A method for improving the production of gamma-polyglutamic acid

By mutating the rapA gene and introducing it into a γ-polyglutamic acid producing strain, the problem of time-consuming and labor-intensive methods for increasing γ-polyglutamic acid yield in existing technologies has been solved, resulting in a significant increase in yield.

CN116694658BActive Publication Date: 2026-02-10GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310126003.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-17
Publication Date
2026-02-10
Estimated Expiration
2043-02-17

AI Technical Summary

Technical Problem

Existing technologies for increasing γ-polyglutamic acid production are time-consuming, labor-intensive, have long gene editing cycles, and limited effectiveness.

Method used

By mutating the rapA gene, changing its nucleotide sequence from A to G at position 575, resulting in the amino acid changing from aspartic acid to glycine, and replacing the rapA gene in the γ-polyglutamic acid producing strain, the mutated gene was introduced into the producing strain using homologous recombination technology, thus significantly increasing the yield of γ-polyglutamic acid.

Benefits of technology

The yield of γ-polyglutamic acid was significantly increased, with the yield of Bacillus licheniformis ATCC9945a increasing from 29.54 g/L to 35.54 g/L, and the yield of Bacillus subtilis PGA-7 increasing from 16.23 g/L to 25.24 g/L.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The application discloses a method for improving the yield of gamma-polyglutamic acid. The method is to replace the rapA gene in a gamma-polyglutamic acid producing strain by a mutant gene rapA, so that the yield of gamma-polyglutamic acid of the producing strain is significantly improved. The nucleotide sequence of the mutant gene rapA is shown in SEQ ID NO. 1, and the base at the 575th position is mutated from A to G. The bacillus velezensis PGA-224 contains the mutant gene rapA, and the preservation number is GDMCC No. 62295. The mutant rapA gene is used to replace the rapA gene in the gamma-polyglutamic acid producing strain, so that the yield of gamma-polyglutamic acid is significantly improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a method for increasing the yield of γ-polyglutamic acid. Background Technology

[0002] γ-Polyglutamic acid is an extracellular polymer synthesized by microorganisms. It is a homopolymer amino acid formed by the polymerization of glutamic acid monomers through γ-glutamine bonds. It has excellent properties such as strong water absorption, biodegradability, strong biocompatibility, and non-toxicity, and has broad application prospects in industries such as industry, food, medicine, environment, agriculture, and daily chemicals.

[0003] γ-Polyglutamic acid (γ-Polyglutamic acid) is primarily produced by bacteria of the genus *Bacillus*. Industrial production of γ-Polyglutamic acid mainly involves *Bacillus belye*, *Bacillus subtilis*, and *Bacillus licheniformis*. Current methods for increasing γ-Polyglutamic acid yield primarily involve screening high-yielding strains in natural environments, adjusting culture medium formulations, and gene editing. Changing the fermentation medium offers limited improvement, while screening new strains is time-consuming and labor-intensive. Gene editing mainly involves knocking out the genes of enzymes that degrade γ-Polyglutamic acid and replacing the promoters of glutamate and γ-Polyglutamic acid synthases. However, editing multiple genes is time-consuming. The rapA gene primarily encodes the dephosphorylated SpoOF-P protein. The SpoOF-P protein promotes the phosphorylation of SpoOA, allowing the bacteria to enter the spore cycle. This invention takes a different approach, replacing the rapA gene in the γ-Polyglutamic acid producing strain with a mutated rapA gene, significantly increasing the γ-Polyglutamic acid yield of this strain. Summary of the Invention

[0004] The purpose of this invention is to provide a method for increasing the yield of γ-polyglutamic acid by replacing the rapA gene in γ-polyglutamic acid producing bacteria with a mutated gene.

[0005] The first objective of this invention is to provide a mutant gene rapA that increases the production of γ-polyglutamic acid, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] Specifically, the protein expressed by the gene is a dephosphorylase (rapA). The rapA gene has a missense mutation at position 575, where the base is changed from A to G. This mutation changes the amino acid at position 192 of its peptide chain from aspartic acid to glycine.

[0007] A second objective of this invention is to provide a strain containing the mutant gene rapA.

[0008] Preferably, the strain is Bacillus belye PGA-224, deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC); accession number GDMCC No. 62295; deposit date: March 16, 2022; deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, China, postcode: 510070.

[0009] The third objective of this invention is to provide a method for increasing the yield of γ-polyglutamic acid, characterized by comprising the following steps: replacing the rapA gene in the γ-polyglutamic acid producing strain with the mutant gene rapA, thereby significantly increasing the yield of γ-polyglutamic acid in the producing strain.

[0010] Preferably, the method includes the following steps:

[0011] (1) Synthesize the sgRNA sequence of the rapA gene in the genome of γ-polyglutamic acid producing bacteria;

[0012] (2) Insert the sgRNA sequence into the pJOE8999 plasmid to obtain pJOE8999-sgRNA;

[0013] (3) The pJOE8999-sgRNA was digested with enzymes;

[0014] (4) Amplify the upstream and downstream homologous sequences of the rapA gene of γ-polyglutamic acid producing bacteria;

[0015] (5) Amplify the mutated gene rapA sequence;

[0016] (6) Homologous recombination was performed on the enzyme-digested pJOE8999-sgRNA plasmid, the upstream and downstream homologous sequence fragments of the rapA gene of the γ-polyglutamic acid producing bacteria and the mutant gene rapA sequence fragment to obtain pJOE8999-sgRNA-rapA224 plasmid.

[0017] (7) The pJOE8999-sgRNA-rapA224 plasmid was transferred into γ-polyglutamic acid producing bacteria and fermented to produce γ-polyglutamic acid.

[0018] Preferably, the specific steps are as follows:

[0019] (1) In the genome of γ-polyglutamic acid producing bacteria, tacg is added to the 5' end of the rapA gene sequence immediately preceding the 5'-NGG PAM motif, and aaac is added to the 5' end of the complementary sequence to obtain the sgRNA sequence and synthesize the sgRNA sequence.

[0020] (2) The pJOE8999 plasmid was digested with BsaI and then recovered by gel extraction; the digested plasmid was linked with the sgRNA sequence to obtain pJOE8999-sgRNA.

[0021] (3) The pJOE8999-sgRNA plasmid was digested with SmaI and XbaI double enzymes;

[0022] (4) Using the genomic DNA of γ-polyglutamic acid producing bacteria as a template, the upstream and downstream homologous sequences of the rapA gene were amplified by PCR using specific primers.

[0023] (5) Using the genomic DNA of Bacillus belyss PGA-224 as a template, the mutant gene rapA gene sequence was amplified by PCR using specific primers;

[0024] (6) Homologous recombination was performed on the enzyme-digested pJOE8999-sgRNA plasmid, the upstream and downstream homologous sequence fragments of the rapA gene of the γ-polyglutamic acid producing bacteria amplified, and the rapA sequence fragment of the mutant gene of Bacillus belyss PGA-224 amplified to obtain the pJOE8999-sgRNA-rapA224 plasmid.

[0025] (7) The pJOE8999-sgRNA-rapA224 plasmid was transformed into γ-polyglutamic acid producing bacteria. Transformants were selected on LB plates containing 20 μg / mL kanamycin and 1.0 g / L mannose at 30°C. Positive mutants grown on the plates were transferred to ordinary LB plates to eliminate the plasmid at 45°C. Positive clones were then screened by colony PCR using validation primers. Positive clones were fermented to produce γ-polyglutamic acid.

[0026] Preferably, the sequences of the verification primers are: rapA-yF: ATGAAGCAGACTATTCCGTCCT and rapA-yR: TAGACAATCTCCTCTCTGGATT.

[0027] Preferably, the γ-polyglutamic acid producing bacteria is Bacillus subtilis, Bacillus licheniformis, or Bacillus belesii.

[0028] The fourth objective of this invention is to provide the application of the mutant gene rapA and the strain Bacillus belyssus PGA-224 in increasing the production of γ-polyglutamic acid.

[0029] The beneficial effects of this invention are as follows: replacing the rapA gene in the γ-polyglutamic acid producing strain with a mutated rapA gene significantly increases the γ-polyglutamic acid yield. The γ-polyglutamic acid content of Bacillus licheniformis ATCC9945a reaches 29.54 g / L, while the γ-polyglutamic acid content of the gene-edited Bacillus licheniformis ATCC9945a-224rapA reaches 35.54 g / L, demonstrating a significant increase in γ-polyglutamic acid yield.

[0030] Bacillus velezensis PGA-224 is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC); accession number GDMCC No. 62295; deposit date: March 16, 2022; deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, China, postcode: 510070. Detailed Implementation

[0031] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0032] The Bacillus licheniformis used in the following examples is Bacillus licheniformis ATCC9945a, with accession number ATCC No: 9945a. The Bacillus subtilis used is Bacillus subtilis PGA-7, with accession number CCTCC NO: M206102. This strain is disclosed in patent CN200610122640.5, entitled "γ-Polyglutamic Acid Producing Bacteria and Method for Preparing γ-Polyglutamic Acid Using This Strain".

[0033] Example 1:

[0034] The starting strain, *Bacillus belye* PGA-7.1, was inoculated onto solid culture plates and incubated at 37°C for 24 hours. The bacterial cells were eluted from the plates with 2 mL of sterile water. The mixture was then mixed with skim milk to a final concentration of 10% (v / v). 1.5 mL of the bacterial culture was dispensed into 2 mL cryovials and incubated at 4°C for 30 minutes, then at -20°C for 90 minutes, and finally at -80°C overnight. The culture was then freeze-dried, packaged, and transferred to Beijing Aerospace Company. Another tube of freeze-dried bacterial powder served as a ground control strain. Before launch, the control sample was placed in a 4°C freezer. After launch, the control sample was placed in the natural environment. The samples carried on board were retrieved and placed in a 4°C freezer along with the carry-on samples. After launch, the bacterial culture from the carry-on samples was eluted into 10 mL of sterile water, diluted, and plated onto solid culture plates. After incubation for 24-48 hours, single colonies were picked and screened using well plates. The solid culture medium consists of: 10 g / L peptone, 3 g / L beef extract, 5 g / L sodium chloride, 20 g / L agar, with the remainder being water, and a pH of 7.0–7.2. The preparation method involves mixing the above components thoroughly, adjusting the pH, and then sterilizing for later use.

[0035] The semi-solid fermentation medium was melted, and 100 μL of the melted medium was added to a 96-well plate. The distance between the melted medium surface and the plate cap was 5 mm. The semi-solid fermentation medium consisted of the following components per liter: glycerol 30 g / L, peptone 50 g / L, citric acid 15 g / L, magnesium sulfate heptahydrate 0.6 g / L, dipotassium hydrogen phosphate 1 g / L, ammonium chloride 7 g / L, manganese sulfate monohydrate 0.104 g / L, and agar 2 g / L, with the balance being water. The pH was 6.5.

[0036] After the culture medium in the well plate solidifies, a single colony from the nutrient agar plate is picked up with a toothpick and transferred into the well of a 96-well culture plate containing semi-solid fermentation medium. The plate is then capped. The plate is then inverted and placed in an incubator with a relative humidity maintained above 80% at 37°C for 96 hours. γ-Polyglutamic acid (γ-Polyglutamic acid) is a product secreted extracellularly and has significant viscosity. When the well plate is inverted for culture, if the γ-Polyglutamic acid production is high and accumulates significantly, its own gravity exceeds its viscosity, causing the product to drip onto the plate cap. If the γ-Polyglutamic acid production is low, its own gravity is less than its viscosity, and the product remains within the well plate. Therefore, visually observing the presence of liquid product on the plate cap is crucial. The wells corresponding to the positions of the plate caps with liquid product are inoculated with strains that produce high levels of γ-Polyglutamic acid. Thus, Bacillus velezensis PGA-224, a high-yielding γ-Polyglutamic acid bacterium, was selected. Bacillus belye PGA-224 is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC); accession number GDMCC No. 62295; deposit date: March 16, 2022; deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, China, Postcode: 510070.

[0037] Example 2:

[0038] The selected *Bacillus belyssioides* strain PGA-224 was inoculated onto solid culture medium slant and incubated at 37°C for 16–24 h to obtain activated *Bacillus belyssioides* strain PGA-224. The solid culture medium consisted of the following components per liter: peptone 10 g / L, beef extract 3 g / L, sodium chloride 5 g / L, agar 20 g / L, with the remainder being water; pH 7.0–7.2. The preparation method involved mixing the above components thoroughly, adjusting the pH, and then sterilizing.

[0039] Preparation of seed culture: Take 2 loops of the activated Bacillus berghei PGA-224 strain and inoculate it into a 300mL Erlenmeyer flask containing 50mL of fermentation medium. Incubate at 37℃ with shaking at 100r / min for 18h to obtain Bacillus berghei PGA-224 seed culture. The fermentation medium consists of the following components per liter: 30g citric acid glycerol, 50g peptone, 15g citric acid, 0.6g magnesium sulfate heptahydrate, 1g dipotassium hydrogen phosphate, 7g ammonium chloride, and 0.104g manganese sulfate monohydrate, with the remainder being water, pH 6.5. The preparation method involves mixing the above components thoroughly, adjusting the pH, and then sterilizing.

[0040] Liquid shake-flask fermentation: Prepare the fermentation medium according to the above formula and dispense 50 mL into 300 mL Erlenmeyer flasks. Inoculate the Bacillus belye PGA-224 seed culture into the fermentation medium at an inoculation rate of 10% by volume. Fermentation temperature: 37℃. Culture on a rotary shaker at 250 r / min for 7 days. After fermentation, the yield of γ-polyglutamic acid (detection method is existing technology, such as patent CN200610122640.5, invention title: Test method for γ-polyglutamic acid producing bacteria and method for preparing γ-polyglutamic acid using this strain) was found to be 9.543 g / L.

[0041] Example 3:

[0042] One loop of activated *Bacillus belyssus* PGA-224 and the originating strain *Bacillus belyssus* PGA-7.1 were inoculated into 300 mL Erlenmeyer flasks containing 50 mL of nutrient broth, and cultured at 37 °C with shaking at 100 rpm for 18 h. The nutrient broth consisted of: 10 g / L peptone, 3 g / L beef extract, 5 g / L sodium chloride, 20 g / L agar, with the remainder being water, and a pH of 7.0–7.2. The broth was prepared by mixing the above components thoroughly, adjusting the pH, and then sterilizing. The samples were centrifuged at 8000 rpm for 10 min (4 °C), the supernatant was discarded, and the precipitate was washed twice with sterile water, frozen in liquid nitrogen, and delivered on dry ice. The originating strain *Bacillus belyssus* PGA-7.1 was used for whole-genome sequencing, and the genome of the mutant strain *Bacillus belyssus* PGA-224 was re-sequencing to analyze the mutation sites in *Bacillus belyssus* PGA-224. The mutation site is the base at position 575 of the rapA gene, which is changed from A to G, resulting in a missense mutation. The gene sequence after the mutation is shown in SEQ ID NO.1.

[0043] The mutant rapA gene (1137 bp) of Bacillus belyssus PGA-224 has the nucleotide sequence shown in SEQ ID NO.1.

[0044] Example 4:

[0045] Gene editing of Bacillus licheniformis ATCC No: 9945a:

[0046] (1) Synthesize the sgRNA sequence of the rapA gene of Bacillus licheniformis ATCC No: 9945a: sgRNA-F: tacgTACGGACGCCGAAATGCTGA, sgRNA-R: aaacTCAGCATTTCGGCGTCCGTA.

[0047] (2) The pJOE8999 plasmid (purchased from Shanghai Haijihaoge Biotechnology) was digested with BsaI and recovered by gel extraction; the digested plasmid was linked with the sgRNA sequence to obtain pJOE8999-sgRNA.

[0048] (3) The pJOE8999-sgRNA plasmid was digested with SmaI and XbaI and then recovered by gel extraction.

[0049] (4) Using genomic DNA from Bacillus licheniformis ATCC No: 9945a as a template, the upstream and downstream homologous sequences of the rapA gene were amplified using PCR-specific primers. The sequences were 800 bp in length, and the amplified sequences were recovered via gel electrophoresis. The primers were:

[0050] The amplification primers for the upstream homologous sequence are:

[0051] rapA-UF: gtcgacggccaacgaggcccgggCGGCGCCGGGAACTGTCGCCAA

[0052] rapA-UR: gacggaatagtctgcttcatCCCTTACGCCCCTTCCTTTTAT

[0053] The amplification primers for the downstream homologous sequence are:

[0054] rapA-DF:tccagaggagattgtctaTATGAAATCTAAACTGTTGTTA

[0055] rapA-DR: gatgaagattatttcttaatctagaCGGGTGACTGATGGATCAGCCT

[0056] (5) Using genomic DNA from Bacillus belyssus PGA-224 as a template, the rapA gene sequence was amplified by PCR using specific primers, and the amplified sequence was recovered by gel electrophoresis. The primers were as follows:

[0057] 224rapA-F:aaaaggaaggggcgtaagggATGAAGCAGACTATTCCGTCCT

[0058] 224rapA-R: acaacagtttagatttcataTAGACAATCTCCTCTCTGGATT

[0059] (6) The digested pJOE8999-sgRNA plasmid, the upstream and downstream homologous sequence fragments of the rapA gene from Bacillus licheniformis amplified, and the rapA gene sequence fragment from Bacillus belyssus PGA-224 amplified were added to recombinase and incubated at 50°C for 15 minutes. The recombinant products were then transformed into E. coli, and transformants were selected on LB plates containing 50 μg / mL kanamycin. Cell PCR was then performed using rapA-UF and rapA-DR to verify the transformants; a PCR product of 2600 bp was considered a correct positive transformant. Correct positive transformants were cultured overnight at 37°C in LB broth containing 50 μg / mL kanamycin. Finally, the cells were collected, and the plasmid was extracted to obtain the pJOE8999-sgRNA-rapA224 plasmid.

[0060] (7) The pJOE8999-sgRNA-rapA224 plasmid was transformed into Bacillus licheniformis. Transformants were selected on LB plates containing 20 μg / mL kanamycin and 1.0 g / L mannose at 30°C. Positive mutants grown on the plates were transferred to ordinary LB plates to eliminate the plasmid at 45°C. Several clones were then screened by colony PCR using validation primers. Genetically edited Bacillus licheniformis ATCC9945a-224rapA strain was obtained. The sequences of the validation primers are as follows:

[0061] rapA-yF:ATGAAGCAGACTATTCCGTCCT

[0062] rapA-yR:TAGACAATCTCCTCTGGATT

[0063] Example 5:

[0064] The preparation steps for activating Bacillus licheniformis strain ATCC9945a-224rapA were the same as in Example 2.

[0065] Preparation of Bacillus licheniformis ATCC9945a-224rapA seed culture: Take 2 loops of the above-mentioned activated Bacillus licheniformis ATCC9945a-224rapA strain, inoculate it into fermentation medium, and culture it in a shaker at 37℃ for 18 hours at a shaking speed of 200 r / min. This is the seed culture. The fermentation medium consists of: citric acid 12 g / L, glycerol 80 g / L, L-glutamic acid 20 g / L, ammonium chloride 7 g / L, dipotassium hydrogen phosphate 0.5 g / L, magnesium sulfate heptahydrate 0.5 g / L, calcium chloride dihydrate 0.15 g / L, manganese sulfate monohydrate 0.104 g / L, ferric chloride hexahydrate 0.04 g / L, with the balance being water, and adjust the pH to 6.5. The preparation method is to mix the above components evenly, adjust the pH value, and then sterilize for later use.

[0066] Liquid shake-flask fermentation: Fermentation medium was dispensed into 300mL Erlenmeyer flasks (50mL each). Bacillus licheniformis ATCC9945a-224rapA seed culture was inoculated into the fermentation medium at a volume fraction of 10%. Fermentation was carried out at 37℃ on a shaker at 200 rpm for 96 hours. The yield of γ-polyglutamic acid was determined to be 35.54 g / L.

[0067] Example 6:

[0068] Gene editing of Bacillus subtilis PGA-7:

[0069] (1) Synthesize the sgRNA sequence of the rapA gene of Bacillus subtilis, sgRNA-F: tacgAAAGGGGGGATATATAATCT, sgRNA-R: aaacAGATTATATATCCCCCCTTTA.

[0070] (2) The pJOE8999 plasmid was digested with BsaI and recovered by gel extraction; the digested plasmid was linked with the sgRNA sequence to obtain pJOE8999-sgRNA.

[0071] (3) The pJOE8999-sgRNA plasmid was digested with SmaI and XbaI and then recovered by gel extraction.

[0072] (4) Using genomic DNA from Bacillus subtilis PGA-7 as a template, the upstream and downstream homologous sequences of the rapA gene were amplified using PCR-specific primers. The sequences were 800 bp in length, and the amplified sequences were recovered via gel electrophoresis. The primers were:

[0073] The amplification primers for the upstream homologous sequence are:

[0074] rapA-UF: gtcgacggccaacgaggcccgggGCCGCTCCCCCCACACCCGTCA

[0075] rapA-UR:aatagtctgcttcatCCTCAATAAAATCCCCCCTTTTG

[0076] The amplification primers for the downstream homologous sequence are:

[0077] rapA-DF:ctatatgaaatctaaACTGTTGTCAGGATTGCTGCTA

[0078] rapA-DR:gatgaagattatttcttaatctagaTCGCTGTTTCCCGTCATATAGC

[0079] (5) Using genomic DNA from Bacillus belyssus PGA-224 as a template, the rapA gene sequence was amplified by PCR using specific primers, and the amplified sequence was recovered by gel electrophoresis. The primers were as follows:

[0080] 224rapA-F:ggggatttattgaggATGAAGCAGACTATTCCGTCCT

[0081] 224rapA-R:aatcctgacaacagtTTAGATTTCATATAGACAATCT

[0082] (6) Homologous recombination was performed on the enzyme-digested pJOE8999-sgRNA plasmid, the upstream and downstream homologous sequence fragments of the rapA gene of Bacillus subtilis PGA-7 amplified and the rapA gene sequence fragment of Bacillus bereaves PGA-224 amplified to obtain the pJOE8999-sgRNA-rapA224 plasmid.

[0083] (7) The pJOE8999-sgRNA-rapA224 plasmid was transformed into Bacillus subtilis PGA-7. Transformants were selected on LB plates containing 20 μg / mL kanamycin and 1.0 g / L mannose at 30°C. Positive mutants grown on the plates were transferred to ordinary LB plates to eliminate the plasmid at 45°C. Several clones were then screened by colony PCR using validation primers. Genetically edited Bacillus subtilis PGA-7-224rapA strain was obtained. The sequences of the validation primers are as follows:

[0084] rapA-yF:ATGAAGCAGACTATTCCGTCCT

[0085] rapA-yR:TAGACAATCTCCTCTGGATT

[0086] Example 7:

[0087] The preparation steps for activating Bacillus subtilis strain PGA-7-224rapA are the same as in Example 2.

[0088] Preparation of Bacillus subtilis PGA-7-224rapA seed culture: Take 2 loops of the above-mentioned activated Bacillus subtilis PGA-7-224rapA inoculum, inoculate it into the fermentation medium, and culture it in a shaker at 37℃ for 18 hours at a shaking speed of 200 r / min. This is the seed culture. The fermentation medium consists of: 90 g / L sucrose, 20 g / L ammonium sulfate, 1 g / L dipotassium hydrogen phosphate, 0.06 g / L magnesium sulfate heptahydrate, 0.15 g / L calcium chloride dihydrate, 0.05 g / L manganese sulfate monohydrate, 0.01 g / L ferric chloride hexahydrate, and the balance being water, adjusted to pH 6.5. The preparation method is to mix the above components evenly, adjust the pH value, and then sterilize for later use.

[0089] Liquid shake-flask fermentation: Fermentation medium was dispensed into 300mL Erlenmeyer flasks (50mL each). Bacillus subtilis PGA-7-224rapA seed culture was inoculated into the fermentation medium at an inoculation rate of 10% (v / v). Fermentation was carried out at 37℃ on a shaker at 200 rpm for 96 hours. The yield of γ-polyglutamic acid was determined to be 25.24 g / L.

[0090] Comparative Example 1:

[0091] The activation of Bacillus belyssus PGA-7.1 strain and the preparation of seed culture were carried out in the same manner as in Example 2.

[0092] Liquid shake-flask fermentation: Fermentation medium (formulation same as in Example 2) was dispensed into 300mL Erlenmeyer flasks (50mL each). The seed culture of *Bacillus belyeis* PGA-7.1 was inoculated into the fermentation medium at an inoculation rate of 10% by volume. The fermentation temperature was 37℃. The mixture was cultured on a rotary shaker at 250 rpm for 7 days. After fermentation, the yield of γ-polyglutamic acid was measured to be 2.647 g / L.

[0093] Comparative Example 2:

[0094] The preparation steps for activating Bacillus licheniformis ATCC No. 9945a strain were the same as in Example 2. The preparation steps for Bacillus licheniformis ATCC No. 9945a seed culture were the same as in Example 5.

[0095] Liquid shake-flask fermentation: Fermentation medium (formulation same as in Example 5) was dispensed into 300mL Erlenmeyer flasks (50mL each). Bacillus licheniformis ATCC No. 9945a seed culture was inoculated into the fermentation medium at a volume fraction of 10%. Fermentation temperature was 37℃. The mixture was cultured on a shaker at 200 rpm for 96 hours. After fermentation, the yield of γ-polyglutamic acid was measured to be 29.54 g / L.

[0096] Comparative Example 3:

[0097] The preparation steps for activating Bacillus subtilis PGA-7 strain were the same as in Example 2. The preparation steps for Bacillus subtilis PGA-7 seed culture were the same as in Example 7.

[0098] Liquid shake-flask fermentation: Fermentation medium (formulation same as in Example 7) was dispensed into 300mL Erlenmeyer flasks (50mL each). Bacillus subtilis seed culture was inoculated into the fermentation medium at a volume fraction of 10%. Fermentation was carried out at 37℃ on a shaker for 96 hours at a shaking speed of 200 rpm. After fermentation, the yield of γ-polyglutamic acid was measured to be 16.23 g / L. SEQ ID NO.1 (nucleotide sequence of the mutant gene rapA)

[0099] ATGAAGCAGACTATTCCGTCCTCTTTTGTCGGGCTCAAAATTAATGAATGGTATACCCATATCCGGCAGTTTCACGTCCTTGAGGCGGAGCGCGTCAAACGTGAAGTAGAGAGAGAGATTGAGGATATGGAAGAAGATCAGGATCTGCTGCTGTATTATTCATTAATGGAATTCAGAC ACCGCGTCATGCTGGATTACATCAAGCCCTTAAAGGAGGACCCTTCTCAGCCTGAGTTTTCAGAATTATTGGAAGACATTGAAGGCAACCAGTATAAACTGACAGGACTGCTTGATTACTACTTTAATTTTTTTCGAGGAATGTACGAATTTAAACAGAAAATGTTCCTAAACGCCATG ATGTATTACAAACGGGCTGAAAAAAACCTTGCACTCGTTTCTGATGACATCGAGAAAGCTGAGTTTGCTTTTAAAATGGCCGAGATTTTTTACAACCTGAAACAAACCTACGTCTCCATGAGTTATGCCGTTCAAGCCCTTGAAACGTACCAATCGTATGAGACGTACAACGTCCGCA GAATCCAATGTGAATTCGTTATTGCAGGGAATTATGATGGCATGCAGTATCCAGAAAGAGCATTGCCCCACTTAGAACTTGCTTTGATCTTGCAAAACAAGAAGGCAATCCCCGTCTTATCAGTTCAGCCTTATATAATCTCGGAAACTGTTACGAAAAAATGGGAGACCTCTCTAAA

[0100] GCAGCCGAATATTTTGAGACAGCCGTTTCCATTTGCAGGTCAGAAAAGTTCGATAATCTT

[0101] CCGCATTCTATTTACTCATTAACACAGGTTCTTTATAAACAGAACACTACAGCCGAAGCA

[0102] GAGAAGCAATATCGCCTCGGGCTCAGTATCGCCCGCGAATACAATGATGAATTGTTTGTC

[0103] AATCTGTTCCAATTTTTGCATGCGTTATACGGCAAGGAAATGGATAACGCATCCGTCAGG

[0104] CGCACGTTTGATTTTCTGGAAGAACACATGCTGTATCCGTATGTGGAAGAATTGGCGCAT

[0105] GACGCTGCCAAATTTTACATGAAACACGGACAGCCTGAAAAAGCGCTCACGTTTTATGA

[0106] AAAAATGGTGCACGCCCAAAAACAAATCCAGAGAGGAGATTGTCTATATGAAATCTAA。

Claims

1. A mutant gene that increases γ-polyglutamic acid production rapA Its characteristics are, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. Containing the mutant gene as described in claim 1 rapA The strain, the strain is Bacillus velezensis PGA-224, with accession number GDMCC No. 62295.

3. A method for increasing the yield of γ-polyglutamic acid, characterized in that, Includes the following steps: By using the mutated gene of claim 1 rapA Replace the γ-polyglutamic acid producing strain rapA The gene, the γ-polyglutamic acid producing bacterium mentioned, is Bacillus belesiensis.

4. The method according to claim 3, characterized in that, Includes the following steps: (1) In the genome of γ-polyglutamic acid producing bacteria rapA The sgRNA sequence of the gene; (2) Insert the sgRNA sequence into the pJOE8999 plasmid to obtain pJOE8999-sgRNA; (3) The pJOE8999-sgRNA was digested with enzymes; (4) Amplification of γ-polyglutamic acid producing bacteria rapA Upstream and downstream homologous sequences of a gene; (5) Amplify the mutant gene as described in claim 1 rapA sequence; (6) The enzyme-digested pJOE8999-sgRNA plasmid was amplified to obtain the γ-polyglutamic acid-producing bacteria. rapA Upstream and downstream homologous sequence fragments of a gene and mutated genes rapA Homologous recombination of the sequence fragments yielded the plasmid pJOE8999-sgRNA-rapA224; (7) The pJOE8999-sgRNA-rapA224 plasmid was transferred into γ-polyglutamic acid producing bacteria and fermented to produce γ-polyglutamic acid.

5. The mutant gene according to claim 1 rapA The application of the strain described in claim 2 in increasing the yield of γ-polyglutamic acid.

Citation Information

Patent Citations

  • Gamma-polyglutamic acid generating bacterium and process of preparing gamma-polyglutamic acid therewith

    CN1932007A

  • Replication element derived from bacillus velezensis plasmids and application thereof

    CN112195190A

  • Crystal polymorphism of 2-[(3-{2-chloro-4-fluoro-5-[3-methyl-4-(trifluoromethyl)-2,6-dioxo-1,2,3,6-tetrahydropyrimidin-1-yl]phenoxy}pyridin-2-yl)oxy]ethyl acetate

    JP2020050667A