ ID NO: 7;
[0034] The downstream primer R is shown in SEQ ID NO: 4.
[0035] Qphr-3A-F3: 5'-TTGTCTAATATGAAGCGATCAACT-3';
[0036] Qphr-3A-R: 5'-GCGCTGGTAGTTGAAGACAA-3'.
[0037] The PCR amplification product with genotype GG is named Qphr-3A GG (nitrogen efficient haplotype), the sequence of which is shown in SEQ ID NO: 8; and the PCR amplification product with genotype AA is named Qphr-3A AA (nitrogen inefficient haplotype), the sequence of which is shown in SEQ ID NO: 9. The sequence is as follows:
[0038] Qphr-3A GG :
[0039] 5'-TTGTCTAATATGAAGCGATCAACTGTTTTGAACTCGTTGTCTTCAACTACCAGCGC-3',
[0040] Qphr-3A AA :
[0041] 5'-TTGTCTAATATGAAGCGATCAACTATTTTGAACTCGTTGTCTTCAACTACCAGCGC-3'.
[0042] The beneficial effects of the present application are:
[0043] The present application screens and identifies a new site Qphr-3A affecting the NUE of wheat materials, which is significantly related to the NUE of wheat. Preliminary analysis results show that the GY, NAA and NHI of wheat materials carrying the GG genotype are significantly higher than those carrying the AA genotype. Based on the allelic variation of the SNP site, combined with the KASP technology, the present application develops a specific primer set and its kit for identifying the site. The specific primer set and its kit of the present application can be used to detect the relative NUE of the wheat strains, lines or varieties to be tested, and to identify and screen the wheat materials, thereby providing technical support for the molecular marker assisted breeding or molecular breeding of wheat nitrogen efficient. BRIEF DESCRIPTION OF DRAWINGS
[0044] Figure 1 Genotype typing results of Qphr-3A site in 244 wheat materials. The red dot represents the genotype AA, the blue dot represents the genotype GG, the green dot represents the genotype AG, and the black dot represents the no DNA template control.
[0045] Figure 2 Manhattan plot drawn by the intermediate file detected on chromosome 3A based on the whole gene association analysis method IIIVmrMLM.
[0046] Figure 3 Sequence alignment diagram of PCR amplification product of nitrogen efficient and nitrogen inefficient materials (a); Blast alignment results of sequence of PCR amplification product of nitrogen efficient material on reference genome (b); Blast alignment results of sequence of PCR amplification product of nitrogen efficient material on reference genome (c).
[0047] Figure 4 Nitrogen efficient genotype Qphr-3A GG and nitrogen inefficient haplotype Qphr-3A AA Box plot of grain yield (GY), nitrogen accumulation amount of aboveground part per unit area (NAA) and nitrogen harvest index (NHI) under different nitrogen treatments (normal nitrogen treatment HN, low nitrogen treatment LN). DETAILED DESCRIPTION
[0048] The application will be described in more detail below through specific embodiments, so as to facilitate the understanding of the technical solutions of the application, but not for limiting the protection scope of the application.
[0049] 1. Wheat germplasm resources and phenotype determination
[0050] The wheat germplasm resources involved in the following examples are provided by the molecular breeding team of Henan Crop Molecular Breeding Research Institute, including 244 wheat germplasm resources (see Table 2 for details).
[0051] It needs to be further explained that as a professional agricultural research institution, the applicant has a long-term preservation library of wheat germplasm resources, and the related wheat varieties (germplasm) can be publicly obtained from the market or the germplasm resource library.
[0052] The related wheat test materials are all planted in the Henan Modern Agricultural Test Demonstration Base (Yuanyang, Henan), and normal N treatment and low N treatment are set. The plant height and the number of spikes per unit area are determined about 20 days after flowering, and the sample section is taken and harvested at the mature stage to determine the yield, and the sample is used for subsequent dry weight determination and other analysis.
[0053] Using the determined plant height, the number of spikes per unit area and yield, the ratio data of these three traits under low N / normal N treatment in each year, i.e. effective spike number ratio (EPNR), plant height ratio (PHR) and yield ratio (YPPR), are calculated, and the obtained data is further normalized. The above obtained phenotype data is used for subsequent genome-wide association analysis (GWAS) analysis; further using CN analyzer (Vario Micro Cube, Elementar) to determine the nitrogen content of the sample, the grain nitrogen accumulation (GNA), the above-ground nitrogen accumulation (NAA) and the nitrogen harvest index (NHI) are obtained by calculation, which are used for subsequent haplotype site verification.
[0054] 2. Significant sites detected by GWAS
[0055] The natural population of 244 wheat germplasm resources used for association analysis is scanned by wheat 660K SNP chip (Zhongyu Jinbiotechnology (Beijing) Co., Ltd.) to determine the genotype information. The genotyping results are quality controlled to obtain 203224 SNP markers. The population structure is estimated by STRUCTURE2.3.4 software, and the Q matrix is calculated; the principal component analysis is performed by Plink 1.07; the linkage disequilibrium analysis LD is analyzed by PopLDdecay 3.4.1 software; the phylogenetic tree analysis is performed by phylip 3.698.
[0056] GWAS analysis was performed by using the mixed linear model (MLM) of R package IIIVmrMLM, with the significant threshold set as LOD≥3 (P≤2×10 -4 ) based on the phenotypic data of effective panicle number ratio (EPNR), plant height ratio (PHR) and yield per plant ratio (YPPR), the best linear unbiased prediction (BLUP) and the population structure Q matrix as a covariate.
[0057] The GWAS analysis results showed that 12 significant SNP loci were detected, and the stable genetic locus 3363 on chromosome 3A was detected by PHR. The single-environment method showed that the contribution rate (R 2 ) of the locus to the phenotype was 14.47% (2018) and 16.59% (BLUP), respectively. The multi-environment method showed that the contribution rate (R 2 ) of the locus to the phenotype was 1.66% ( Figure 2 ).
[0058] The significant SNP locus 3363 was named as molecular marker Qphr-3A.
[0059] 3. Development of KASP-specific primers and haplotype analysis
[0060] Based on the SNP polymorphism and the principle of KASP technology, the KASP-specific primers were designed by using the full-length sequence of 50 bp flanking the molecular marker Qphr-3A.
[0061] The full-length base sequence of 50 bp flanking the molecular marker Qphr-3A used for designing the KASP-specific primers is as follows:
[0062]
[0063] The KASP-specific primers were synthesized by Shanghai Generay Biotech Co., Ltd. The primer sequences are as follows:
[0064] Qphr-3A-F1: 5'-TAATATGAAGCGATCAACTA-3' (SEQ ID NO: 2), wherein the partial sequence of 5'-GAAGGTCGGAGTCAACGGATT-3' is the specific fluorescent tag sequence of HEX. GAAGGTCGGAGTCAACGGATT Qphr-3A-F2: 5'-TAATATGAAGCGATCAACTG-3' (SEQ ID NO: 3), wherein the partial sequence of 5'-GAAGGTGACCAAGTTCATGCT-3' is the specific fluorescent tag sequence of FAM.
[0065] GAAGGTGACCAAGTTCATGCT Qphr-3A-F2: 5'-TAATATGAAGCGATCAACTG-3' (SEQ ID NO: 3), wherein the partial sequence of 5'-GAAGGTGACCAAGTTCATGCT-3' is the specific fluorescent tag sequence of FAM.
[0066] Qphr-3A-R: 5'-GCGCTGGTAGTTGAAGACAA-3' (SEQ ID NO: 4).
[0067] The KASP reaction system was operated according to the instructions in the KASP TF V4.0 2xMaster Mix kit, and the mixing ratio of KASP Assay Mix (100 mM), F1 Primer: F2 Primer: R Primer: ddH2O was 12:12:30:46.
[0068] 5mL reaction system: 2.5mL gDNA template (50-100ng.mL -1 ); 2.5mL 2xKASP Master Mix; 0.07mL KASP Assay Mix.
[0069] The PCR reaction was performed in the LGC Hydrocycler instrument, and the reaction program was set as follows:
[0070] Table 1 PCR reaction program setting conditions
[0071]
[0072] After the PCR reaction, the fluorescence color was read in the OMEGA software of the Fluostar Omega SNP, and the KASP typing results were viewed by the KlusterCaller software.
[0073] According to the above operation steps, 244 wheat germplasm resources were genotyped using the KASP specific primer of Qphr-3A Figure 1 , and the specific genotyping results are shown in Table 2.
[0074] According to the genotyping results of 244 wheat germplasms and the corresponding GY, NAA and NHI three NUE-related trait phenotype data, correlation analysis and significance T test were performed, and the results showed that the wheat materials carrying haplotype Qphr-3A GG The GY, NAA and NHI of the wheat materials carrying haplotype Qphr-3A AA Figure 4 This indicates that the specific KASP specific primer developed based on Qphr-3A can distinguish nitrogen-efficient and nitrogen-inefficient materials.
[0075] Among them, blue represents nitrogen-efficient haplotype Qphr-3A GG , containing 98 materials;
[0076] Red represents nitrogen-inefficient haplotype Qphr-3A AA , comprising 137 parts of material.
[0077] Table 2 SNP genotyping of 244 parts of material
[0078]
[0079]
[0080]
[0081] Note: The same name different species of the material has been marked out the source of the table, NN represents not detected.
[0082] 4. PCR detection and sequencing comparison of amplification products
[0083] According to the above-mentioned flanking sequence of molecular marker Qphr-3A and the KASP upstream and downstream primer sequence characteristics of Qphr-3A, the PCR specific primer for amplifying part of the base sequence of molecular marker Qphr-3A is designed, and the primer sequence is shown as SEQ ID NO: 4 and SEQ ID NO: 7. The PCR amplification primer is synthesized by Shanghai SunGene Biotech Co., Ltd.
[0084] The primer Qphr-3A-F3 is shown as SEQ ID NO: 7;
[0085] The primer Qphr-3A-R is shown as SEQ ID NO: 4.
[0086] Qphr-3A-F3: 5'-TTGTCTAATATGAAGCGATCAACT-3';
[0087] Qphr-3A-R: 5'-GCGCTGGTAGTTGAAGACAA-3'. The sequence size of the amplification product is 54bp.
[0088] A 50μL reaction system (Table 3) is established by using Tks Gflex DNA Polymerase (TaRaKa) high-fidelity enzyme and specific PCR primer. The PCR amplification conditions are as follows: 94℃, 1min; (98℃, 10s; 55℃, 15s; 68℃, 30s) × 30 cycles; 72℃, 10min.
[0089] The PCR amplification product is electrophoresed by 3% agarose gel in 1×TBE electrophoresis buffer, stained with DNA green nucleic acid stain, and photographed on Bio-Rad gel imaging system for observation.
[0090] Table 3 PCR reaction system
[0091] Component Volume 2x Gflex PCR buffer 25 μL F3 Primer (100 μM) 1.5 μL R Primer (100 μM) 1.5 μL gDNA template 2.0 μL Tks Gflex DNA Polymerase 1.0 μL dd H2O 19 μL Total volume 50 μl
[0092] Based on the above PCR reaction system and conditions, the specific PCR primers designed above were used to amplify two materials carrying nitrogen-efficient (Aikang 58 and Zhengmai 1354) and nitrogen-inefficient (Baiquan 41 and Yubianmai) haplotypes and analyze them by agarose gel electrophoresis. After confirming that the target band was 54 bp, the PCR reaction solution was subjected to T / A cloning sequencing (Shanghai Shenggong Biotechnology Co., Ltd.).
[0093] Sequencing results showed that the PCR reaction was successful in the nitrogen efficient haplotype Qphr-3A GG The amplified products in the materials (Aikang 58 and Zhengmai 1354) are:
[0094] 5'-TTGTCTAATATGAAGCGATCAACTGTTTTGAACTCGTTGTCTTCAACTACCAGCGC-3';
[0095] PCR reaction in nitrogen-inefficient haplotype Qphr-3A AA The amplified product in the materials (Baiquan 41 and Yubianmai) was: 5'-TTGTCTAATATGAAGCGATCAACTATTTTGAACTCGTTGTCTTCAACTACCAGCGC-3'.
[0096] The PCR amplified sequences of Aikang 58 and Zhengmai 1354, Baiquan 41 and Yubianmai were further compared using DNAMAN software ( Figure 3 a), it can be seen that there is an A / G base difference at position 25 of the amplified product, which is consistent with the KASP molecular marker detection result of Qphr-3A, indicating the effectiveness and usability of this marker.
[0097] The PCR amplified sequences of Aikang 58 and Zhengmai 1354, Baiquan 41 and Yubianmai were aligned with the whole genome sequence of the Chinese Spring reference genome v1.0 using the WheatOmics 1.0 website (http: / / 202.194.139.32 / blast / blast.html). Figure 3 b, c), it can be seen that the sequence of the nitrogen-low-efficiency material is completely consistent with the sequence of the Chinese Spring genome on chromosome 3A; while the sequence of the nitrogen-efficient material has a variation in base 25 compared with the sequence of the Chinese Spring genome on chromosome 3A.
[0098] The embodiments described above are only preferred embodiments of the present invention and do not limit the scope of implementation of the present invention. Therefore, any equivalent changes or modifications made according to the structure, characteristics and principles described in the patent scope of the present invention should be included in the scope of the patent application of the present invention.
Claims
1. Use of KASP-specific primers for detecting wheat molecular marker Qphr-3A in any of the following items, characterized in that: (a) Breeding or selecting wheat lines, strains or varieties with higher nitrogen use efficiency; (b) identifying or assisting in the identification or comparing the nitrogen use efficiency of the tested wheat materials; (c) preparing products for identifying or assisting in identifying or comparing the nitrogen utilization efficiency of wheat materials to be tested; (d) preparing products for breeding or screening wheat lines, strains or varieties with improved nitrogen use efficiency; The wheat molecular marker Qphr-3A is a SNP molecular marker located on wheat chromosome 3AL, and the SNP site of the SNP molecular marker is located at the 51st base of the sequence shown in SEQ ID NO: 1; wherein N is A or G; The KASP-specific primers include: Qphr-3A-F1: 5'-GAAGGTCGGAGTCAACGGATTTAATATGAAGCGATCAACTA-3'; Qphr-3A-F2: 5'-GAAGGTGACCAAGTTCATGCTTAATATGAAGCGATCAACTG-3'; Qphr-3A-R: 5'-GCGCTGGTAGTTGAAGACAA-3'; Specific fluorescent tag sequence HEX: 5'-GAAGGTCGGAGTCAACGGATT-3'; Specific fluorescent tag sequence FAM: 5′-GAAGGTGACCAAGTTCATGCT-3′; Using the KASP-specific primers to perform a PCR reaction on the genomic DNA of the wheat material to be tested, and reading the fluorescent color of the PCR amplification product to determine whether the genotype corresponding to the 51st base of the sequence shown in SEQ ID NO: 1 on chromosome 3AL in the genome of the sample material is AA, GG, or AG; When the SNP site genotype of the wheat material is GG, it exhibits nitrogen high efficiency, and its grain yield, grain nitrogen accumulation and nitrogen harvest index are significantly higher than those of the wheat material with the SNP site genotype of AA.
2. Use of a kit for detecting wheat molecular marker Qphr-3A in any of the following items, characterized in that: (a) Breeding or selecting wheat lines, strains or varieties with higher nitrogen use efficiency; (b) identifying or assisting in the identification or comparing the nitrogen use efficiency of the tested wheat materials; The wheat molecular marker Qphr-3A is a SNP molecular marker located on wheat chromosome 3AL, and the SNP site of the SNP molecular marker is located at the 51st base of the sequence shown in SEQ ID NO: 1; wherein N is A or G; The kit contains KASP specific primers, which include: Qphr-3A-F1: 5'-GAAGGTCGGAGTCAACGGATTTAATATGAAGCGATCAACTA-3'; Qphr-3A-F2: 5'-GAAGGTGACCAAGTTCATGCTTAATATGAAGCGATCAACTG-3'; Qphr-3A-R: 5'-GCGCTGGTAGTTGAAGACAA-3'; Specific fluorescent tag sequence HEX: 5'-GAAGGTCGGAGTCAACGGATT-3'; Specific fluorescent tag sequence FAM: 5′-GAAGGTGACCAAGTTCATGCT-3′; Using the KASP-specific primers to perform a PCR reaction on the genomic DNA of the wheat material to be tested, and reading the fluorescent color of the PCR amplification product to determine whether the genotype corresponding to the 51st base of the sequence shown in SEQ ID NO: 1 on chromosome 3AL in the genome of the sample material is AA, GG, or AG; When the SNP site genotype of the wheat material is GG, it exhibits nitrogen high efficiency, and its grain yield, grain nitrogen accumulation and nitrogen harvest index are significantly higher than those of the wheat material with the SNP site genotype of AA.
3. A method for identifying nitrogen utilization efficiency of wheat, characterized in that: Using the KASP-specific primers described in claim 1 to perform a PCR reaction on the genomic DNA of the wheat material to be tested, and reading the fluorescent color of the PCR amplification product to determine whether the genotype corresponding to the 51st base of the sequence shown in SEQ ID NO: 1 on chromosome 3AL in the genome of the sample material is AA, GG, or AG; The wheat material with the GG genotype showed high nitrogen efficiency, and its grain yield, grain nitrogen accumulation and nitrogen harvest index were significantly higher than those of the wheat with the AA SNP site. or: The genomic DNA of wheat materials was subjected to PCR reaction using primers Qphr-3A-F3 and Qphr-3A-R. The wheat material with the amplification product of 5'-TTGTCTAATATGAAGCGATCAACTGTTTTGAACTCGTTGTCTTCAACTACCAGCGC-3' was a nitrogen-efficient type, and its grain yield, grain nitrogen accumulation and nitrogen harvest index were significantly higher than those of the wheat material with the amplification product of 5'-TTGTCTAATATGAAGCGATCAACTATTTTGAACTCGTTGTCTTCAACTACCAGCGC-3'. The sequences of primers Qphr-3A-F3 and Qphr-3A-R are: Qphr-3A-F3: 5'-TTGTCTAATATGAAGCGATCAACT-3'; Qphr-3A-R: 5'-GCGCTGGTAGTTGAAGACAA-3'.
Citation Information
Patent Citations
Gene capable of increasing nitrogen fertilizer utilization efficiency and yield of rice and application thereof
CN107937416A
Wheat low-affinity nitrate salt transporter gene TaNPF7.6-1A allelic variation KASP marker and application thereof
CN116179754A