Streptomyces coelicolor M145-chry and its application in fermentation production of chrysogenum
By constructing the M145-chry engineered strain of Streptomyces coelicolor, the heterologous expression of chlortetracycline was achieved, which solved the problem of industrial production of chlortetracycline in the existing technology and provided an efficient biosynthetic pathway suitable for the industrial production and research of chlortetracycline.
Patent Information
- Application Number
- CN202310387726.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-12
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2043-04-12
AI Technical Summary
The existing technology lacks suitable strains for the industrial production and biosynthesis of chloramphenicol, resulting in low potency, multiple components, high cost, and difficulty in large-scale preparation.
A Streptomyces coelicolor M145-chry engineered strain was constructed. The chrysogenycin biosynthesis gene cluster was introduced into the heterologous host Streptomyces coelicolor M145 through genetic engineering. The gene introduction was carried out using ExoCET DNA recombination technology and Redαβ homologous recombination technology to achieve heterologous expression of chrysogenycin.
Heterologous synthesis of chloramphenicol was achieved, with a total titer of 14.466±0.191 mg/L in shake flask fermentation, and the contents of chloramphenicol A, B and C were 10.878±0.110, 1.331±0.079 and 2.257±0.380 mg/L, respectively. It has good genetic stability and is suitable for the industrial production of chloramphenicol.
Smart Images

Figure BDA0004174655800000031 
Figure BDA0004174655800000041 
Figure BDA0004174655800000042
Abstract
Description
(1) Technical field
[0001] The invention relates to Streptomyces coelicolor M145-chry and application thereof in fermentation production of chrysomycin. (2) Background technology
[0002] Chlorophycin A is a group of glycosides with a benzonaphthopyrone structure. First discovered in 1955 from Streptomyces strain A-419 and later isolated from several other Streptomyces strains, it exhibits remarkable broad-spectrum biological properties, including antiphage, antibacterial, and cytotoxic activities. In particular, chlorophycin A exhibits potent inhibitory effects against multidrug-resistant (MDR) and extensively drug-resistant (XDR) Mycobacterium tuberculosis, methicillin-resistant Staphylococcus aureus (MRSA), and vancomycin-resistant Enterococci (VRE). Therefore, as a drug lead, chlorophycin A has great potential for application in the pharmaceutical industry, and a growing number of researchers, including chemists, biologists, and pharmacologists, have begun to focus on chlorophycins. However, the fermentation process of chlorophycin-producing bacteria presents problems such as low potency and multiple components, which make subsequent large-scale production expensive and difficult to separate.
[0003] Secondary metabolites in Streptomyces are synthesized primarily through chemical synthesis and biosynthesis. Due to the complex structures of many secondary metabolites, full chemical synthesis is often difficult to achieve, requiring tedious synthetic steps, resulting in low yields and associated chemical contamination. Therefore, industrial fermentation of complex natural products is often used for biosynthesis. Hosts for secondary metabolite production include both native strains and heterologous hosts. Unmodified native strains typically contain strong restriction and modification systems to protect them from external invasion, making genetic modification difficult. In contrast, heterologous hosts are typically engineered strains with a clear genetic background and mature molecular manipulation techniques. These hosts are typically optimized to fully heterologously express secondary metabolites. Genetic engineering techniques, such as overexpressing positive or negative regulators, replacing suitable promoters, or increasing precursor supply, can also be used to enhance natural product yields, study the synthesis and regulatory mechanisms of secondary metabolites, and discover potential new natural products. Furthermore, the expression of exogenous genes in fast-growing hosts can shorten fermentation cycles, facilitating industrial-scale production.
[0004] Research on chlortetracycline is ongoing both domestically and internationally, encompassing strain selection, genetic studies, chemical structure modification, and industrial production optimization. With the advancement of synthetic biology and the continuous advancement of genetic engineering technology, heterologous expression of microbial natural products is playing an increasingly important role in drug development. However, to date, no studies have reported heterologous expression of the chlortetracycline biosynthetic gene cluster. Therefore, heterologous expression of chlortetracycline may be an effective approach for studying the biosynthesis and metabolic regulation of chlortetracycline, as well as for discovering new chlortetracycline derivatives. (3) Summary of the invention
[0005] The present invention aims to provide a Streptomyces coelicolor M145-chry and its application in the fermentation production of chlortetracycline, realizing the heterologous expression of chlortetracycline for the first time, and solving the problem of lack of suitable strains for the industrial production of chlortetracycline and the study of biosynthetic pathways in the prior art.
[0006] The technical solution adopted in the present invention is:
[0007] The present invention provides an engineered bacterium that produces chrysomycin, namely Streptomyces coelicolor M145-chry, which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M20222084 and a deposit date of December 27, 2022. The deposit address is Wuhan University, Wuhan, China, with a postal code of 430072.
[0008] The construction of the chlortetracycline-producing engineered bacteria of the present invention includes introducing the chlortetracycline biosynthetic gene cluster into the heterologous host Streptomyces coelicolor M145 to obtain the engineered bacteria Streptomyces coelicolor M145-chry capable of producing chlortetracycline; the nucleotide sequence of the chlortetracycline biosynthetic gene cluster is shown as SEQ ID NO.1+SEQ ID NO.2+SEQ ID NO.3+SEQ ID NO.4+SEQ ID NO.5, wherein the chlortetracycline biosynthetic gene cluster is composed of the tail-to-head splicing of the sequences of SEQ ID NO.1+SEQ ID NO.3+SEQ ID NO.4+SEQ ID NO.5.
[0009] The method for constructing Streptomyces coelicolor M145-chry of the present invention is carried out as follows:
[0010] (1) Using ExoCET DNA recombination technology, the genomic DNA from Streptomyces spp. (gene accession number: CP050693) in GenBank was artificially synthesized to construct a recombinant vector p15A-chry containing the gene cluster;
[0011] (2) Redαβ homologous recombination technology was used to add the conjugative transfer element apra-oriT-attp-int to obtain the recombinant plasmid p15A-chry-phiC31;
[0012] (3) The plasmid obtained in step (2) was introduced into E. coli ET12567 / pUZ8002 by electroporation;
[0013] (4) The plasmid in step (2) is introduced into the genome of Streptomyces coelicolor M145 by conjugation transfer under the action of integrase to obtain an engineered strain producing chrysomycin, namely, Streptomyces coelicolor M145-chry.
[0014] The present invention also provides the use of the Streptomyces coelicolor M145-chry in the fermentation production of chlortetracycline. The method of the use is as follows: inoculating the Streptomyces coelicolor M145-chry into a fermentation medium, culturing at 28-30° C. and 180-220 rpm to obtain a fermentation liquid containing chlortetracycline;
[0015] The fermentation medium comprises: 5.0 g / L starch, 20.0 g / L glucose, 10.0 g / L soybean powder, 2.0 g / L calcium carbonate, the solvent is deionized water, and the pH value is natural.
[0016] Preferably, the fermentation culture conditions are a temperature of 30° C., a culture rotation speed of 220 rpm, and a culture time of 7 days.
[0017] Preferably, the Streptomyces coelicolor M145-chry is first subjected to seed culture before fermentation, and then the seed liquid is inoculated into the fermentation medium at an inoculum concentration of 1-5% (preferably 5%) by volume. The seed culture method is as follows: Streptomyces coelicolor M145-chry is inoculated into MS agar medium containing apramycin (50 μg / mL), activated at 30°C for 5 days, and then inoculated into TSB liquid medium, cultured at 30°C and 220 rpm for 48-72 hours to obtain the seed liquid. The MS agar medium is composed of: 20.0 g / L mannitol, 20.0 g / L soybean flour, 20.0 g / L agar, the solvent is deionized water, and the pH is natural; the TSB liquid medium is composed of: 17.0 g / L trypticase, 5.0 g / L sodium chloride, 3.0 g / L soybean papain digest, 2.5 g / L dipotassium hydrogen phosphate, 2.5 g / L glucose, the solvent is deionized water, and the pH is natural.
[0018] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in that the present invention constructs an engineered strain capable of synthesizing chlortetracycline, Streptomyces coelicolor M145-chry, by genetic engineering means. The total titer of shake flask fermentation is 14.466 ± 0.191 mg / L, of which the contents of chlortetracycline A, B and C are 10.878 ± 0.110, 1.331 ± 0.079 and 2.257 ± 0.380 mg / L, respectively. Moreover, the genetic stability is good. After five generations of subculture, the level of chlortetracycline production is comparable to that of the first generation, laying a technical foundation for the industrial production of chlortetracycline. The present invention realizes the heterologous synthesis of chlortetracycline for the first time, laying a foundation for further research on the synthesis and regulation mechanism of chlortetracycline and the discovery of new chlortetracycline derivatives. The method is simple to operate, efficient in application and has certain universality, providing an effective technical means for the development of large-fragment polyketide antibiotics. At the same time, the genetic stability of the engineered strain provided by the present invention is good, the plasmid is not lost after five generations, and the level of chlortetracycline production is comparable to that of the first generation, which can be applied to the industrial production of chlortetracycline. (IV) Description of the accompanying drawings
[0019] Figure 1 : Enzyme digestion map of plasmid p15A-chry. M: DNA marker; Lane 1: EcoRI digestion result.
[0020] Figure 2 : Restriction enzyme digestion map of plasmid p15A-chry-phiC31. M: DNA marker, lanes 1-6: AseI digestion results of different monoclonal clones.
[0021] Figure 3 : Gel image of PCR analysis of the genome of the engineered strain M145-chry. M: DNA marker; Lanes 1-4: Gel image of PCR analysis of the positive control plasmid template using DNR02-F / R, DNR03-F / R, DNR04-F / R, and DNR05-F / R as the top and bottom primers, respectively; Lanes 5-8: Gel image of PCR analysis of the genome of the engineered strain using DNR02-F / R, DNR03-F / R, DNR04-F / R, and DNR05-F / R as the top and bottom primers, respectively.
[0022] Figure 4 : HPLC analysis of fermentation products of the engineered strain M145-chry. In the figure, (A) is the spectrum of the control strain without the chrysogenycin gene cluster introduced. (B) is the spectrum of the fermentation products of the engineered strain M145-chry.
[0023] Figure 5PCR detection of p15A-chry-phiC31 in serially subcultured engineered strain M145-chry. (A), (B), and (C) are gel images of PCR detection using DNR02-F / R, DNR04-F / R, and DNR05-F / R primers, respectively. M: DNA marker; +: plasmid template used as positive control; -: negative control. G1-5: 1st to 4th subcultures.
[0024] Figure 6 : Fermentation yield analysis of engineered strain M145-chry from the first to the fifth generation.
[0025] Figure 7 : The effect of chlortetracycline expression on the growth of recombinant strains. (V) Specific implementation methods
[0026] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:
[0027] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples are commercially available unless otherwise specified. The Escherichia coli ET12567 / pUZ8002 used in the following examples was purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd., Streptomyces coelicolor M145 was found in the literature (BentleySD, et al. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature, 2022, 417: 141-147.), plasmids p15A-cm-tetR-tetO-hyg-ccdB and pR6k-oriT-attp-phiC31 were found in the literature (Wang HL, et al. RecET direct cloning and Redαβrecombineering of biosynthetic gene clusters, large operons or single genes for heterologous expression. Nat Protoc, 2016, 11: 1175-1190.), Escherichia coli GBdir-ETgA and Escherichia coli GB08-red were found in the literature (Fu J, et al. Full-length RecE enhances linear-linear homologous recombination and facilitates direct cloning for bioprospecting. Nat Biotechnol, 2012, 30: 440-446.).
[0028] The culture medium and solutions used in the examples are:
[0029] (1) Seed culture medium (TSB medium): 17.0 g / L trypticase, 5.0 g / L sodium chloride, 3.0 g / L soybean papain digest, 2.5 g / L potassium hydrogen phosphate, 2.5 g / L glucose, solvent is deionized water, pH natural.
[0030] (2) Fermentation medium: 5.0 g / L starch, 20.0 g / L glucose, 10.0 g / L soybean powder, 2.0 g / L calcium carbonate, solvent: deionized water, pH natural.
[0031] (3) MS solid medium: 20.0 g / L mannitol, 20.0 g / L soybean powder, 20.0 g / L agar, solvent is deionized water, pH natural.
[0032] (4) LB solid medium: 10.0 g / L tryptone, 5.0 g / L yeast extract, 1.0 g / L sodium chloride, 20.0 g / L agar powder, solvent is deionized water, pH natural.
[0033] (5) LB liquid medium: 10.0 g / L tryptone, 5.0 g / L yeast extract, 1.0 g / L sodium chloride, solvent is deionized water, pH natural.
[0034] (6) 2×YT: 10 g / L yeast extract, 16 g / L tryptone, 5 g / L sodium chloride, solvent is deionized water, pH 7.0.
[0035] (7) SET buffer: Weigh 1.146 g of TES powder, add 80 mL of deionized water, stir to dissolve, adjust the pH to 8.0, and then make up to 100 mL. Sterilize with a 0.22 μm filter and store at 4°C.
[0036] Example 1: Cloning of the chlortetracycline biosynthetic gene cluster
[0037] (1) The restriction endonuclease digestion reaction system in Table 1 was used to digest the artificially synthesized genomic DNA from Streptomyces sp. in GenBank (gene accession number: CP050693) with the restriction endonuclease BsrGI, and digested at 37°C for 8 h. After the digestion was completed, the digestion product was purified and recovered using the phenol-chloroform-isoamyl alcohol (25:24:1, v / v / v) method. The recovered product was verified using agarose gel to obtain a fragment containing the complete chrysomehizobactam gene cluster (denoted as chry). The nucleotide sequence of the chrysomehizobactam gene cluster is shown in SEQ ID NO.1+SEQ ID NO.2+SEQ ID NO.3+SEQ ID NO.4+SEQID NO.5.
[0038] Table 1 Restriction enzyme digestion reaction system
[0039]
[0040] (2) Using the PCR amplification system in Table 2, the vector p15A-cm-tetR-tetO-hyg-ccdB was amplified using primers DNR01-F / R with homology arms, so that the homology arms of the target gene cluster were attached to both ends of the vector to obtain a cloning vector.
[0041] Primer DNR01-F (SEQ ID NO.6):
[0042] gcagggtcggcctgagcgccggaccggctcccgtgatcctgccggtgaacttcctggtcgacggccgcaccatcgtagatccgaaaacccc aagttacg.
[0043] Primer DNR01-R (SEQ ID NO. 7):
[0044] ggccgtagatcgcgcccagcagggccagtttggcctggtcgcggtcgccggagaacgcccgctcggagagggccgtagatcctttctcctct ttagatc.
[0045] Table 2 PCR amplification system
[0046]
[0047] (3) The fragment containing the complete chrysogenycin gene cluster in step (1) and the cloning vector in step (2) were treated with T4 DNA polymerase according to the RecET recombinant T4 DNA polymerase reaction system in Table 3 and the RecET recombinant T4 DNA polymerase reaction procedure in Table 4, and then electroporated into Escherichia coli GBdir-ETgA expressing RecET recombinase. The cells were then spread on LB plates containing chloramphenicol (10 μg / mL) and cultured at 37°C for 16 h.
[0048] Table 3 RecET recombinant T4 DNA polymerase reaction system
[0049]
[0050] Table 4 RecET recombinant T4 DNA polymerase reaction program
[0051]
[0052] (4) The single clone grown in step (3) was subjected to plasmid extraction and then digested with EcoRI enzyme and sequenced for verification. The digestion results were as follows: Figure 1 The results show that the recombinant plasmid p15A-chry containing the chrysomelin synthesis gene cluster was screened out.
[0053] (5) The gene fragment containing apra-oriT-attp-int was cut out from the pR6k-oriT-attp-phiC31 plasmid using AseI enzyme, i.e., the combined transfer element.
[0054] (6) The plasmid p15A-chry obtained in step (4) and the apra-oriT-attp-int gene fragment obtained in step (5) were mixed and introduced into Escherichia coli GB08-red by electroporation. Using Redαβ homologous recombination technology, linear-loop recombination was performed under the action of Redαβ recombinase. The cells were then plated on LB plates containing 10 μg / mL apramycin and cultured at 37°C for 16 h.
[0055] (7) The monoclonal clone grown in step (6) was subjected to plasmid extraction and then digested with AseI enzyme and sequenced for verification. The digestion results were as follows: Figure 2 As shown, the recombinant plasmid p15A-chry-phiC31 with the chlortetracycline synthesis gene cluster and the conjugated transfer element inserted was obtained.
[0056] Example 2: Heterologous expression of the chlortetracycline biosynthetic gene cluster
[0057] (1) The recombinant plasmid p15A-chry-phiC31 obtained in Example 1 was electrotransformed into the Escherichia coli ET12567 / pUZ8002 strain, and the positive strains were screened to obtain the Escherichia coli ET12567 / pUZ8002 strain containing the recombinant plasmid p15A-chry-phiC31. The positive strains were inoculated into 10 mL LB liquid culture medium containing chloramphenicol (10 μg / mL), kanamycin (10 μg / mL), and apramycin (50 μg / mL) and cultured at 37°C and 220 rpm until the OD 600 The cells were collected by centrifugation at 12,000 rpm for 1 min at a concentration of 0.4-0.6, and washed twice with antibiotic-free LB medium, and finally resuspended with 1 mL of antibiotic-free LB medium.
[0058] (2) Add TES buffer to the MS plate covered with Streptomyces coelicolor M145 spores. Gently scrape the spores with a sterile cotton swab and filter out the remaining mycelium with a sterile cotton ball to obtain the Streptomyces spore solution. Wash the spores twice with TES buffer and add 1 mL of TES to suspend the spores. Place the centrifuge tube in a 50°C water bath, heat shock for 10 minutes, and then cool in ice water. Add an equal volume of 2×YT medium to the heat-shocked spore solution and incubate at 30°C and 220 rpm for 3 hours. Centrifuge at 12,000 rpm for 1 minute, wash the bacteria twice with antibiotic-free LB medium, and finally resuspend in 200 μL of antibiotic-free LB medium.
[0059] (3) Mix 100 μL of E. coli and 200 μL of Streptomyces spore solution prepared in steps (1) and (2) and spread on MS plate culture medium containing 10 mM MgCl2. Place the plate in a 28°C incubator and culture overnight for 12 h to 16 h (until light mist-like colonies grow).
[0060] (4) Spread 1 mL of sterile ddH2O (containing 500 μg / mL nalidixic acid and 1 mg / mL apramycin antibiotic) on the plate prepared in step (3), and then culture in a 30°C incubator (until spores grow, about 5-7 days).
[0061] (5) Single colonies were selected for culture and genomic DNA was extracted. Three pairs of primers, DNR02-F / R, DNR03-F / R, and DNR04-F / R, were designed upstream, midstream, and downstream of the gene cluster, and primer DNR05-F / R was designed upstream and downstream of the apramycin resistance gene for PCR amplification verification. The PCR verification results were as follows: Figure 3 The engineered bacteria into which the chrysomycin biosynthesis gene cluster was inserted were obtained, named Streptomyces coelicolor M145-chry, and deposited in the China Center for Type Culture Collection (CCTCC) with the deposit number CCTCC NO: M20222084. The deposit date was December 27, 2022, and the deposit address was Wuhan University, Wuhan, China, with a postal code of 430072.
[0062] Table 5 Primer sequences
[0063] Primers sequence Primers sequence DNR02-F tcacctccaccaccaacta DNR04-F gcgaagaaatacaaaaagc DNR02-R actgccgactctctaccgt DNR04-R gcacgaaagtactgacacc DNR03-F ggtgagcagggaccagaag DNR05-F tctcaccaataaaaaacgc DNR03-R gggcacgagttgaagaagc DNR05-R gctgaagaaagacaatccc
[0064] Example 3: Detection of Streptomyces coelicolor M145-chry fermentation products
[0065] (1) Streptomyces coelicolor M145-chry constructed in Example 3 was inoculated into MS agar medium containing apramycin (50 μg / mL), activated at 30°C for 5 days, and then inoculated into TSB liquid medium. After culturing at 30°C and 220 rpm for 3 days, a seed solution was obtained;
[0066] (2) The seed liquid obtained in step (1) was inoculated into the fermentation medium at a volume concentration of 5%, and cultured at 30° C. and 220 rpm for 7 days to obtain a fermentation liquid.
[0067] (3) The fermentation broth obtained in step (2) was extracted three times with twice the volume of ethyl acetate, and the mycelium was ultrasonicated three times with twice the volume of methanol at room temperature, each time for 20 minutes, with an ultrasonic frequency of 40KHZ. After the extraction and ultrasonication were completed, the methanol solution was completely evaporated by rotary evaporation, and then dissolved in 1 mL of chromatographic methanol, filtered through a 0.22 μm needle-type microporous filter membrane, and detected by HPLC. The chromatographic results were as follows: Figure 4 .
[0068] (4) Chlorhexine A, B, and C standards were prepared with methanol to form a concentration gradient solution. The chlorhexine in the fermentation product was quantitatively analyzed by HPLC and a standard curve was drawn. The total titer of chlorhexine in the shake flask fermentation of Streptomyces coelicolor M145-chry was 14.466±0.191 mg / L, of which the contents of chlorhexine A, B, and C were 10.878±0.110, 1.331±0.079, and 2.257±0.380 mg / L, respectively, with a ratio of 75:9:16.
[0069] The HPLC detection conditions are as follows: a Phenomenex (Luna, 250×4.6 mm) C18 column was used, the HPLC mobile phase was acetonitrile and water in a 1:1 isocratic elution, the mobile phase flow rate was 1 mL / min, the detection wavelength was 287 nm, and the injection volume was 10 μL.
[0070] Example 4: Genetic Stability Analysis of Streptomyces coelicolor M145-chry
[0071] The Streptomyces coelicolor M145-chry obtained in Example 2 was subcultured four times on MS solid medium. The genetic stability of the recombinant plasmid p15A-chry-phiC31 and the production of chlortetracycline were detected by PCR and HPLC. Primer pairs DNR02-F / R, DNR04-F / R, and DNR05-F / R were used to identify the plasmid p15A-chry-phiC31. Fermentation of the strain, chlortetracycline extraction, and HPLC analysis were performed according to the steps in Example 3. Figure 5 The results show that the genetic analysis by PCR showed that the recombinant plasmid p15A-chry-phiC31 was still present in the engineered strain after 4 passages. Figure 6 As shown, the chlortetracycline production of the engineered strain remained relatively stable after four consecutive subcultures.
[0072] Example 5: Analysis of bacterial cell mass in heterologous expression hosts
[0073] The growth of Streptomyces coelicolor M145-chry and Streptomyces coelicolor M145 obtained in Example 2 in the fermentation medium was detected by using the method of Example 3. Samples were taken every 24 hours, the dry weight of the cells was measured, and the growth curve of the strain was plotted. Figure 7Comparing the growth of the engineered and original strains revealed no significant difference in bacterial mass, indicating that inserting large DNA fragments into the heterologous host genome did not significantly affect host growth. Furthermore, the heterologous host, Streptomyces coelicolor, entered a plateau phase after 48 hours of fermentation, reaching a dry weight of 7.633 g / L, demonstrating a significant growth advantage for this strain.
[0074] To measure the dry weight of the cells, transfer 1 mL of fermentation broth to a weighed 1.5 mL centrifuge tube. Centrifuge at 12,000 rpm for 10 minutes, remove the supernatant, and dry the pellet in a 60°C oven until constant weight is reached (approximately 24 hours). Subtract the tube weight from the weight of the pellet to obtain the cell weight per mL. Repeat this experiment three times.
[0075] As can be seen from the above examples, the present invention provides an effective technical means for heterologous expression of large polyketide antibiotics, which is simple to operate, highly effective in application, and has a certain degree of universality. Furthermore, the engineered strain Streptomyces coelicolor M145-chry provided by the present invention has good genetic stability, with no plasmid loss after five generations and chrysomycin production levels comparable to those of the first generation, making it suitable for subsequent chrysomycin research.
[0076] The embodiment described above is only a preferred solution of the present invention and does not limit the present invention in any form. Any modifications, replacements and improvements made on the basis of the present invention should be included in the scope of protection of the present invention.
Claims
1. Streptomyces coelicolor M145-chry, deposited in China Center for Type Culture Collection, with the deposit number CCTCC NO: M20222084, deposit date December 27, 2022, at Wuhan University, Wuhan, China, zip code 430072.
2. Use of the Streptomyces coelicolor M145-chry according to claim 1 in the fermentation production of chrysomycin.
3. The use according to claim 2, characterized in that The application method comprises the following steps: inoculating the Streptomyces coelicolor M145-chry into a fermentation medium, culturing the medium at 28-30° C. and 180-220 rpm to obtain a fermentation liquid containing chrysomycin; the fermentation medium comprises: 5.0 g / L starch, 20.0 g / L glucose, 10.0 g / L soybean powder, 2.0 g / L calcium carbonate, the solvent is deionized water, and the pH value is natural.
4. The use according to claim 3, characterized in that The culture conditions were 30°C, 220 rpm, and 7 days.
5. The use according to claim 3, characterized in that The Streptomyces coelicolor M145-chry is first subjected to seed culture before fermentation, and then the seed liquid is inoculated into a fermentation medium at an inoculum size of 1-5% by volume. The seed culture method comprises the following steps: inoculating the Streptomyces coelicolor M145-chry into an MS agar medium containing 50 μg / mL apramycin, activating the medium at 30°C for 5 days, then inoculating the medium into a TSB liquid medium, and culturing the medium at 30°C and 220 rpm for 48-72 hours to obtain the seed liquid; the MS agar medium comprises 20.0 g / L mannitol, 20.0 g / L soybean powder, 20.0 g / L agar, the solvent is deionized water, and the pH value is natural; and the TSB liquid medium comprises 17.0 g / L trypticase, 5.0 g / L sodium chloride, 3.0 g / L soybean papain digest, 2.5 g / L dipotassium hydrogen phosphate, and 2.5 g / L glucose, the solvent is deionized water, and the pH value is natural.
Citation Information
Patent Citations
Streptomyces mutant strain and application of mutant strain
CN113278545A
Streptomyces aureus mutant strain with high aureomycin yield and low impurity proportion and application thereof
CN113549579A