A titanium-based material with a ROS-responsive polydopamine / naringenin coating, its preparation method and application

By constructing DNAzyme nanoflower structure and ROS-responsive polydopamine/napperin coating on the surface of titanium-based materials, the problem of insufficient osseous integration in patients with osteoporosis was solved, and the effect of significantly improving the osseous integration efficiency in patients with osteoporosis was achieved.

CN116637236BActive Publication Date: 2025-07-01CHONGQING UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310603137.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-25
Publication Date
2025-07-01
Estimated Expiration
2043-05-25

AI Technical Summary

Technical Problem

Inadequate osteointegration in patients with osteoporosis is the main reason for the failure of orthopedic surgery. The existing technology has limited application under osteoporosis pathological conditions, and it is urgent to develop titanium surface modification methods that can improve osteointegration in patients with osteoporosis.

Method used

By constructing DNAzyme nanoflower structures on the surface of titanium-based material, the protein expression of STING is significantly reduced, combined with ROS-responsive polydopamine/napperin coating, promoting H-type angiogenesis and osteointegration.

Benefits of technology

The bone integration efficiency of osteoporosis patients is significantly improved, and the blood vessels and new bone formation around the implant is enhanced by promoting H-type vascularization and osteogenic differentiation of bone-related cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116637236B_ABST
    Figure CN116637236B_ABST
Patent Text Reader

Abstract

The present invention relates to a titanium-based material with a ROS-responsive polydopamine / naringenin coating, a preparation method thereof, and an application thereof, belonging to the technical field of the preparation of functionalized titanium-based materials. In the present invention, DNA nanoflowers (DNFzn) complexed with ZnO and a ROS-responsive polydopamine / naringenin coating (PDA-Nar) are sequentially coated on the surface of an amino-functionalized titanium sheet. The titanium-based material (Ti / DNFzn / PDA-Nar) with a ROS-responsive polydopamine / naringenin coating on the surface can drive endothelial cell migration in the high-ROS environment of osteoporosis, increase the formation of H-type blood vessels, and promote new bone formation at the fracture site through the molecular communication between H-type endothelial cells and bone-related cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of the preparation of titanium-based materials, and relates to a titanium-based material with a ROS-responsive polydopamine / naringenin coating, a preparation method thereof, and an application thereof. Background Art

[0002] Titanium and its alloys are widely used in surgical operations due to their good biocompatibility. However, due to the reduced osteogenic ability caused by some bone degenerative diseases, insufficient bone integration between bone tissue and implant materials is the main reason for the failure of orthopedic surgeries. A large number of surface modification strategies have been used to increase bone integration between bone tissue and implant materials (such as plasma spraying, magnetron sputtering, and layer-by-layer self-assembly, etc.). The purpose of these modification methods is mainly to increase the osteogenic differentiation of bone-related cells. However, the application of these simple modification methods under osteoporotic pathological conditions is very limited because the osteoblast activity of osteoporotic patients is low and the osteoclast activity is strong. Therefore, there is an urgent clinical need to develop a titanium surface modification method that can improve bone integration in osteoporotic patients.

[0003] The skeletal system contains a large number of highly differentiated type H blood vessels, which provide oxygen, nutrients, hormones, and growth factors for all cells in the bone, and at the same time remove the metabolic wastes of cells. More importantly, type H blood vessels can transport a variety of osteogenic signal factors to the injury site, regulate the osteogenic differentiation of perivascular osteoprogenitor cells, and accelerate fracture healing. Therefore, type H blood vessels are crucial in the process of bone repair. However, in degenerative bone disease models such as osteoporosis and osteoarthritis, the number of type H blood vessels in the bone and the expression of angiogenesis-related factors such as HIF-1α and VEGF are significantly reduced. Studies have confirmed that increasing the abundance of type H blood vessels during fracture repair can effectively promote fracture healing, which may be related to the close communication between type H endothelial cells and surrounding pre-osteoblasts. This provides a new target for the treatment of osteoporosis-related fracture diseases.

[0004] NO is a gaseous free radical produced by endothelial nitric oxide synthase and is also a ubiquitous second messenger in various physiological reactions. It can rapidly cross the cell membrane and regulate various physiological functions of the vascular system. Recently, Huang et al. designed a system of cell-like nanoparticles for the sustained release of NO and secreted factors to synergistically promote angiogenesis. Chai et al. demonstrated that the activation of the STING signaling pathway continuously stimulates the inflammatory response at the injury site, hinders the formation of H-type blood vessels, and further delays bone healing, thus providing a new perspective of inhibiting the expression of SITNG to promote the formation of H-type blood vessels. In recent decades, DNA nanotechnology has developed rapidly, and the post-transcriptional modification of target genes has provided new strategies for the preparation of intelligent controlled-release materials. In 1994, Gerald Joyce discovered deoxyribozyme (DNAzyme), which is a single-stranded DNA sequence that can precisely cleave target genes or mimic the functions of some nucleases in the presence of cofactors (such as Zn 2+ 、Ca 2+ 、Mg 2+ ions, etc.). According to the different catalytic functions of DNAzyme, it can be divided into 5 categories: DNAzyme with RNA cleavage activity (rDNAzyme), DNAzyme with DNA cleavage activity (dDNAzyme), DNAzyme with ligase function, DNAzyme with peroxidase activity, and DNAzyme that modifies thymine dimers. However, the low uptake of nucleic acid drugs by cells seriously hinders the clinical application of DNAzyme. Inspired by DNA amplification technology, rolling circle amplification can amplify a long DNA tandem with repetitive sequences around a circular template DNA, and then form DNA-inorganic hybrid DNA nanoflowers (DNF) through self-assembly during the amplification process. This nanoflower can not only promote endocytosis but also resist degradation by nucleases in the physiological environment.

[0005] Based on this, it is necessary to combine RCA technology and electrostatic assembly to study the construction of DNAzyme nanoflower structures on the surface of titanium materials, significantly reduce the protein expression of STING, and sequentially solve the problem of low abundance of H-type blood vessels at the osteoporotic fracture site, effectively promoting the bone integration efficiency of implants. Summary of the Invention

[0006] In view of this, one of the objectives of the present invention is to provide a titanium-based material with a ROS-responsive polydopamine / naringenin coating; the second objective of the present invention is to provide a preparation method of a titanium-based material with a ROS-responsive polydopamine / naringenin coating; the third objective of the present invention is to provide the application of a titanium-based material with a ROS-responsive polydopamine / naringenin coating in the preparation of bone implant materials.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] 1. A titanium-based material with a ROS-responsive polydopamine / naringenin coating, wherein the titanium-based material sequentially includes an aminated titanium sheet, DNF complexed with ZnO (DNFzn), and a ROS-responsive polydopamine / naringenin coating (PDA-Nar) from the inside to the outside;

[0009] The DNF complexed with ZnO (DNFzn) is obtained by static adsorption of DNA nanoflowers (DNF) and amino-functionalized ZnO quantum dots, wherein the DNA nanoflowers (DNF) are formed by complexing the base sequence of SEQ ID NO.1 after n cycles of amplification with x nucleic acid aptamers of SEQ ID NO.3, where n and x are both integers greater than or equal to 1.

[0010] Preferably, the DNA nanoflowers (DNF) are prepared as follows: Place a 5'-phosphorylated DNA template, T4 DNA ligase, and RCA amplification primers at 10 - 30 °C and react overnight; then maintain at 60 - 95 °C for 10 - 30 min to inactivate the T4 DNA ligase, slowly cool to 10 - 30 °C and add deoxynucleoside triphosphates (dNTP) and phi29 DNA polymerase, react at 10 - 30 °C for 6 - 12 h, then heat at 80 - 95 °C for 10 - 20 min to inactivate the phi29 DNA polymerase, and then centrifuge at 8000 - 12000 rpm, wash the precipitate twice with deionized water to obtain DNA nanoparticles; finally, disperse the DNA nanoparticles and nucleic acid aptamers (Apt) with endothelial cell targeting function in deionized water, heat at 55 - 65 °C for 10 - 30 min and then slowly cool to room temperature to obtain DNA nanoflowers (DNF);

[0011] Wherein the DNA template is a phosphate group connected to the 5' end of the base sequence of SEQ ID NO.1, the base sequence of the RCA amplification primer is as described in SEQ ID NO.2, the DNA nanoparticles are formed after n cycles of amplification of the base sequence of SEQ ID NO.1, where n is an integer greater than or equal to 1, and the nucleotide sequence of the nucleic acid aptamer (Apt) with endothelial cell targeting function is as described in SEQ ID NO.3.

[0012] More preferably, the ratio of the 5'-phosphorylated DNA template, T4 DNA ligase, RCA amplification primer, deoxynucleoside triphosphates, and phi29 DNA polymerase is 5 - 10:20 - 40:10 - 20:1 - 5:1 - 5, μM:U / μL:μM:mM:U / μL;

[0013] The molar ratio of the DNA nanoparticles to the nucleic acid aptamer (Apt) with endothelial cell targeting function is 1:20 to 1:50.

[0014] Preferably, the amino-functionalized ZnO quantum dots are prepared as follows: Zinc acetate dihydrate is ultrasonically dispersed in methanol, and a methanol solution of potassium hydroxide is added dropwise with stirring. After stirring and centrifugation, the precipitate is collected, and the ZnO quantum dots can be obtained by washing the particles twice with a methanol solution. Then, the ZnO quantum dots are dispersed in ethanol, and an aminopropyltriethoxysilane solution (APTES) is added for reflux reaction. After washing twice with ethanol, vacuum drying can obtain the amino-functionalized ZnO quantum dots.

[0015] More preferably, the concentration of potassium hydroxide in the methanol solution of potassium hydroxide is 0.2 - 0.45 M, and the mass-to-volume ratio of zinc acetate dihydrate to the methanol solution of potassium hydroxide is 0.9 - 2.0:10 - 20, g:mL;

[0016] In the stirring and centrifugation, the stirring time is 1 - 3 h and the centrifugation speed is 8000 - 12000 rpm;

[0017] The mass concentration of aminopropyltriethoxysilane in the aminopropyltriethoxysilane solution is 1 - 3%, and the mass ratio of the ZnO quantum dots to aminopropyltriethoxysilane in the aminopropyltriethoxysilane solution is 0.5 - 1:1 - 3, g:mL;

[0018] The temperature of the reflux reaction is 100 - 120 °C and the time is 6 - 10 h.

[0019] 2. The preparation method of the above titanium-based material, and the preparation method includes the following steps:

[0020] (1) Preparation of DNF complexed with ZnO (DNFzn): The DNA nanoflowers (DNF) and amino-functionalized ZnO quantum dots are dispersed in deionized water, and the oscillation reaction is carried out overnight. Then, centrifugation is carried out at a speed of 8000 - 12000 rpm, and the precipitate is collected to obtain DNF complexed with ZnO (DNFzn);

[0021] (2) Preparation of Ti / DNFzn: The amino-functionalized titanium sheet is immersed in a solution containing DNF complexed with ZnO (DNFzn) overnight, and a large amount of DNFzn is adsorbed on the surface of the amino-functionalized titanium sheet through electrostatic interaction to obtain Ti / DNFzn;

[0022] (3) Preparation of the titanium-based material (Ti / DNFzn / PDA-Nar) with a ROS-responsive polydopamine / naringenin coating (PDA-Nar) on its surface: After rinsing and drying the Ti / DNFzn, soak it overnight in a Tris solution containing ROS-responsive dopamine monomer (TK-DA) and naringenin, and then rinse it thoroughly with deionized water to obtain the titanium-based material (Ti / DNFzn / PDA-Nar) with a ROS-responsive polydopamine / naringenin coating (PDA-Nar) on its surface.

[0023] Preferably, in step (1), the mass ratio of the DNA nanoflower (DNF) to the amino-functionalized ZnO quantum dots is 1:100 to 1:600.

[0024] In step (2), the solvent of the solution of DNF containing complexed ZnO (DNFzn) is deionized water, and the concentration of DNF containing complexed ZnO (DNFzn) in the solution of DNF containing complexed ZnO (DNFzn) is 1:100.

[0025] Preferably, in step (3), the rinsing and drying specifically refer to: repeatedly rinsing with deionized water and then drying with N2.

[0026] The molar ratio of the Ti / DNFzn, the ROS-responsive dopamine monomer (TK-DA), and naringenin is 1:2 to 1:5.

[0027] The concentration of the ROS-responsive dopamine monomer in the Tris solution is 2.5 to 5 mM, and the concentration of naringenin is 3.5 to 6 mM.

[0028] Preferably, the structural formula of the ROS-responsive dopamine monomer is

[0029]

[0030] 3 Application of the above titanium-based material in the preparation of bone implant materials.

[0031] The beneficial effects of the present invention are as follows: The present invention discloses a titanium-based material with a ROS-responsive polydopamine / naringenin coating on its surface, mainly by sequentially coating DNF (DNFzn) complexed with ZnO and a ROS-responsive polydopamine / naringenin coating (PDA-Nar) on the surface of an aminated titanium sheet. The titanium-based material of the present invention has the following advantages: (1) Both dopamine monomers and naringenin contain benzene rings, which can form a tight PDA-Nar coating around DNFzn through π-π bond stacking with the deoxyribose of DNFzn, and this coating can make the binding between DNFzn and the titanium surface stronger and extend the release time of DNFzn from the titanium surface; (2) In the high-ROS environment of osteoporosis, as the ROS-responsive polydopamine (TK-PDA) coating is damaged, naringenin is released from the coating first to stimulate the eNOS expression of endothelial cells, increase NO production, and enhance angiogenesis around the implant; (3) DNFzn is released from the titanium-based material and phagocytosed by endothelial cells, and is self-catalytically cleaved into small fragment DNAs containing rDNAzyme by dDNAzyme in DNFzn in lysosomes, and then escapes from lysosomes to catalytically cleave the mRNA of STING, reducing the protein expression of STING and promoting the transformation of blood vessels into H-type blood vessels; (4) In addition, preparing a TK-PDA coating on the surface of Ti / DNFzn can further reduce the surface potential of the material and form a negatively charged interface. When this negatively charged bone material is implanted at the injury site, an endogenous electric field can be formed between it and the surrounding normal tissues to drive the migration of endothelial cells to the material surface. In summary, the titanium-based material (Ti / DNFzn / PDA-Nar) with a ROS-responsive polydopamine / naringenin coating on its surface according to the present invention can drive the migration of endothelial cells, increase the formation of H-type blood vessels, and promote the formation of new bone around the implant through molecular communication between H-type endothelial cells and bone-related cells in the high-ROS environment of osteoporosis.

[0032] Other advantages, objectives, and features of the present invention will be described to some extent in the subsequent specification, and to some extent, will be obvious to those skilled in the art based on the study of the following text, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following specification. Brief Description of the Drawings

[0033] In order to make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be described in detail preferably with reference to the accompanying drawings, where:

[0034] Figure 1Transmission electron microscope images of different materials, where A is the TEM image of ZnO quantum dots, B is the selected area electron diffraction pattern of ZnO quantum dots, C is the high-resolution TEM image of ZnO quantum dots, D is the TEM image of DNF and DNFzn, E is the scanning transmission electron microscope image of DNFzn and the corresponding EDS analysis results, F is the TEM image of DNFzn without acetate buffer treatment, G is the TEM image of DNFzn treated with acetate buffer, H is the scanning transmission electron microscope image of DNFzn / PDA-Nar and the corresponding phosphorus energy spectrum analysis results;

[0035] Figure 2 400 MHz nuclear magnetic resonance spectrometer test results of the ROS-responsive linking small molecule - dithioacetal with amino groups at both ends (H2N-TK-NH2) (A) and dopamine monomer containing ROS response (TK-DA) (B);

[0036] Figure 3 Scanning electron microscope images of different material surfaces, where various materials in the control group were not treated in any way, and various materials in the ultrasound group were treated by ultrasound;

[0037] Figure 4 Release test of naringenin and DNFzn from the surfaces of Ti / DNFzn and Ti / DNFzn / PDA-Nar materials, where A and B are Ti / DNFzn and Ti / DNFzn / PDA-Nar materials immersed in PBS buffer containing H2O2, C and D are Ti / DNFzn and Ti / DNFzn / PDA-Nar materials immersed in PBS buffer without H2O2, E and F are the absorbance values of Ti / DNFzn and Ti / DNFzn / PDA-Nar materials immersed in PBS buffer containing H2O2, G and H are the absorbance values of Ti / DNFzn and Ti / DNFzn / PDA-Nar materials immersed in PBS buffer without H2O2, I is the change in the release rate of naringenin (Nar) in different materials with incubation time, J is the change in the release rate of DNFzn in different materials with incubation time;

[0038] Figure 5 In which A is the effect of Ti / DNFzn / PDA-Nar on endothelial cell angiogenesis, and B is the effect of secretory factors of endothelial cells growing on different material surfaces on osteogenic differentiation;

[0039] Figure 6 Detection of the expression of H-type vascular marker proteins CD31 and EMCN around different materials (Ti, Ti / PDA-Nar, Ti / DNFzn, and Ti / DNFzn / PDA-Nar) used as implants by immunofluorescence staining;

[0040] Figure 7 To observe the new bone formation around the epiphyseal ends of osteoporotic rats implanted with different titanium materials (Ti, Ti / PDA-Nar, Ti / DNFzn, and Ti / DNFzn / PDA-Nar) by micro-CT, where A is the micro-CT scan image, B is the statistical chart of the amount of new bone formation around the implant, C is the statistical chart of the number of trabecular bones around the implant, and D is the statistical chart of the thickness of trabecular bones around the implant. Specific implementation mode

[0041] The following specific examples illustrate the implementation mode of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation modes. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the diagrams provided in the following examples only illustrate the basic concept of the present invention in a schematic manner. Without conflict, the following examples and the features in the examples can be combined with each other.

[0042] In the following examples, the DNA template is the phosphate group connected to the 5' end of the base sequence of SEQ ID NO.1, namely Phosphate-SEQ ID NO.1, where the base sequence of SEQ ID NO.1 is: aactagataccagctggtatccttcaacgtctaacggatagatagtggagggtttgcctcgaaccctccactatctatccgttagacagctc;

[0043] The base sequence of the primer for RCA amplification is SEQ ID NO.2: ataccagctggtatctagttgagctgtctaactgctgcgc;

[0044] The DNA nanoparticle is formed after n cycles of amplification of the base sequence of SEQ ID NO.1 (where n is an integer greater than or equal to 1);

[0045] The nucleotide sequence of the nucleic acid aptamer with endothelial cell targeting function is SEQ ID NO.3: gatgtgagtgtgtgacgagctacgacgtctggtgtatttataaagacactgtgtatatcaacaacagaacaaggaaagg;

[0046] DNA nanoflower (DNF) is formed by complexing the base sequence of SEQ ID NO.1 after n cycles of amplification with x nucleic acid aptamers of SEQ ID NO.3, specifically [(aactagataccagctggtatccttcaacgtctaacggatagatagtggagggtttgcctcgaaccctccactatctatccgttagacagctc) n (gatgtgagtgtgtgacgagctacgacgtctggtgtatttataaagacactgtgtatatcaacaacagaacaaggaaagg) x (where n and x are both integers greater than or equal to 1).

[0047] Example 1

[0048] A titanium-based material with a ROS-responsive polydopamine / naringenin coating on its surface, specifically including the following steps:

[0049] 1. Preparation of DNFzn with catalytic function

[0050] a. Ultrasonically disperse 0.9 g of zinc acetate dihydrate in methanol, and while stirring, dropwise add 20 mL of a methanol solution of potassium hydroxide (the concentration of potassium hydroxide in this solution is 0.45 M). After stirring for 1 h, centrifuge at a speed of 12000 rpm, collect the precipitate, and wash the particles twice with a methanol solution to obtain ZnO quantum dots. Then continue to disperse 0.5 g of ZnO quantum dots in ethanol, add 5 mL of a solution of 3-aminopropyltriethoxysilane (APTES, where the mass fraction of 3-aminopropyltriethoxysilane is 2%) and reflux at 120 °C for 6 h. After washing twice with ethanol, dry in vacuum to obtain amino-functionalized ZnO quantum dots.

[0051] b. Place the 5'-phosphorylated DNA template (5 μM), T4 DNA ligase (20 U / mL), and the primer for RCA amplification (10 μM) at 16 °C and react overnight; then maintain at 65 °C for 10 min to inactivate the T4 DNA ligase, so as to ligate the 5'-phosphorylated linear DNA into a circular form to form a circular template. After slowly cooling to 30 °C, add deoxynucleoside triphosphates (dNTP, 1 mM), phi29 DNA polymerase (1 U / μL), and phi29 DNA polymerase buffer to make the total volume 50 μL. React at 30 °C for 6 h, then heat at 95 °C for 10 min to inactivate the phi29 DNA polymerase, and then centrifuge at 8000 rpm. Wash the precipitate twice with deionized water to obtain DNA nanoparticles; finally, disperse the DNA nanoparticles (10 μM) and the nucleic acid aptamer with endothelial cell targeting function (Apt, 50 μM) in 100 μL of deionized water, heat at 55 °C for 10 min, and then slowly cool to room temperature to obtain DNA nanoflowers (DNF).

[0052] c. Disperse the DNA nanoflowers (DNF) and amino-functionalized ZnO quantum dots in deionized water according to a mass ratio of 1:100, oscillate and react overnight, and then centrifuge at 8000 rpm. Collect the precipitate to obtain DNF complexed with ZnO (DNFzn).

[0053] The above DNF is prepared using circular DNA as a template, and the template includes the antisense sequences of dDNAzyme (cleaving the DNA motif in the template) and rDNAzyme (clearing the mRNA of STING). Structurally stable DNA nanoparticles are synthesized by rolling circle amplification (RCA), and the nucleic acid aptamer (Apt) capable of targeting endothelial cells is modified on the surface of the DNA nanoparticles by base complementary pairing, finally forming DNA nanoflowers (DNF). Figure 1 Figure A is the TEM image of the ZnO quantum dots prepared in Example 1. The TEM results show that the ZnO quantum dots are successfully synthesized. The ZnO quantum dots exhibit a highly dispersed spherical structure with a diameter of approximately 8 nm. The diffraction results indicate that it is a polycrystalline structure, and the most obvious lattice fringe spacing is 0.26 nm, which is the 002 crystal plane of ZnO (as Figure 1 shown in Figure B (selected area electron diffraction pattern of ZnO quantum dots) and Figure C (high-resolution TEM image of ZnO quantum dots) in the figure). DNF exhibits a highly dispersed spherical nanoflower morphology with a diameter of approximately 200 nm. After binding with ZnO quantum dots, the morphology and particle size of DNFzn do not change significantly. At the same time, the results of energy dispersive spectrometer (EDS) show that the constituent elements of DNFzn include C, N, P, Mg belonging to DNF and Zn belonging to ZnO quantum dots, and these elements are evenly distributed in the DNFzn nanoparticles (asFigure 1 as shown in D (TEM images of DNF and DNFzn) and E (scanning transmission electron microscopy image of DNFzn and corresponding EDS analysis results). During the formation of DNFzn, pyrophosphate is generated when oligonucleotides (dNTPs) are ligated to the DNA strand by phi29 DNA polymerase. It can immediately combine with magnesium ions in the buffer to form magnesium pyrophosphate (Mg2PPi), thereby fixing the long-chain DNA into a shape similar to a nanoflower (DNFzn). Once DNFzn is exposed to a mildly acidic environment, magnesium pyrophosphate is degraded, and DNFzn becomes loose long-chain DNA (as shown in Figure 1 F (TEM image of DNFzn without acetate buffer treatment) and G (TEM image of DNFzn treated with acetate buffer) in. After incubating DNFzn with ROS-responsive dopamine in Tris-HCl for 12 hours, using P element as the calibration of DNFzn, it was found that DNFzn was encapsulated in ROS-responsive polydopamine (TK-PDA) (as shown in Figure 1 H (scanning transmission electron microscopy image of DNFzn / PDA-Nar and corresponding phosphorus energy spectrum analysis results) in.

[0054] 2. Preparation of titanium-based materials with a ROS-responsive polydopamine / naringenin coating on the surface

[0055] a. Synthesis of a ROS-responsive linking small molecule - dithioacetal with amino groups at both ends (H2N-TK-NH2): First, dissolve 3.78 g of cysteine hydrochloride in acetone (6.63 mL), then add 20 mL of a mixture formed by chloroform and concentrated hydrochloric acid in a volume ratio of 8:2, and react at 4 °C for 12 h; then, centrifuge at 8000 rpm, collect the precipitate and wash the precipitate twice with chloroform; next, dissolve the precipitate in methanol, and then add an excess of diethyl ether for recrystallization on ice, centrifuge at 8000 rpm, collect the precipitate and add 50 mL of NaOH solution (6 M), react at room temperature for 12 h, extract with dichloromethane, and evaporate the solvent to obtain the product, the ROS-responsive linking small molecule - dithioacetal with amino groups at both ends (H2N-TK-NH2), and its 400 MHz nuclear magnetic resonance spectrometer detection results are as shown in Figure 2 A in.

[0056] b. Synthesis of dopamine monomer with ROS responsiveness (TK-DA): First, dissolve L-dopa (13.9 mmol) and tert-butyldimethylchlorosilane (TBDMSCl, 42.3 mmol) in 20 mL of acetonitrile. Dropwise add 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU, 40 mmol) at 0 °C, stir at room temperature for 24 h, then filter. Recrystallize the filter residue with methanol / acetonitrile to obtain compound 1 (reaction efficiency is 81%); Second, add compound 1 to 10 mL of a NaHCO3 solution with a concentration of 15.5 mg / mL, then add an excessive THF solution containing di-tert-butyl dicarbonate ((Boc)2O) (this solution contains 30 mmol of di-tert-butyl dicarbonate ((Boc)2O)), stir at room temperature for 24 h, evaporate the THF to dryness, add deionized water, extract with diethyl ether, acidify the aqueous phase with citric acid to pH = 5 - 6, extract 3 times with diethyl ether, and finally separate and purify through a silica gel column to obtain a yellow oily liquid compound 2 (reaction efficiency is approximately 74%); Then, dissolve 524 mg of compound 2 (1 mmol) in DMF, add 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC, 1.2 mmol) and N-hydroxysuccinimide (NHS, 1.2 mmol), stir at room temperature for 2 h, then add the ROS-responsive linker small molecule with amino groups at both ends - thioacetalamine (H2N-TK-NH2) (0.45 mmol) prepared above, react at room temperature for 15 h, evaporate the organic solvent DMF, wash once with saturated sodium chloride solution, extract with dichloromethane, separate and purify through a silica gel column, and spin-dry to obtain compound 3 (yield is approximately 57%); Finally, dissolve compound 3 (0.6 mmol) in THF, add 1 mL of trifluoroacetic acid (TFA), react at 0 °C for 12 h, spin-dry, dissolve with THF, add 15 mL of tetrabutylammonium fluoride (TBAF), react at 0 °C for 4 h, and then separate and purify through a silica gel column to obtain the final product, which is dopamine monomer with ROS responsiveness (TK-DA). The detection result by a 400 MHz nuclear magnetic resonance spectrometer is as Figure 2 shown in B of

[0057]

[0058] c. Preparation of a titanium-based material with a ROS-responsive polydopamine / naringenin coating (PDA-Nar): First, soak a clean titanium sheet in an HNO3 solution, and after water bath treatment at 60 °C for 40 min, thoroughly rinse the residual HNO3 on the surface with double-distilled water. Then, boil the treated titanium sheet in boiling water for 1 h to fully activate the hydroxyl groups on its surface to obtain a hydroxyl-activated titanium sheet. Second, after drying the hydroxyl-activated titanium sheet with N2, soak it in a 1% (mass fraction) ethanol solution of 3-aminopropyltriethoxysilane (APTES) overnight at room temperature. Then, ultrasonically clean the titanium sheet with absolute ethanol and double-distilled water respectively, and blow it dry with N2 to obtain an aminated titanium sheet. Then, immerse the aminated titanium sheet (the area of the upper surface is 2 cm 2 ) in a solution (800 μg / mL) containing DNF complexed with ZnO (DNFzn) overnight. A large amount of DNFzn can be adsorbed on the surface of the aminated titanium sheet through electrostatic interaction to obtain Ti / DNFzn. Then, rinse it three times with deionized water, dry it with N2, and soak it in a Tris solution containing ROS-responsive dopamine monomer (TK-DA) (2.5 mM) and naringenin (3.5 mM) overnight. After rinsing it clean with deionized water, a titanium-based material (Ti / DNFzn / PDA-Nar) with a ROS-responsive polydopamine / naringenin coating (PDA-Nar) on its surface can be obtained.

[0059] Figure 3 are scanning electron microscope images of different material surfaces. Among them, the various materials in the control group were not treated in any way, and the various materials in the ultrasonic group were treated by ultrasonic treatment. From Figure 3It can be seen that many obvious scratches can be seen on the surface of titanium without any treatment, which are caused by the processing and polishing of pure titanium. A large amount of DNFzn was observed on the surface of the Ti / DNFzn group, which was evenly distributed on the material surface. DNFzn was adsorbed on the surface of amino-functionalized titanium through electrostatic interaction, but the binding between DNFzn and the titanium surface was not very strong at this time. After TK-PDA treatment, a large number of small particle coatings were observed around DNFzn on the surface of the titanium material. Due to the π-π interaction between the benzene ring of TK-PDA and the pentose on DNFzn, TK-PDA tightly wrapped the DNFzn on the titanium material and further enhanced the stability of the binding between DNFzn and the titanium surface. After treating different titanium materials with 400W ultrasonic waves for one hour, the surface morphology of the materials was observed by SEM. The results showed that ultrasonic treatment had no effect on the surface structure of pure titanium, but the DNFzn on the surface of the Ti / DNFzn group materials was significantly reduced. The SEM images of the Ti / PDA-Nar and Ti / DNFzn / PDA-Nar groups showed that ultrasonic treatment had no significant effect on the TK-PDA coating on the material surface, and the DNFzn in the Ti / DNFzn / PDA-Nar group did not fall off from the material surface due to ultrasonic treatment. This may be because dopamine can form a firm polydopamine coating on the surface of any material, thus preventing the detachment of DNFzn.

[0060] Performance test

[0061] 1. ROS regulates the release of naringin and DNFzn from the functional interface of pure titanium

[0062] Different titanium-based materials were immersed in PBS buffer containing H2O2 or PBS buffer without H2O2, and samples and supernatants were collected at 7, 14, 21, and 28 days respectively.

[0063] After the supernatant was collected, the degradation of particles was characterized by 2% agarose gel electrophoresis. The results are shown in Figure 4 A - D below. Among them, A and B are Ti / DNFzn and Ti / DNFzn / PDA-Nar materials immersed in PBS buffer containing H2O2, and C and D are Ti / DNFzn and Ti / DNFzn / PDA-Nar materials immersed in PBS buffer without H2O2 respectively. The results of agarose gel electrophoresis showed that there were no obvious degradation bands of DNFzn in the incubation solution, and a large amount of unmoved DNA was present at the loading well, indicating that the DNFzn in the incubation solution still maintained a complete nanoflower structure.

[0064] The released DNF content was quantitatively detected by Nanodrop. The results are shown in Figure 4As shown in E - H, where E and F are the absorbance values of Ti / DNFzn and Ti / DNFzn / PDA - Nar materials immersed in PBS buffer containing H2O2, respectively, and G and H are the absorbance values of Ti / DNFzn and Ti / DNFzn / PDA - Nar materials immersed in PBS buffer without H2O2, respectively. Figure 4 In J, it shows the change of the release rate of DNFzn in different materials with the incubation time. Combining the results of the quantitative analysis therein, the corresponding absorbance values are converted into release amounts. It can be seen that when Ti / DNFzn is immersed in PBS buffer solution with or without H2O2, a large amount of DNFzn is released from the material surface in the first 14 days, and the cumulative release amounts are approximately 1.53 μg and 1.48 μg. The release amounts from 14 to 28 days of immersion are significantly reduced, and approximately 0.83 μg and 0.72 μg of DNFzn are cumulatively released. In the Ti / DNFzn group, due to the lack of the protection of the TK - PDA coating, DNFzn is only bound to the titanium surface by electrostatic interaction, and this binding is not firm. Therefore, the release rate of DNFzn is relatively fast in the early stage. When Ti / DNFzn / PDA - Nar is immersed in PBS buffer with or without H2O2, the release rate hardly changes significantly every 7 days, and approximately 0.43 μg and 0.0176 μg of DNFzn are released from the material surface. The PBS buffer without H2O2 cannot degrade the TK - PDA coating, resulting in DNFzn being continuously fixed on the titanium material surface and unable to be released into the incubation solution. So only a very small amount of DNFzn is released in the Ti / DNFzn / PDA - Nar group in the PBS buffer without H2O2.

[0065] Zn released from different samples was detected by inductively coupled plasma mass spectrometry (ICP - MS) and high - performance liquid chromatography (HPLC). 2+ For the detection of naringenin, the mobile phase is methanol and 0.05% phosphoric acid (ratio 45:55), the detection wavelength is 288 nm, the flow rate is 1 mL / min, and the column temperature is 30 °C. The detection results are as Figure 4 shown in I. It can be seen from it that the release rate of naringenin (Nar) increases steadily with the incubation time, and the cumulative release amount reaches approximately 65 μg at 7 days.

[0066] 2. Titanium - functionalized interface regulates angiogenesis of endothelial cells and osteogenic differentiation of stem cells

[0067] Select the samples prepared in Example 1 to investigate the effect of different titanium material surfaces on endothelial cell angiogenesis. Immerse clean titanium sheets (Ti), Ti / PDA-Nar (this material replaces Ti / DNFzn with a Ti sheet when preparing Ti / DNFzn / PDA-Nar), Ti / DNFzn, and Ti / DNFzn / PDA-Nar in a medium containing H2O2, and collect the medium after 7 days.

[0068] Human umbilical vein endothelial cells (HUVECs) were seeded on Matrigel at a seeding density of 5000 cells / cm 2 , culture the cells with the previously collected medium for 6 h and then take pictures for recording, and then analyze the angiogenesis trend of HUVECs with Image J. The results are as Figure 5 shown in A in Figure 5 (the upper row of A is the original picture; the lower row is the picture after tube analysis with Image J. Among them, dark blue dots represent nodes, red circles around the dark blue dots represent connections, light blue rings represent the vascular network, yellow rings represent the main segments, blue lines represent incomplete vascular fragments, and green lines represent branches). It can be seen from this that when the extract of the Ti / DNFzn / PDA-Nar group is provided to HUVECs growing on Matrigel, its ability to form tubular networks is the strongest. A large number of capillary-like structures can be seen in the photos. Followed by the Ti / PDA-Nar and Ti / DNFzn groups. Quantitative data show that when HUVECs growing on Matrigel are cultured with the extract of the Ti / DNFzn / PDA-Nar group, the vascular length and the number of nodes formed are also the largest. However, there is no obvious difference in the vascular length and the number of nodes between the Ti / PDA-Nar and Ti / DNFzn groups, but both are significantly higher than the Ti group.

[0069] Culture HUVECs on the surfaces of Ti, Ti / PDA-Nar, Ti / DNFzn, and Ti / DNFzn / PDA-Nar materials for 7 days (corresponding to detecting the alkaline phosphatase activity of MSCs) or 21 days (corresponding to detecting the mineralization level), and collect the medium every day. Mesenchymal stem cells (MSCs) were cultured in 24-well plates, and the MSCs were cultured with the previously collected medium for 7 days, and then the ALP activity of MSCs was detected. After culturing for 21 days, the formation of mineralized nodules of MSCs was detected. The results are as Figure 5 shown in B in

[0070] 3. Functionalized titanium-based interface induces in vivo H-type angiogenesis and new bone formation in an osteoporosis rat model

[0071] An osteoporosis model of SD rats was constructed by ovariectomy. Ti, Ti / PDA-Nar, Ti / DNFzn, and Ti / DNFzn / PDA-Nar materials were selected as different samples and implanted into the femoral epiphysis of osteoporotic rats. The rats were anesthetized by intraperitoneal injection of chloral hydrate. After shaving and disinfecting the surgical site of the rats, a hole was drilled along the direction parallel to the femur in the femoral epiphysis of the rats using a surgical electric drill (with a diameter of 1.2 cm), and different samples were inserted into the hole. Four weeks after implantation, the expressions of H-type vascular marker proteins CD31 and EMCN around the implants of different titanium materials (Ti, Ti / PDA-Nar, Ti / DNFzn, and Ti / DNFzn / PDA-Nar) were detected by immunofluorescence staining, and the results are as Figure 6 shown. As can be seen from the Figure 6 immunofluorescence staining results, a large number of highly branched blood vessels were formed by endothelial cells highly expressing CD31 and EMCN around the Ti / DNFzn / PDA-Nar implant. High expression of CD31 and EMCN is a marker of H-type endothelial cells. This kind of blood vessel is closely related to new bone formation and can regulate the vascular differentiation of surrounding osteoprogenitor cells through paracrine.

[0072] Furthermore, micro-CT was used to observe the new bone formation around the implants of different titanium materials (Ti, Ti / PDA-Nar, Ti / DNFzn, and Ti / DNFzn / PDA-Nar) at the epiphysis of osteoporotic rats, and the results are as Figure 7 shown, where A is the micro-CT scan picture, B is the statistical chart of the amount of new bone formation around the implant, C is the statistical chart of the number of trabecular bones around the implant, and D is the statistical chart of the thickness of trabecular bones around the implant. The new bone of the Ti / DNFzn / PDA-Nar material was significantly more than that of the other groups of Ti, Ti / PDA-Nar, and Ti / DNFzn (red represents the implanted titanium nail, and gray represents the bone tissue). The results of quantitative analysis also proved this view. The bone volume, trabecular bone thickness, and trabecular bone number within 1 mm around the Ti / DNFzn / PDA-Nar implant were significantly higher than those of the other groups. Followed by the Ti / PDA-Nar and Ti / DNFzn groups, there was also more new bone formation.

[0073] Research shows that the titanium-based material (Ti / DNFzn / PDA-Nar) with a ROS-responsive polydopamine / naringenin coating prepared by the present invention can significantly promote new bone formation at the implant interface compared to untreated pure titanium. The reason is as follows: The ROS-responsive polydopamine / naringenin coating (PDA-Nar coating) on the surface of the titanium-based material (Ti / DNFzn / PDA-Nar) with a ROS-responsive polydopamine / naringenin coating is degraded by the high ROS in the osteoporosis microenvironment. First, the naringenin loaded in the coating is released to increase eNOS expression, promote the production of free radical NO and angiogenesis; Next, without the protection of the PDA-Nar coating, DNFzn adsorbed on the surface of the aminated titanium sheet by electrostatic interaction is easily released from the titanium sheet surface and endocytosed by endothelial cells through lysosomes to clear the mRNA of STING to enhance the formation of H-type blood vessels. H-type endothelial cells regulate the paracrine of surrounding cells through paracrine to improve the bone integration between the material and the surrounding bone tissue.

[0074] H-type blood vessels play an important role in bone formation and can affect the osteogenic differentiation of surrounding bone-related cells through secretion. However, the number of H-type blood vessels in the bone tissue of osteoporosis patients decreases sharply. Therefore, promoting the formation of H-type blood vessels at the fracture site will become a potential therapeutic target for improving the bone integration of implant materials. The present invention uses rolling circle amplification (RCA) to synthesize functionalized DNA nanoflowers that can promote H-type angiogenesis (i.e., DNF complexed with ZnO, DNFzn), increasing the uptake of nucleic acid drugs by cells. DNFzn is fixed to the surface of an aminated titanium implant through electrostatic interaction. At the same time, a ROS-responsive polydopamine / naringenin coating is constructed on the surface of DNFzn by the π-π stacking between DNFzn and polydopamine, thereby forming a titanium-based material with a ROS-responsive polydopamine / naringenin coating on the surface (Ti / DNFzn / PDA-Nar). This ROS-responsive polydopamine / naringenin coating not only makes the binding between DNFzn and the titanium material surface stronger, but also further reduces the surface potential of the material, preparing a super negatively charged bone implant material. When Ti / DNFzn / PDA-Nar is implanted into the injury site of osteoporotic rats, the negatively charged material surface forms an endogenous electric field with the surrounding tissues to drive endothelial cells to migrate to the material surface; at the same time, the high ROS level around the implant stimulates the degradation of the polydopamine coating, releasing naringenin in the coating, increasing the eNOS expression of endothelial cells, increasing NO production, and promoting angiogenesis; subsequently, the surface DNF targets endothelial cells to inhibit the mRNA expression of stimulator of interferon genes (STING) in endothelial cells, promoting the transformation of newly formed blood vessels into H-type. The titanium-based material with a ROS-responsive polydopamine / naringenin coating prepared by the present invention mainly solves the following problems: 1) Since the cell membrane is negatively charged, the uptake of nucleic acid drugs is very low. In the present invention, the nucleic acid drugs are amplified into a flower-like structure through hundreds of millions of times of amplification. This structure can increase the endocytosis of cells and promote the uptake of nucleic acid drugs by cells; 2) Nucleic acid drugs are unstable in the physiological environment and are easily degraded by various enzymes. This DNA-inorganic hybrid structure increases the stability of nucleic acid drugs; 3) Since bone implant materials are prone to friction with the surrounding tissues during implantation, resulting in the detachment of surface-modified nanoparticles from the metal material surface, it is difficult for current technologies to firmly load nanoparticles onto the material surface. Inspired by mussel foot proteins, the present invention wraps a ROS-responsive polydopamine around the particles, making the binding between the particles and the material stronger.

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the purpose and scope of the present technical solution, and they should all be covered by the scope of the claims of the present invention.

Claims

1. A titanium-based material with a ROS-responsive polydopamine / naringenin coating, characterized in that, The titanium-based material sequentially includes an amino-functionalized titanium sheet, DNA nanoflowers (DNF) complexed with ZnO, and a ROS-responsive polydopamine / naringenin coating from the inside to the outside; The DNA nanoflowers (DNF) complexed with ZnO are obtained by static adsorption of DNA nanoflowers and amino-functionalized ZnO quantum dots. The DNA nanoflowers are formed by complexing the base sequence of SEQ ID NO.1 after n cycles of amplification with x nucleic acid aptamers of SEQ ID NO.3, where both n and x are integers greater than or equal to 1.

2. The titanium-based material according to claim 1, characterized in that, The DNA nanoflowers are prepared as follows: A 5'-phosphorylated DNA template, T4 DNA ligase, and RCA amplification primers are reacted overnight at 10 - 30°C; then maintained at 60 - 95°C for 10 - 30 min to inactivate the T4 DNA ligase, slowly cooled to 10 - 30°C, and then deoxynucleoside triphosphates and phi29 DNA polymerase are added, reacted at 10 - 30°C for 6 - 12 h, heated at 80 - 95°C for 10 - 20 min to inactivate the phi29 DNA polymerase, and then centrifuged at 8000 - 12000 rpm, and the precipitate is washed twice with deionized water to obtain DNA nanoparticles; finally, the DNA nanoparticles and nucleic acid aptamers with endothelial cell targeting function are dispersed in deionized water, heated at 55 - 65°C for 10 - 30 min, and then slowly cooled to room temperature to obtain DNA nanoflowers; Wherein the DNA template has a phosphate group linked to the 5'-end of the base sequence of SEQ ID NO.1, the base sequence of the RCA amplification primer is as described in SEQ ID NO.2, the DNA nanoparticles are formed by the base sequence of SEQ ID NO.1 after n cycles of amplification, where n is an integer greater than or equal to 1, and the nucleotide sequence of the nucleic acid aptamer with endothelial cell targeting function is as described in SEQ ID NO.

3.

3. The titanium-based material according to claim 2, wherein The ratio of the 5'-phosphorylated DNA template, T4 DNA ligase, RCA amplification primer, deoxynucleoside triphosphates, and phi29 DNA polymerase is 5 - 10:20 - 40:10 - 20:1 - 5:1 - 5, μM:U / μL:μM:mM:U / μL; The molar ratio of the DNA nanoparticles and the nucleic acid aptamer with endothelial cell targeting function is 1:20 - 1:

50.

4. The titanium-based material according to claim 1, characterized in that, The amino-functionalized ZnO quantum dots are prepared as follows: Zinc acetate dihydrate is ultrasonically dispersed in methanol, and a methanol solution of potassium hydroxide is added dropwise while stirring, stirred and centrifuged, the precipitate is collected, and the particles are washed twice with a methanol solution to obtain ZnO quantum dots. Then, the ZnO quantum dots are dispersed in ethanol, aminopropyltriethoxysilane solution is added, and reflux reaction is carried out. After washing twice with ethanol, vacuum drying is carried out to obtain amino-functionalized ZnO quantum dots.

5. The titanium-based material according to claim 4, characterized in that, The concentration of potassium hydroxide in the methanol solution of potassium hydroxide is 0.2 - 0.45 M, and the mass-volume ratio of zinc acetate dihydrate and the methanol solution of potassium hydroxide is 0.9 - 2.0:10 - 20, g:mL; In the stirring and centrifugation, the stirring time is 1 to 3 h and the centrifugation speed is 8000 to 12000 rpm; In the aminopropyltriethoxysilane solution, the mass concentration of aminopropyltriethoxysilane is 1 to 3%, and the mass ratio of ZnO quantum dots to aminopropyltriethoxysilane solution in the aminopropyltriethoxysilane solution is 0.5 to 1:1 to 3 g:mL; The temperature of the reflux reaction is 100 to 120 °C and the time is 6 to 10 h.

6. The preparation method of the titanium-based material according to any one of claims 1 to 5, characterized in that, The preparation method includes the following steps: (1) Preparation of DNF complexing ZnO: Disperse DNA nanoflowers and amino-functionalized ZnO quantum dots in deionized water, oscillate and react overnight, and then centrifuge at a speed of 8000 to 12000 rpm to collect the precipitate to obtain DNF complexing ZnO; (2) Preparation of Ti / DNFzn: Immerse the aminated titanium sheet in the solution containing DNF complexing ZnO overnight, and adsorb a large amount of DNFzn on the surface of the aminated titanium sheet through electrostatic interaction to obtain Ti / DNFzn; (3) Preparation of a titanium-based material with a ROS-responsive polydopamine / naringenin coating on the surface: After rinsing and drying the Ti / DNFzn, immerse it in a Tris solution containing ROS-responsive dopamine monomers and naringenin overnight, and rinse it with deionized water to obtain a titanium-based material with a ROS-responsive polydopamine / naringenin coating on the surface.

7. The preparation method according to claim 6, characterized in that In step (1), the mass ratio of the DNA nanoflowers to the amino-functionalized ZnO quantum dots is 1:100 to 1:600; In step (2), the solvent of the solution containing DNF complexing ZnO is deionized water, and the concentration of DNF complexing ZnO in the solution containing DNF complexing ZnO is 1:

100.

8. The preparation method according to claim 6, characterized in that, In step (3), the rinsing and drying specifically means: repeatedly rinsing with deionized water and then drying with N2; The molar ratio of the Ti / DNFzn, ROS-responsive dopamine monomers and naringenin is 1:2 to 1:5; The concentration of ROS-responsive dopamine monomers in the Tris solution is 2.5 to 5 mM and the concentration of naringenin is 3.5 to 6 mM.

9. The preparation method according to claim 6, characterized in that, The structural formula of the dopamine monomer in response to ROS is 10. Use of the titanium-based material according to any one of claims 1 to 5 in the preparation of bone implant materials.

Citation Information

Patent Citations

  • DNA (deoxyribonucleic acid) nanoflower as well as preparation method and application thereof

    CN115094056A

  • Method for preparing medical titanium implant with function of eliminating surface bio-membrane

    WO2020244600A1