A PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide and its application

Abstract

The present invention discloses a PRRSV M protein SLA‑1*04:01:01 restricted T cell epitope polypeptide and its application. In order to provide a vaccine that provides extensive cross-protection against heterologous PRRSV strains. The present invention provides a PRRSV M protein SLA‑1*04:01:01 restricted T cell epitope polypeptide, whose amino acid sequence is shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. The T cell epitope peptide obtained by the present invention that is specific to the PRRSV M protein and restricted by SLA‑1*04:01:01 is applied to the study of the PRRSV immune mechanism, or to the development of epitope peptide vaccines, and has good application prospects in the development and utilization of epitope peptide vaccines.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular immunology, and specifically relates to a PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide and application thereof. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is an important viral disease caused by porcine reproductive and respiratory syndrome virus (PRRSV), which has caused huge economic losses to China's pig industry (Zhou and Yang, 2010). After PRRSV invades the body, it can trigger humoral and cellular immune responses. Studies have shown that cellular immunity may play a more important role in clearing the virus from the body (Mateu and Diaz, 2008). PRRSV contains three important structural proteins: GP5 protein, M protein and N protein. Among them, M protein is the membrane matrix protein of PRRSV, has no glycosylation site, and is the most conserved structural protein in European and North American isolates. It plays an important role in the assembly and budding of the virus (Mardassi et al., 1996) and is closely related to the infectivity of the virus (Wissink et al., 2005). The M protein has strong immunogenicity. It can not only induce the body to produce neutralizing antibodies, but also induce strong specific cellular immune responses. It is related to immune protection and may play a major role in cellular immunity (Jeong et al., 2010). Therefore, studying the M protein can provide a theoretical basis for in-depth research on the cellular immune mechanism of PRRS. Since the first isolation of PRRSV strains in 1991, the strains have continued to evolve genetically and mutate through recombination (Gao et al., 2017), forming diverse wild strains with different pathogenicity, which seriously hindered the development of safe and effective vaccines (Nilubol et al., 2004). At present, commercial modified attenuated live vaccines cannot provide extensive cross-protection against all heterologous PRRSV strains, so it is urgent to develop new vaccines for prevention and control.

[0003] Tandem repeat peptide synthesis is the most commonly used method for screening viral CTL epitopes. That is, under the condition of known antigen primary structure, a series of peptides with one or several overlapping amino acids are randomly or continuously synthesized according to the amino acid sequence of the antigen protein, and the peptides that can be recognized by T cells are determined by lymphocyte function test. Wang et al. used this method to preliminarily identify the location of HP-PRRSV M protein T cell epitopes and found that 4 short peptides (each containing 15 amino acid residues) may have specific T cell epitopes that can induce cellular immunity (Wang et al., 2011), but did not screen out nonameric peptides with CTL epitope characteristics, nor identify their MHC restriction, and may also cause missed detection due to the high polymorphism of MHC molecules. Therefore, before synthesizing peptides, the possibility of binding to MHC molecules is predicted, the most likely antigen fragments are first screened out, and then the predicted results are verified through a series of in vivo and in vitro immunological tests, which can not only reduce workload and save costs, but also improve the success rate of the test. Zhang et al. used bioinformatics methods to predict and synthesize some CTL peptides of PRRSV M protein, then separated spleen lymphocytes from Balb / c mice, and finally identified two H-2Kd and H-2Dd restricted CTL epitopes through in vitro immunological tests (Zhang et al., 2011b). Song Yanhua also used bioinformatics methods combined with in vitro immunological tests to identify two CTL epitopes of M protein (Song Yanhua, 2012). However, these studies did not conduct in vivo immunological tests to verify and therefore could not be determined as true epitopes. The pig MHC (SLA) restriction of the epitope was also not identified, which reduced the application range of the epitope. Screening for epitope peptides with SLA restriction has greater application value. 1. The previous method of identifying SLA restricted epitopes is defective, and the method provided in this application is more reliable and effective. 2. The current commercial modified attenuated live vaccine cannot provide extensive cross-protection against all heterologous PRRSV strains, and new vaccines need to be developed. Summary of the invention

[0004] The purpose of the present invention is to provide a vaccine that provides broad cross-protection against heterologous PRRSV strains and to screen new restricted epitope polypeptides.

[0005] The present invention provides a PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide, the amino acid sequence of which is shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3.

[0006] The present invention provides a nucleotide sequence encoding a PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide.

[0007] It is further defined that the nucleotide sequence is shown in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0008] The present invention provides a recombinant vector, which carries the above-mentioned coding gene.

[0009] The present invention provides a recombinant microbial cell carrying the above gene or expressing the antigen epitope polypeptide according to claim 1.

[0010] The present invention provides a vaccine composition, which contains the PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide.

[0011] It is further defined that the vaccine composition is a monovalent vaccine, a bivalent vaccine or a multivalent vaccine.

[0012] The present invention provides the use of the above-mentioned antigen epitope polypeptide, the above-mentioned encoding gene, the above-mentioned recombinant vector or the above-mentioned recombinant microbial cell in preparing a kit for detecting porcine reproductive and respiratory syndrome virus-specific T cell response.

[0013] The present invention provides the above-mentioned antigen epitope polypeptide, the above-mentioned encoding gene, the above-mentioned recombinant vector or the above-mentioned recombinant microbial cell for preparing SLA-1*04:01:01 / epitope peptide-complex tetramer for detecting specific CD8 chromatin caused by PRRSV infection. + Application of the invention in T cell immune response reaction or in the preparation of medicine for treating or preventing PRRSV infection.

[0014] The present invention provides a method for screening the above-mentioned PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide, characterized in that the specific steps of the method are as follows:

[0015] Step 1: Use biological software to predict candidate nonamer peptides with potential high affinity to the SLA-1*04:01:01 molecule;

[0016] Step 2: construct the SLA-I complex in vitro, and use the ELISA method to screen out peptides that can specifically bind to the SLA-1*04:01:01 molecule and identify potential epitopes;

[0017] Step 3: using the CCK-8 method to identify the SLA-1*04:01:01 restricted PRRSV M protein T cell nonameric peptide epitope that can stimulate the proliferation response of T lymphocytes carrying SLA-1*04:01:01;

[0018] Step 4: The IFN-γ ELISPOT method was used to identify the SLA-1*04:01:01-restricted PRRSV M protein T cell nonameric peptide epitope that can stimulate the proliferation of SLA-1*04:01:01-carrying lymphocytes that secrete IFN-γ.

[0019] Beneficial effects: The PRRSV M protein-specific T cell epitope peptides restricted by SLA-1*04:01:01 provided by the present invention are screened by epitope prediction software, in vitro construction of SLA-I complex to detect specific binding with SLA-1*04:01:01, CCK-8 and IFN-γELISpot technology to obtain PRRSV M protein M27, M39 and M49 epitope peptides, which are experimentally confirmed to be highly specific and can induce specific T cells to produce strong cellular immune responses and secrete IFN-γ. Moreover, SLA-1*04:01:01 is the most popular and ubiquitous allele in all pig breeds, and the SLA-1*04:01:01 molecules encoded by it can cover a wide range of pig breeds. Therefore, the T cell epitope peptide obtained by the present invention, which is restricted by SLA-1*04:01:01 and is specific to the PRRSV M protein, is applied to the study of the immune mechanism of PRRSV, or to the development of epitope peptide vaccines, or to the induction of epitope peptide-specific CTL responses, or to the preparation of SLA-1 / epitope peptide-complex tetramers, and has a higher reference value for designing more extensive and effective polypeptide vaccines for different breeds of pigs. The method for identifying epitope peptides established by the present invention can be used to identify T cell epitopes of other viruses, and has a good application prospect in the development and utilization of epitope peptide vaccines. The SLA-restricted epitope identified by the present invention can induce specific T cells to produce a strong cellular immune response, secrete IFN-γ, and immunize pigs carrying SLA-1*04:01:01 molecules to provide protection, so it can be applied to the development of peptide vaccines in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the construction of the recombinant expression vector pET-epitope-SLA-1*040101-β2m; the horizontal boxes of SLA-1*04:01:01 and β2m represent the amplified extracellular region of the SLA-1*04:01:01 allele and the mature peptide sequence of the β2m gene, respectively; Linker represents a glycine-rich linker sequence; His·Taq represents the C-terminal His tag sequence of the pET-30a(+) prokaryotic expression vector; and CTL epitope represents the predicted CTL epitope peptide sequence. Capital letters outside the boxes represent amino acids. Bold letters represent restriction endonuclease sites. The arc represents the pET-30a(+) vector;

[0021] Figure 2SDS-PAGE and Western blot detection results of fusion protein; Lane 1: induced expression of pET-epitope-SLA-1*040101-β2m; Lane 2: induced expression of pET-SLA-1*040101-β2m; Lane 3: uninduced expression bacteria; Lane 4: renaturation result of recombinant protein pET-epitope-SLA-1*040101-β2m; Lane 5: renaturation result of recombinant protein pET-SLA-1*040101-β2m; Lane 6: Western blot detection of recombinant protein pET-epitope-SLA-1*040101-β2m; Lane 7: Western blot detection of recombinant protein pET-SLA-1*040101-β2m; M: prestained protein Ladder;

[0022] Figure 3 The test results of specific binding of candidate epitope peptides to SLA-1*04:01:01 molecules;

[0023] Figure 4 The proliferation response of T lymphocytes after stimulating PBMCs of SLA Hp-4.0 (A) and Hp-26.0 (B) haplotype piglets with 6 groups of candidate peptides;

[0024] Figure 5 The proliferation response of T lymphocytes after the candidate peptides stimulated PBMCs of SLA Hp-4.0 (A) and Hp-26.0 (B) haplotype piglets alone;

[0025] Figure 6 The average number of spot-forming cells on the ELISPOT plate after stimulating SLA Hp-4.0 and Hp-26.0 haplotype piglet PBMCs with the six groups of candidate peptides;

[0026] Figure 7 The average number of spot-forming cells on the ELISPOT plate after the candidate peptides stimulated SLA Hp-4.0 and Hp-26.0 haplotype piglet PBMCs alone;

[0027] Figure 8 The temperature change curve of piglets after virus attack;

[0028] Fig. 9 Detection of antibodies in piglet sera after immunization and challenge;

[0029] Fig.10 Detection of viremia in piglets after challenge. DETAILED DESCRIPTION

[0030] Example 1. Prediction and synthesis of antigenic epitopes

[0031] 1. Software predicts the PRRSV M protein SLA-1*04:01:01 restricted T cell nonameric peptide epitope

[0032] The PRRSV (HuN4 virus strain) M protein consists of 174 amino acid residues. The specific M amino acid sequence can be obtained from the protein database of the NCBI website (Access No. ABR26254), combined with the online prediction software ICES (http: / / sb.nhri.org.tw / ICES), IEDB Analysis Resoure (http: / / tools.immuneepitope.org / main / ) and NetMHCpan 4.0Server ( http: / / www.cbs.dtu.dk / services / NetMHCpan / ) The software was used to predict the SLA-1*04:01:01 restricted T cell epitopes of the M protein of the PRRSV HuN4 strain. The nine-mer peptide T cell epitope peptides of the PRRSV M protein restricted by the common molecule SLA-1*04:01:01 of different pig breeds were predicted. Based on the prediction results of the software, 27 nine-mer peptides with higher affinity to SLA-1*04:01:01 were selected in turn (Table 1).

[0033] Table 1 Prediction of T cell nonameric peptide epitopes restricted by SLA-1*04:01:01 of PRRSV M protein

[0034]

[0035]

[0036] 2. Synthesis of predicted PRRSV M protein nonaminopeptide

[0037] According to the results of the software-predicted restricted T cell epitope of PRRSV M protein SLA-1*04:01:01, Beijing Liuhe BGI Gene Technology Co., Ltd. was commissioned to synthesize 27 nonameric peptides, each of which was synthesized to 4 mg, and the purity was >90% as determined by RP HPLC. The synthesized peptide powder was dissolved in 1% sterile dimethyl sulfoxide (DMSO-water) to a final concentration of 500ug / ml and stored in a -80℃ ultra-low temperature refrigerator for use, and further diluted with RPMI-1640 containing 10% FBS when used.

[0038] Example 2. Screening of polypeptides

[0039] 1. In vitro construction of SLA-I complexes to detect and screen candidate nonamer peptides that specifically bind to the SLA-1*04:01:01 molecule

[0040] 1.1 Construction of SLA-I complex in vitro

[0041] The polymorphism of SLA class I molecules is mainly concentrated in exons 2 and 3. The two exons encode the α1 and α2 domains respectively, which together constitute the antigen peptide binding groove. The binding groove can be further divided into six different pockets (AF), which determine the specificity of T cell epitope binding. Different alleles bind to different types of T cell epitopes, which are determined by the amino acids suitable for the pockets in the SLA-I antigen peptide binding groove and the anchor residues of the peptide segment. When the binding groove binds to a specific peptide epitope, the spatial conformation changes to form a heterotrimer, including SLA class I heavy chain, a single form of light chain (β2m) and a specifically bound peptide epitope. This heteromeric protein is almost constitutively expressed on the surface of various nucleated cells and is very effective for CD8 + It is essential for the normal development of T lymphocytes, which mainly present antigen epitopes to CD8 + CTLs kill target cells by recognizing antigenic epitopes (endogenous antigenic T cell epitopes) on the cell surface that bind to SLA class I molecules. By simulating the action mode of SLA class I molecules in vivo, constructing SLA class I molecule complexes in vitro to analyze the interaction between amino acid residues in the peptide binding groove and polypeptides, screening out polypeptides with high affinity to SLA class I molecules and identifying potential epitopes, it avoids the one-sidedness of epitope prediction based solely on protein sequence information, improves the accuracy of epitope identification, and is a good and feasible antigen polypeptide screening system.

[0042] The specific construction process is as follows: First, PCR amplify the extracellular region of SLA-1*04:01:01 and the mature peptide region of β2m, and the primers are shown in Table 2. Then, SOE-PCR technology is used to connect the extracellular region of SLA-1*04:01:01 with the mature peptide region of β2m, and a linker rich in glycine and serine is added in the middle: (G4S)3, (the flexible linker is added to form a better spatial conformation when the expressed protein is renatured, and it is easier to specifically bind to the peptide segment. It is connected to the 30a vector together with the extracellular region of SLA-1*04:01:01 and the mature peptide region of β2m, and the expressed protein contains this segment) Use the restriction endonuclease site pET-30a vector to connect and construct the pET-SLA-1*040101-β2m recombinant expression plasmid, and then the predicted 27 PRRSV The nucleotide sequences of the candidate epitopes of the M protein were inserted in front of the extracellular region of SLA-1*04:01:01, respectively, to construct 27 pET-epitope-SLA-1*040101-β2m complex (polypeptide-SLA-1 extracellular region-β2m) recombinant expression plasmids ("epitope" refers to the candidate epitope, which can be replaced by M1, M2, M3, etc. when specifically expressed) (see the schematic diagram Figure 1), pET-SLA-1*040101-β2m (the SLA-1*04:01:01 extracellular region was connected to the β2m mature peptide region, and a glycine- and serine-rich Linker was added in the middle to connect to the pET-30a vector) and 27 pET-epitope-SLA-1*040101-β2m recombinant plasmids were expressed in prokaryotes. The SDS-PAGE results showed that the target bands appeared at 45.5kDa and 47.4kDa, respectively, which were consistent with the expected size. The expressed protein was an inclusion body. After the protein was refolded and renatured using a protein refolding kit, the target protein band was relatively single. Western blot detected His-tagged proteins, and the results showed that a single band was detected in all 28 recombinant proteins, which was consistent with the size of the expression band. Taking the results of the pET-M1-SLA-1*040101-β2m recombinant plasmid as an example, Figure 2 Lanes 1, 4, and 6 in the figure are selected from one of the 27 epitope-carrying recombinant plasmids as an example, showing the results of induced expression, renaturation, and WB, respectively. The remaining 26 are exactly the same as this one. Figure 2 ).

[0043] SLA-1*04:01:01 extracellular region sequence: (SEQ ID NO.7)

[0044] GGTCCCCACTCCCTGAGCTATTTCTACACCGCCGTGTCCCGGCCCGACCGCGGGGACT

[0045] CTCGCTTCATCGCCGTCGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAACTA

[0046] CGCCCCGAATCCGCGGATGGAGCCTCGGGTGCCGTGGATACAGCAGGAGGGGCAGGA

[0047] GTATTGGGATCGGGAGACGCGGAATGTCAAGGAAACCGCACAGACTTACGGAGTGGG

[0048] CCTGAACACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGGTCTCACACCCTCCA

[0049] GAGCATGTACGGCTGCTACTTGGGACCAGACGGGCTCCTCCTCCACGGGTACAGACA

[0050] GGACGCCTACGACGGCGCCGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGAC

[0051] CGCGGCGGACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCGATGAGGC

[0052] GGAGCGTAGGAGGAGCTACCTGCAGGGACTGTGTGTGGAGTCGCTCCGCAGATACCT

[0053] GGAGATGGGGAAGGACACGCTGCAGCGCGCAGAGCCTCCAAAGACACATGTGACCCG

[0054] CCACCCCAGCTCTGACCTCGGGGTCACCTTGAGGTGCTGGGCCCTGGGCTTCTACCCT

[0055] AAGGAGATCTCCCTGACCTGGCAGCGGGAGGGCCAGGACCAGAGCCAGGACATGGA

[0056] GCTGGTGGAGACCAGGCCCTCAGGGGATGGGACCTTCCAGAAGTGGGCGGCCCTGGT

[0057] GGTGCCTCCTGGAGAGGAGCAGAGCTACACCTGCCATGTGCAGCACGAGGGCCTGCAGGAGCCCCTCACCCTGAGATGG。

[0058] β2m mature peptide region sequence: (SEQ ID NO.8)

[0059] GTCGCGCGTCCCCCGAAGGTTCAGGTTTACTCACGCCACCCAGCGGAAAACGGAAAG

[0060] CCAAATTACCTGAACTGCTATGTATCTGGGTTCCATCCGCCCCAGATTGAAATTGATTT

[0061] GCTGAAAAACGGGGAGAAGATGAACGCGGAGCAGTCAGACCTGTCTTTCAGCAAGGA

[0062] CTGGTCTTTCTACCTTCTGGTCCACACTGAGTTCACTCCTAACGCTGTGGATCAGTATA

[0063] GCTGCCGCGTGAAGCACGTGACTCTCGATAAGCCCAAGATAGTTAAGTGGGATCGAGACCAC.

[0064] Linker: (G4S) 3 Sequence: (SEQ ID NO.9)

[0065] GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG.

[0066] Table 2 Primers related to the construction of SLA-I complex

[0067]

[0068] Bold letters represent restriction endonuclease sites, and the underlined part represents the Linker (G4S) 3 sequence.

[0069] 2. In vitro detection and screening of candidate nonamer peptides that specifically bind to the SLA-1*04:01:01 molecule using the SLA-I complex

[0070] When the antigenic peptide binding groove of the SLA class I molecule binds to a specific peptide epitope, the spatial conformation changes to form a heterotrimer. The monoclonal antibody PT85A can recognize this conformational epitope. The PT85A monoclonal antibody (Monoclonal Antibody Center, Washington State University, United States) was developed at the University of Washington and can recognize all SLA class I molecules discovered so far, including inbred and outbred pig populations (Mosaad et al., Identification of monoclonal antibody reagents for use in the study of the immune response to infectious agents in camel and water buffalo, 2006). This monoclonal antibody was used to establish an ELISA method to detect refolded proteins and analyze the specificity of candidate T cell epitopes binding to the SLA-1*04:01:01 molecule.

[0071] The details are as follows: The concentration of the renatured protein was determined using the 2D-Quant Kit protein quantification kit. Take the Nickel-coated ELISA plate, add 7.2 μg of the renatured protein to each well, make up to 100 μl / well with PBS, incubate at room temperature overnight, so that the pET-SLA-1*040101-β2m and 27 pET-epitope-SLA-1*040101-β2m recombinant proteins carrying the His tag can be fully combined with Nickel, then washed 3 times with PBST (200 μl / well), add 100 μl of monoclonal antibody PT85A (1% BSA 1:200 dilution), incubate at 37°C for 1h, wash 3 times with PBST (200 μl / well), add 100 μl of horseradish enzyme-labeled goat anti-mouse IgG (H+L) (1% BSA 1:10000 dilution), incubate at 37℃ for 1h, wash thoroughly, add TMB substrate solution, 100μl / well, incubate in dark for 15min, add 100μl stop solution (2mol / L sulfuric acid) to each well, then place the ELISA plate in an ELISA reader and measure the OD value (wavelength 450nm).

[0072] All recombinant proteins of pET-SLA-1*040101-β2m and pET-epitope-SLA-1*040101-β2m were tested by ELISA. The test was repeated 3 times for each sample. The OD value of the complex protein pET-SLA-1*040101-β2m not linked to the epitope was used as a negative control. The OD value (pET-epitope-SLA-1*040101-β2m complex) / OD value (pET-SLA-1*040101-β2m complex) ≥ 2.0 was judged as positive, so as to screen the epitope polypeptide that specifically binds to the SLA-1*04:01:01 molecule.

[0073] The results showed that among the 27 candidate PRRSV M protein nonameric peptides to be tested, the relative OD values ​​of the complexes formed by the M27 (TWKFITSRC), M39 (NHAFVVRRP) and M49 (GRKAVKQGV) peptides and the SLA-1*04:01:01 molecule after ELISA detection were >2.0, indicating that these three peptides can be identified as SLA-1*04:01:01 high-affinity binding peptides ( Figure 3 ).

[0074] 2. Identification of SLA-1*04:01:01 restricted PRRSV M protein T cell nonaminase epitope using Cell Counting Kit-8 (CCK-8)

[0075] 2.1 Screening of SPF Landrace Homozygous SLA Haplotype Piglets

[0076] Peripheral blood from Landrace pigs with different SPF was collected aseptically and placed in sodium heparin anticoagulant tubes, which were numbered. Peripheral blood mononuclear cells (PBMCs) were separated using porcine peripheral blood lymphocyte separation medium (Tianjin Haoyang Biological Company) according to the instructions, and RNA was extracted and reverse transcribed into cDNA. The full-length CDS sequences of SLA-1, SLA-2 and SLA-3 were amplified by PCR using this as a template. The primers are shown in Table 3. The PCR products were sequenced, and single peak sequences were selected for comparison with the different allele sequences of SLA-1, SLA-2 and SLA-3 submitted to the IPD-MHC database (https: / / www.ebi.ac.uk / ipd / mhc / group / SLA / ) to screen homozygous SLA Hp-4.0 (SLA-1*04:01:01-SLA-3*04:01-SLA-2*04:01) and Hp-26.0 (SLA-1*08:11-SLA-3*05:02-SLA-2*10:06) without SLA-1*04:01:01) haplotype piglets (Gao, C., et al,. Swine Leukocyte Antigen Diversity in Canadian Specific Pathogen-Free Yorkshire and Landrace Pigs, 2017).

[0077] Table 3 SLA class I gene specific primer information

[0078]

[0079] 2.2 Identification of the SLA-1*04:01:01 restricted PRRSV M protein T cell nonameric peptide epitope that can stimulate T lymphocyte proliferation using CCK-8 method

[0080] Six SLA Hp-4.0 and Hp-26.0 homozygous piglets were randomly divided into a normal group (3 piglets) and an immune group (3 piglets). The immune group was vaccinated with HuN4-F112 vaccine strain (highly pathogenic porcine reproductive and respiratory syndrome live vaccine) at a dose of 3×10 4.5 TCID 50 The normal group PBS was used as the control. After inoculation, the animals were strictly kept and managed. On the 17th day after inoculation (DPI), blood was collected to separate PBMCs as effector cells. The 27 synthesized peptides were divided into 6 groups (Table 4) for stimulation. The CCK-8 kit (Product No.: C0038) was used to detect the proliferation response of T lymphocytes according to the instructions. The details were as follows: PBMCs were 10 5Cells were plated on 96-well plates and incubated overnight. Cells were stimulated with 6 groups of peptides. Cells were stimulated with plant lectin (PHA) at a final concentration of 10 μg / ml (the final volume × final concentration is the amount of peptide added, but the final concentration must be 10 μg / ml) as positive control wells, and ddH2O or DMSO treatment was used as negative control wells. Each sample was repeated 3 times. After stimulating the cells for 72 hours, 10 μL CCK-8 was added to each well, and then incubated for another 5 hours. The absorbance value (OD value) at 450 nm was measured using an automatic microplate reader. The stimulation index of the immune group or normal group = the average OD value of the peptide-stimulated cell wells / the average OD value of the negative control wells. Peptides were screened out based on the results of the first grouping, and the screened peptides were used to stimulate PBMCs alone. The T lymphocyte proliferation response was detected again using the CCK-8 kit according to the instructions.

[0081] The results showed that for SLA Hp-4.0 haplotype piglets, after stimulating PBMCs with Group 4, Group 5 and Group 6 peptides, the stimulation index of the immune group was significantly higher than that of the control group, while there was no significant change in SLA Hp-26.0 piglets ( Figure 4 ). Subsequently, each peptide fragment of Group 4, Group 5 and Group 6 was used to stimulate SLA Hp-4.0 haplotype PBMCs. The results showed that the stimulation index of M27, M39 and M49 was significantly higher than that of the control group, while there was still no significant change in Hp-26.0 piglets ( Figure 5 )

[0082] Table 4 Grouping of 27 candidate epitope peptides

[0083] Grouping Peptides Group 1 M1,M2,M6,M8,M9 Group 2 M3,M4,M5,M7,M10 Group 3 M13,M14,M15,M26,M31 Group 4 M16,M17,M22,M23,M27 Group 5 M39,M44,M45,M46,M49 Group 6 M33,M34

[0084] 3. Identification of the SLA-1*04:01:01 restricted PRRSV M protein T cell nonaminase epitope by solid phase enzyme linked immunospot assay (ELISPOT)

[0085] Commercial IFNγ ELISPOT (R&D Systems, USA) was used to detect the candidate PRRSV M protein nonaminase epitope-induced CD8 + The ability of T cells to secrete IFNγ was determined by using IFNγ as the detection target to detect the effect of the SLA-1*04:01:01 restricted PRRSV M protein nonaminase on the CD8 +The specific stimulation of T cells was as follows: take the 96-well plate pre-coated with IFNγ monoclonal antibody provided in the kit, add 200 μl of sterile culture medium to each well, incubate at room temperature for 20 minutes, and discard the liquid; add 2.5×10 5 PBMCs from the immune group or normal group were plated and stimulated with 6 groups of peptides (final concentration 10μg / ml) respectively, incubated overnight, and positive and negative controls were set up at the same time. PHA (final concentration 10μg / ml) was added to the positive control wells, and ddH2O or DMSO was added to the negative control wells; after washing with Wash Buffer, 100μl of Detection Antibody was added and incubated at 4℃ in the dark overnight; after washing with Wash Buffer, 100μl of Streptavidin-AP was added and incubated at room temperature for 2h; after washing with Wash Buffer, 100μl of BCIP / NBT Chromogen was added and incubated at room temperature in the dark for 1h, washed with deionized water, dried naturally, and the number of IFNγ spot-forming cells was counted on the automatic plate reader of the enzyme-linked spot image analysis system. The number of spot-forming cells (SFC) = the average number of spots in the experimental wells stimulated by peptides - the average number of spots in the negative control wells. The data were finally expressed as SFCs / 10 6 Cell representation.

[0086] ELISPOT results showed that when the peptides were divided into 6 groups, only the peptides in Group 4 and Group 5 stimulated SLA Hp-4.0 haplotype PBMCs, and the average number of spot-forming cells on the ELISPOT plate in the immune group was significantly higher than that in other groups (p<0.01), and there was no significant change in Hp-26.0 piglets ( Figure 6 ), and then stimulated SLAHp-4.0 haplotype PBMCs with separate peptides from Group 4 and Group 5. The results showed that the average number of spot-forming cells in M27, M39 and M49 on the ELISPOT plate was significantly higher than that in other groups (p<0.05), and there was still no significant change in Hp-26.0 piglets ( Figure 7 ). This indicates that the nonapeptide epitopes M27, M39 and M49 can induce strong CTL responses in PRRSV-infected pigs. Therefore, it was determined that the three nonapeptides were all SLA-1*04:01:01-restricted PRRSV M protein T cell epitopes.

[0087] Example 3. Utilization of SLA-1*04:01:01 restricted PRRSV M protein T cell nonameric peptide epitope

[0088] 1. A method for preparing a vaccine: The nucleotide sequences encoding the M27, M39 and M49 epitopes are concatenated with a flexible linker (a nucleotide sequence encoding the amino acid GGGGS), a nucleotide sequence encoding a histidine tag (His) and a stop codon (TAA) are added to the 3′ end, Beijing Liuhe BGI Gene Technology Co., Ltd. is commissioned to synthesize the fragments, the above-mentioned fragments are connected to the eukaryotic expression vector pcaggs using restriction sites, and the fragments are transformed into Escherichia coli to construct a recombinant expression plasmid pcaggs-M27-M39-M49, and then the plasmid is transfected into the Expi293·F suspension cell expression system, the supernatant is collected and purified by a nickel column to obtain a nonapeptide epitope tandem polypeptide, and the polypeptide is emulsified with Freund's adjuvant to prepare an epitope polypeptide vaccine.

[0089] 2. Evaluation of the protective effect of SLA-1*04:01:01 restricted PRRSV M protein T cell nonaminopeptide on PRRSV immunity

[0090] Eighteen one-month-old homozygous SLA Hp-4.0 haplotype SPF Large White pigs were randomly divided into 4 groups: polypeptide immunization group (5 pigs) (Group 1), commercial vaccine immunization group (5 pigs) (Group 2), challenge control group (5 pigs) (Group 3) and blank control group (3 pigs) (Group 4). They were kept in a barrier environment for 3 days and their body temperature was measured once a day. After 3 days, the polypeptide immunization group was immunized with an equal amount of mixed polypeptides of M27, M39 and M49 emulsified with Freund's adjuvant by intramuscular injection in the neck, with a dose of 900 μg per pig. Two weeks later, the second immunization was carried out with the same route and dose as the first immunization. On the day of the first immunization, the commercial vaccine immunization group was immunized with 2 mL of HP-PRRSV live vaccine (HuN4-F112 strain) (10 5 TCID 50 28 days after the first vaccination, each pig in the polypeptide immunization group, commercial vaccine immunization group and challenge control group was injected intramuscularly with 2 mL 10 5 TCID 50 / head of HuN4. The blank control group was treated with the same method and dose of DMEM. After immunization, the clinical symptoms of the pigs were observed every day, and blood was collected every week. After the challenge, the spirit, drinking water, food intake, feces and morbidity of the pigs in each group were observed every day, the clinical symptoms were recorded, and the temperature was measured; blood was collected on 0d, 7d, 10d, 14d, and 18d after the challenge, and the serum was separated. The ELISA method was used to detect PRRSV-specific antibodies, and the fluorescent quantitative PCR method was used to detect viremia; 18d after the challenge, the surviving pigs were euthanized and dissected, tissue lesions were observed, and the viral load in tissues / organs was detected by fluorescent quantitative PCR.

[0091] The results are as follows:

[0092] (1) Observation of clinical symptoms of piglets in each group after immunization and challenge

[0093] After immunization, none of the four groups of piglets had clinical symptoms of PRRS. After HuN4 challenge, the body temperature of the piglets in the peptide immunization group and the commercial vaccine immunization group was normal, and no obvious clinical symptoms were observed, which was the same as the blank control group, and the physiological function was normal. The challenge control group showed fever symptoms (≥40.5℃) on the first day after challenge ( Figure 8 ), different clinical symptoms such as dyspnea, anorexia, and depression appeared 3 to 4 days after infection. As the disease progressed, obvious bleeding appeared on the abdomen, ears, and hind limb skin. All five pigs died on the 10th day after infection.

[0094] (2) Changes in antibody levels in each group of piglets after immunization and challenge

[0095] 14 days after immunization, the PRRSV antibodies of the peptide immunization group and the commercial vaccine immunization group all turned positive, and the antibody level remained high until the end of the experiment; 7 days after the challenge, the PRRSV antibodies of the piglets in the challenge control group turned positive, while the antibodies of the piglets in the blank control group remained negative ( Fig. 9 and Table 5).

[0096] Table 5 Changes in PRRSV antibody levels in each group of piglets after immunization and challenge

[0097]

[0098] (3) Viremia and tissue viral load of piglets in each group after challenge

[0099] 7 days after the virus attack, the viremia of piglets in the virus attack control group, peptide immunization group and commercial vaccine immunization group reached a peak, but the levels of the peptide immunization group and the commercial vaccine immunization group were similar, both significantly lower than the virus attack control group, and then gradually decreased. The blank control group was negative ( Fig.10 The virus load in tissues showed that PRRSV was detected in the heart, liver, spleen, lung, kidney, submandibular lymph node and inguinal lymph node of all pigs in the challenge control group, and PRRSV was detected in 1 / 5 of the polypeptide immunization group and the commercial vaccine immunization group, and the blank control group was negative (as shown in Table 7).

[0100] Table 6 Changes in viremia in piglets in each group after challenge

[0101]

[0102] Table 7 Detection results of PRRSV in the tissues of each group of piglets after challenge

[0103]

[0104] (4) Pathological examination results of piglets in each group after challenge

[0105] After the virus attack, the lungs of the virus attack control group were obviously swollen, with bleeding spots, and the submandibular lymph nodes and inguinal lymph nodes were swollen and bleeding, while the polypeptide immunization group and the commercial vaccine immunization group were basically normal, with no obvious pathological changes. Pathological section observation showed that the virus attack control group had severe interstitial pneumonia and a large number of submandibular lymph node lymphocyte necrosis, the polypeptide immunization group and the commercial vaccine immunization group showed mild to moderate interstitial pneumonia, submandibular lymph node lymphocyte reduction, a small number of lymphocyte necrosis, and no significant changes in the blank control group.

[0106] In summary, the three SLA-1*04:01:01 restricted PRRSV M protein T cell nonamin epitopes, like commercial vaccines, can induce SLA Hp-4.0 haplotype piglets to produce good antibodies, effectively reduce the virus load in pig blood and various tissues, alleviate the pathological damage caused by the virus, and provide better protection against PRRSV infection.

[0107] Since SLA-1*04:01:01 is a SLA allele locus commonly present in different breeds of pigs, the identification of the T cell epitope of the PRRSV M protein restricted by SLA-1*04:01:01 not only has important theoretical significance in revealing the pathogenesis of PRRS, but also can provide a reliable experimental basis for designing a more specific and effective new PRRSV polypeptide vaccine for my country's pig herds. The method for identifying epitope peptides established by the present invention can be used to identify T cell epitopes of other viruses, and has a good application prospect in the development and utilization of epitope peptide vaccines.

[0108] The peptide sequences of three PRRSV M protein SLA-1*04:01:01 restricted T cell epitopes M27, M39 and M49:

[0109] M27: TWKFITSRC(SEQ ID NO.1);

[0110] M39: NHAFVVRRP (SEQ ID NO.2);

[0111] M49: GRKAVKQGV (SEQ ID NO. 3).

[0112] Three nucleotide sequences M-N27, M-N39 and M-N49 encoding PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptides:

[0113] M-27: ACCTGGAAATTCATCACCTCCAGATGC (SEQ ID NO.4);

[0114] M-39: AACCACGCATTTGTCGTCCCGGCGTCCC (SEQ ID NO.5);

[0115] M-49: GGCAGAAAAGCTGTTAAGCAGGGAGTG (SEQ ID NO. 6).

Claims

1. A PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide, characterized in that: Its amino acid sequence is shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3.

2. A nucleic acid encoding a PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide.

3. The nucleic acid according to claim 2, characterized in that The nucleotide sequence is shown in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:

6.

4. A recombinant vector, characterized in that: The recombinant vector carries the nucleic acid according to claim 2 or 3.

5. A recombinant microbial cell, characterized in that Carrying the nucleic acid of claim 2 or 3 or expressing the antigen epitope polypeptide of claim 1.

6. A vaccine composition, characterized in that The vaccine composition contains the PRRSV M protein SLA-1*04:01:01 restricted T cell epitope polypeptide according to claim 1.

7. The vaccine composition according to claim 6, characterized in that The vaccine composition is a monovalent vaccine, a bivalent vaccine or a multivalent vaccine.

8. Use of the antigen epitope polypeptide according to claim 1, the nucleic acid according to claim 2 or 3, the recombinant vector according to claim 4 or the recombinant microbial cell according to claim 5 in the preparation of a kit for detecting porcine reproductive and respiratory syndrome virus-specific T cell response.

9. The antigen epitope polypeptide of claim 1, the nucleic acid of claim 2 or 3, the recombinant vector of claim 4 or the recombinant microbial cell of claim 5 is used in the preparation of SLA-1*04:01:01 / epitope peptide-complex tetramer for detecting specific CD8 induced by PRRSV infection + Application of the invention in T cell immune response reaction or in the preparation of medicine for treating or preventing PRRSV infection.

Images