Epidermal stem cell increase promoting agent

Abstract

The present disclosure relates to a composition effective for improving skin condition from the viewpoint of maintaining or improving quality of life (QOL) in both health and beauty. More specifically, the present disclosure relates to a composition containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide, which can be suitably used as a cosmetic or the like beauty composition effective for improving skin condition due to promotion of increase of epidermal stem cells, promotion of increase of keratinocytes.

Description

TECHNICAL FIELD

[0001] The present application relates to a skin external preparation, and more particularly, to a skin external preparation containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide. BACKGROUND

[0002] With the advent of a true aging society, research and development related to aging mechanisms are becoming active. The skin forms the outermost layer of the human body, and not only plays an important role in protecting the organism, but also visually captures the appearance, and thus is a particularly important organ in terms of beauty. From the viewpoint of maintaining or improving the quality of life (QOL) in terms of both health and beauty, the concern about preventing skin aging has been increasing in recent years.

[0003] In order to prevent skin aging, moisturizers, which have been expected to improve the skin moisture retention ability, vitamin E, C, and the like, which have been expected to have antioxidant activity, have been mixed in skin external preparations such as cosmetics. Furthermore, as a result of recent research, it has been clarified that the decrease in the matrix component in the skin is closely related to wrinkles, sagging, and the decrease in elasticity accompanying aging.

[0004] In particular, the decrease in collagen, which is a main component of the matrix, is related to the sagging and decrease in elasticity of the skin, and the degradation and denaturation of elastin, which occurs through the expression of elastase, is considered to be a cause of the decrease in elasticity, and collagen production enhancers, collagenase inhibitors, elastase inhibitors, and the like are mixed as anti-aging agents. However, these agents show a certain effect, but do not show a sufficient effect.

[0005] In Patent Literature 1, as an anti-aging skin external preparation effective for the recovery / retention of elasticity and flexibility of the skin, the reduction of wrinkles / sagging, the reduction of pigmentation, and the restoration and maintenance of the state of young skin, an anti-aging skin external preparation characterized by containing niacin and ubiquinone is disclosed.

[0006] In Patent Literature 2, from the viewpoint of the relationship between heparanase and skin aging, as a new agent effective for the prevention and inhibition of skin aging, a whitening agent component effective for the prevention and inhibition of pigmentation such as spots, freckles, and dullness, a cyclic carboxamide derivative having a specific structure is disclosed.

[0007] PRIOR ART DOCUMENTS

[0008] PATENT LITERATURE

[0009] Patent Literature 1: Japanese Patent Application Laid-Open No. 2005-298370

[0010] Patent Literature 2: Japanese Patent Application Laid-Open No. 2014-111640

[0011] Non-patent literature 1: Vlodavsky I., et. al., Semin Cancer Biol., 2002; 12(2): 121-129 SUMMARY

[0012] PROBLEMS TO BE SOLVED BY THE INVENTION

[0013] The present application has been made in view of the finding that a composition effective for improving the skin condition is found from the viewpoint of maintaining or improving the quality of life (QOL) in both health and beauty.

[0014] METHOD FOR SOLVING THE PROBLEM

[0015] The present inventors have conducted intensive studies, and as a result, have found that a composition containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide shows an effect of promoting the increase of epidermal stem cells.

[0016] Therefore, the present disclosure provides the following embodiments.

[0017] (1) A skin external composition characterized by containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide as effective ingredients.

[0018] (2) The composition according to (1), which is a cosmetic composition.

[0019] (3) The composition according to (1) or (2), which is a composition for promoting the increase of epidermal stem cells.

[0020] (4) The composition according to (3), wherein the epidermal stem cells are MCSP-positive cells.

[0021] (5) The composition according to any one of (1) to (4), which promotes the increase of keratinocytes.

[0022] (6) The composition according to any one of (1) to (5), wherein the 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof is a cyclic carboxamide derivative represented by the following general formula (I).

[0023]

[0024] (In the general formula (I), n is an integer of 1 to 3, R 1 is a hydrogen atom, or a hydrocarbon group having 1 to 6 carbon atoms which can be substituted with a hydroxyl group, X is a group represented by -CH2- or -N(R 2 )-, and R 2 means a hydrogen atom, or a hydrocarbon group having 1 to 6 carbon atoms which can be substituted with a hydroxyl group.)

[0025] (7) In any one of (1) to (6), the pyridinecarboxamide is selected from 2-pyridinecarboxamide, 3-pyridinecarboxamide, 4-pyridinecarboxamide, and mixtures thereof.

[0026] (8) A cosmetic method characterized by applying a composition containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and pyridine carboxamide to the skin.

[0027] (9) The composition according to any one of (1) to (7) is a composition for promoting the expression of collagen in the papillary layer of the dermis.

[0028] (10) The composition according to any one of (1) to (7) is a composition for promoting the expression of collagen in the dermis.

[0029] The effects of the invention

[0030] The compositions disclosed herein can be used, for example, as cosmetic compositions such as cosmetics that are effective in improving skin condition, because they promote the increase of epidermal stem cells and keratinocytes. Attached Figure Description

[0031] Figure 1 Images were created to illustrate the effects of nicotinamide (NAM) and the combination of CGS27023A (an MMP-9 inhibitor) and BIPBIPU (a heparinase inhibitor) on keratinocyte proliferation in a three-dimensional epidermal skin model, based on Ki-67 expression. Cont represents the untreated control, NAM represents the nicotinamide treatment, BIPBIPU+CGS represents the treatment with the combination of BIPBIPU and CGS, and NAM+BIPBIPU+CGS represents the treatment with either NAM or the combination of BIPBIPU and CGS.

[0032] Figure 2 Images show the effects of nicotinamide (NAM) and the combination of CGS27023A (an MMP-9 inhibitor) and BIPBIPU (a heparinase inhibitor) on keratinocyte proliferation in a three-dimensional skin model containing dermis, based on Ki-67 expression. Cont represents the untreated control, NAM represents nicotinamide treatment, BIPBIPU+CGS represents treatment with the combination of BIPBIPU and CGS, and NAM+BIPBIPU+CGS represents treatment with either NAM or the combination of BIPBIPU and CGS.

[0033] Figure 3Images of the results investigating the effect of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolidinone (S173) on fresh skin samples based on the expression of Ki-67 as a marker of cell proliferation. Cont is the untreated control, NAM is the treatment with nicotinamide alone, S173 is the treatment with S173 alone, NAM+S173 is the treatment with the combination of NAM and S173.

[0034] Figure 4 Images of the results investigating the effect of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolidinone (S173) on fresh skin samples based on the expression of Ki-67 as a marker of cell proliferation. Cont is the untreated control, NAM is the treatment with nicotinamide alone, S173 is the treatment with S173 alone, NAM+S173 is the treatment with the combination of NAM and S173.

[0035] Figure 5 Graph of the results quantifying the number of Ki-67 positive cells per unit length of the basement membrane based on the results of immunostaining. Cont is the untreated control, NAM is the treatment with nicotinamide alone, S173 is the treatment with S173 alone, NAM+S173 is the treatment with the combination of NAM and S173.

[0036] Figure 6 Images of the results investigating the effect of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolidinone (S173) on epidermal stem cells based on the expression of MCSP. Cont is the untreated control, NAM is the treatment with nicotinamide alone, S173 is the treatment with S173 alone, NAM+S173 is the treatment with the combination of NAM and S173.

[0037] Figure 7 Graph of the results quantifying the number of MCSP positive cells per unit length of the basement membrane based on the results of immunostaining. Cont is the untreated control, NAM is the treatment with nicotinamide alone, S173 is the treatment with S173 alone, NAM+S173 is the treatment with the combination of NAM and S173.

[0038] Figure 8 Graph of the results investigating the relative expression of MCSP mRNA by qPCR analysis. Cont is the untreated control, NAM is the treatment with nicotinamide alone, S173 is the treatment with S173 alone, NAM+S173 is the treatment with the combination of NAM and S173.

[0039] Figure 9AA graph showing the results of investigating the effects of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) on Type V collagen production. Cont is an untreated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0040] Figure 9B A graph showing the results of investigating the effects of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) on Type V collagen production. Cont is an untreated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173. Figure 9A A graph showing the results of quantifying the staining shown in FIG. 2 (**p<0.01, *p<0.05; Tukey-Kramer test). Control is an untreated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0041] Figure 9C A graph showing the results of investigating the effects of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) on Type V collagen production. Cont is an untreated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0042] Figure 10A A graph showing the results of investigating the effects of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) on Type V collagen production. Cont is an untreated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0043] Figure 10B A graph showing the results of quantifying the staining shown in FIG. 8 (**p<0.01, *p<0.05; Tukey-Kramer test). Control is an untreated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173. Figure 10A A graph showing the results of quantifying the staining shown in FIG. 8 (**p<0.01, *p<0.05; Tukey-Kramer test). Control is an untreated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0044] Figure 10CFig. 2 is a graph showing the results of investigating the effects of nicotinamide (NAM) and 1 -(2-hydroxyethyl)-2-imidazolinone (S173) on the production of Type III collagen. Cont is a non-treated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0045] Figure 11A Fig. 3 is a graph showing the results of investigating the effects of nicotinamide (NAM) and 1 -(2-hydroxyethyl)-2-imidazolinone (S173) on the production of Type III collagen. Cont is a non-treated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0046] Figure 11B Fig. 4 is a graph showing the results of investigating the effects of nicotinamide (NAM) and 1 -(2-hydroxyethyl)-2-imidazolinone (S173) on the production of Type III collagen. Cont is a non-treated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173. Figure 11A

[0047] Figure 11C Fig. 5 is a graph showing the results of investigating the effects of nicotinamide (NAM) and 1 -(2-hydroxyethyl)-2-imidazolinone (S173) on the production of Type III collagen. Cont is a non-treated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0048] Figure 12A Fig. 6 is a graph showing the results of investigating the effects of nicotinamide (NAM) and 1 -(2-hydroxyethyl)-2-imidazolinone (S173) on the production of Type III collagen. Cont is a non-treated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0049] Figure 12B Fig. 7 is a graph showing the results of investigating the effects of nicotinamide (NAM) and 1 -(2-hydroxyethyl)-2-imidazolinone (S173) on the production of Type III collagen. Cont is a non-treated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173. Figure 12A ​The staining shown quantified the graph (**p<0.01, *p<0.05; Tukey-Kramer test). Control (Control) is a non-treated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173.

[0050] Figure 12C The graph shown shows the results of analysis of Col collagen 4A1 gene expression (**p<0.01, *p<0.05; Tukey-Kramer test). Control (Control) is a non-treated control, NAM is a treatment with nicotinamide alone, S173 is a treatment with S173 alone, and NAM+S173 is a treatment with a combination of NAM and S173. DETAILED DESCRIPTION

[0051] Topical skin composition

[0052] One embodiment relating to the present disclosure relates to a skin external preparation composition characterized by containing 1-(2-hydroxyethyl)-2-imidazolinone (HEI) or a derivative thereof and picolinamide as effective ingredients. Such a composition is preferably capable of being formulated as a cosmetic composition.

[0053] 1-(2-hydroxyethyl)-2-imidazolinone (HEI) is a compound having the following structure. In addition, in the present specification, 1-(2-hydroxyethyl)-2-imidazolinone (HEI) is sometimes expressed as S173.

[0054]

[0055] A derivative of 1-(2-hydroxyethyl)-2-imidazolinone can be, for example, a compound represented by the following general formula (I):

[0056]

[0057] (In general formula (I), n is an integer of 1 to 3, R 1 is a hydrogen atom, or a hydrocarbon group having 1 to 6 carbon atoms which can be substituted with a hydroxyl group, and X is -CH2- or -N(R 2 )-group represented by the formula, and R 2 is a hydrogen atom, or a hydrocarbon group having 1 to 6 carbon atoms which can be substituted with a hydroxyl group.)

[0058] It is known that 1-(2-hydroxyethyl)-2-imidazolinone and its derivatives function as an inhibitor of heparanase activity (see Japanese Patent Application Publication No. 2014-111640 (Patent Document 2)). Heparanase is an enzyme that specifically degrades heparan sulfate chains of various heparan sulfate proteoglycans present in various cells. For the skin, it is produced by keratinocytes that constitute the epidermis and fibroblasts, vascular endothelial cells, and the like of the dermis. It is known that the production thereof is also increased in various cancer cells, and it is also suggested to be related to the malignancy of cancer. It is known that if the production of heparanase is high in cancer cells, the metastaticity is high, and the ability to induce angiogenesis is also high (see Vlodavsky I., et. al., Semin Cancer Biol., 2002; 12(2): 121-129 (Non-Patent Document 1)).

[0059] Heparan sulfate proteoglycans play a role in accumulating heparan sulfate-binding growth factors (bFGF, HGF, VEGF, HB-EGF, and the like) outside cells. Perlecan, which is one of heparan sulfate proteoglycans, is also present in the epidermal basement membrane present at the boundary between the epidermis and the dermis, and for the skin, controls the movement of growth factors between the epidermis and the dermis by binding heparan sulfate-binding growth factors to the epidermal basement membrane. Furthermore, it is clarified that perlecan present in the epidermal basement membrane also controls the action of growth factors on epidermal basal cells bound to the basement membrane, and is essential for good proliferation / differentiation of the epidermis.

[0060] Furthermore, it is known that 1-(2-hydroxyethyl)-2-imidazolinone (HEI) also functions as an inhibitor of MMP (matrix metalloproteinase). HEI, for example, inhibits MMP-9, but does not affect the activity of MMP-1 and MMP-2.

[0061] A picolinamide is a compound having the molecular formula C6H6N2O, including the following compounds differing in the position of the carboxamide group, 2-picolinamide, 3-picolinamide (nicotinamide), and 4-picolinamide (isonicotinamide). In the embodiments to which the present disclosure pertains, any one of 2-picolinamide (picolinamide), 3-picolinamide (nicotinamide), and 4-picolinamide (isonicotinamide), or a mixture thereof can be used. In several embodiments, 3-picolinamide (nicotinamide) is suitably used. The structure of 3-picolinamide (nicotinamide) is shown below.

[0062]

[0063] As detailed in the Examples column, the present inventors have this time discovered that a composition containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide has an effect of promoting an increase in epidermal stem cells, an effect of promoting an increase in keratinocytes. The increase in these cells can be evaluated, for example, by immunohistochemical staining and the like. For example, epidermal stem cells can be identified as MCSP-positive cells. Thus, one embodiment to which the present disclosure relates relates to a composition characterized by being a composition for promoting an increase in epidermal stem cells, containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide as effective ingredients. Such a composition is preferably able to be formulated as a skin external composition.

[0064] In other words, the composition to which the present disclosure relates can also be described as an epidermal stem cell increase promoter containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide as effective ingredients. The composition and agent to which the present disclosure relates are particularly able to be used for non-therapeutic cosmetic use. Furthermore, from another viewpoint, one embodiment to which the present disclosure relates relates to use of a composition containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide for promoting an increase in epidermal stem cells. In such use, 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide can be used in the form of a composition further combined with other ingredients. Further from another viewpoint, one embodiment to which the present disclosure relates relates to use of 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide in the manufacture of an epidermal stem cell increase promoter. Further from another viewpoint, one embodiment to which the present disclosure relates relates to an epidermal stem cell increase promoting method comprising: administering a composition containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide to a subject (e.g., a human).

[0065] Furthermore, one embodiment to which the present disclosure relates relates to a composition characterized by being for promoting an increase in keratinocytes, and containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide as effective ingredients. Such a composition is preferably able to be formulated as a skin external composition.

[0066] In other words, the composition according to the present disclosure can also be described as a keratinocyte proliferation accelerator containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide as active ingredients. The composition and agent according to the present disclosure are particularly useful for non-therapeutic, cosmetic use. Furthermore, from another viewpoint, an embodiment according to the present disclosure relates to the use of a composition containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide for promoting keratinocyte proliferation. In such use, 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide can be used in the form of a composition further combined with other ingredients. Furthermore, from another viewpoint, an embodiment according to the present disclosure relates to the use of 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide in the manufacture of a keratinocyte proliferation accelerator. Furthermore, from another viewpoint, an embodiment according to the present disclosure relates to a method for promoting keratinocyte proliferation, comprising: administering a composition containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide to a subject (e.g., a human).

[0067] Furthermore, an embodiment according to the present disclosure relates to a composition characterized by being for use in promoting the expression of collagen in the dermal papilla layer, and containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide as active ingredients. The collagen can be type I, type III, type IV, or type V collagen. Such a composition is preferably capable of being formulated as a skin external preparation.

[0068] In other words, the composition according to the present disclosure can also be described as a collagen expression accelerator in the dermal papilla layer containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide as active ingredients. The composition and agent according to the present disclosure are particularly useful for non-therapeutic, cosmetic use. Furthermore, from another viewpoint, an embodiment according to the present disclosure relates to the use of a composition containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide for promoting the expression of collagen in the dermal papilla layer. In such use, 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide can be used in the form of a composition further combined with other ingredients. Furthermore, from another viewpoint, an embodiment according to the present disclosure relates to the use of 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide in the manufacture of a collagen expression accelerator in the dermal papilla layer. Furthermore, from another viewpoint, an embodiment according to the present disclosure relates to a method for promoting the expression of collagen in the dermal papilla layer, comprising: administering a composition containing 1 -(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and a picolinamide to a subject (e.g., a human).

[0069] Further, an embodiment of the present disclosure relates to a composition characterized by being for promoting expression of collagen in the dermis, and containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and nicotinamide as effective ingredients. The collagen can be type I, type III, type IV, or type V collagen. Such a composition is preferably able to be formulated as a skin external preparation.

[0070] In other words, the composition according to the present disclosure can also be described as an expression promoter of collagen in the dermis containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and nicotinamide as effective ingredients. The composition and agent according to the present disclosure are particularly useful for non-therapeutic cosmetic use. Further, from another viewpoint, an embodiment of the present disclosure relates to use of a composition containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and nicotinamide for promoting expression of collagen in the dermis. In such use, 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and nicotinamide can be used in the form of a composition further combined with other ingredients. Further, from another viewpoint, an embodiment of the present disclosure relates to use of 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and nicotinamide in the manufacture of an expression promoter of collagen in the dermis. Further, from another viewpoint, an embodiment of the present disclosure relates to a method for promoting expression of collagen in the dermis, comprising: administering a composition containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and nicotinamide to a subject (e.g., a human).

[0071] Cosmetic method

[0072] An embodiment of the present disclosure relates to a cosmetic method characterized by applying a composition containing 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and nicotinamide to the skin. The subject can be any animal, but is preferably a human. The cosmetic method according to the present disclosure is a non-therapeutic method, and does not include so-called medical acts. In the cosmetic or non-therapeutic method according to the present disclosure, the above-mentioned skin external preparation is applied to a site where a desired effect is intended, such as the face, neck, hands, wrists, feet, and the like. The application can be performed in any manner such as by rubbing with the hand, a rubbing tool, or the like. The number of times, frequency, amount, and the like of the application are appropriately set according to the desired effect, and the like.

[0073] Modulation

[0074] 1-(2-hydroxyethyl)-2-imidazolinone or a derivative thereof and nicotinamide can be synthesized by a known method, or can be easily purchased as a commercial product.

[0075] Further, 1-(2-hydroxyethyl)-2-imidazolinone or its derivative and picolinamide can be made into inorganic salts or organic salts by publicly known methods. As the salts used in the embodiments related to the present disclosure, there is no particular limitation, and for example, as inorganic salts, there can be mentioned hydrochloride, sulfate, phosphate, hydrobromide, sodium salt, potassium salt, magnesium salt, calcium salt, ammonium salt, and the like. As organic salts, there can be mentioned acetate, lactate, maleate, fumarate, tartrate, citrate, methanesulfonate, p-toluenesulfonate, triethanolamine salt, diethanolamine salt, amino acid salt, and the like.

[0076] In the agents related to the present disclosure, 1-(2-hydroxyethyl)-2-imidazolinone and its derivative having an acetylheparinase activity inhibitory effect and / or an MMP inhibitory effect, particularly a substance having both an acetylheparinase activity inhibitory effect and an MMP inhibitory effect (particularly an MMP-9 inhibitory effect) can be suitably used. The composition related to the present disclosure can contain only one kind of 1-(2-hydroxyethyl)-2-imidazolinone or its derivative, but can also contain two or more of the above compounds or salts thereof in any combination and ratio.

[0077] The content of 1-(2-hydroxyethyl)-2-imidazolinone or its derivative and picolinamide, or a salt thereof in the composition related to the present disclosure is not particularly limited as long as it is a sufficient amount for effectively exerting the desired effect, and is appropriately selected depending on the use of the agent. However, in general, it is preferable that the ratio of 1-(2-hydroxyethyl)-2-imidazolinone or its derivative and picolinamide, or a salt thereof with respect to the entire agent is usually 0.0001% by mass or more, and is 0.0001% by mass or more, and is usually 1% by mass or less, and is 0.2% by mass or less. In the case where two or more kinds of 1-(2-hydroxyethyl)-2-imidazolinone or its derivative and picolinamide, or a salt thereof are used, as long as the total amount thereof satisfies the above range.

[0078] Further, the composition according to the present disclosure can contain any other ingredient as long as the effect of 1-(2-hydroxyethyl)-2-imidazolinone or its derivative and a picolinamide, or a salt thereof is not substantially impaired. As the other ingredient, there can be mentioned other compounds having an inhibitory effect on heparanase activity, other activities (MMP inhibitory activity, particularly MMP-9 inhibitory activity, etc.) (CGS27023A, BIPBIPU, etc.), pharmaceutically acceptable carriers and / or adjuvants. Examples of the other ingredient can include valerian extract, lily extract, Peucedanum decursivum extract, Sapindus mukorossi extract, dried tangerine or orange peel extract, and other crude drugs having an effect as heparanase inhibitors (see Japanese Patent Application No. 2014-165586) and other crude drugs having an effect as MMP inhibitors (see Japanese Patent Application No. 2018-545781) such as Embelia elata extract, Curcuma longa extract, and Potentilla feruginea extract, but are not limited thereto. Such other ingredients can be used alone or in combination of two or more at an arbitrary ratio. Thus, some of the aspects of the present application relate to a skin external preparation composition containing a compound having both heparanase inhibitory activity and MMP (particularly MMP-9) inhibitory activity and / or a combination of a heparanase inhibitor and an MMP (particularly MMP-9) inhibitor, and a picolinamide as an active ingredient.

[0079] The composition according to the present disclosure can be manufactured by a conventional method, and as the ingredient constituting a skin external preparation, one or two or more of 1-(2-hydroxyethyl)-2-imidazolinone or its derivative and a picolinamide, or a salt thereof can be individually prepared, but can be appropriately mixed with ingredients such as oil, surfactant, powder, colorant, water, alcohol, thickening agent, chelating agent, silicone, antioxidant, ultraviolet absorber, humectant, perfume, various pharmaceutical ingredients, preservative, pH adjuster, neutralizing agent, and the like, which are generally contained in quasi-drugs, pharmaceuticals, and the like, as needed.

[0080] The dosage form of the composition according to the present disclosure is not limited as long as it is appropriately selected depending on the use thereof. As an example of the administration route, there can be mentioned topical administration (skin external use). As the dosage form, in the case of topical administration (skin external preparation), there can be mentioned a form in which a solution system, a solubilization system, an emulsion system, a powder dispersion system, a water-oil two-layer system, a water-oil-powder three-layer system, and the like are made into a patch, an ointment, a cream, a lotion, a cosmetic water, a gel, an aerosol, and the like.

[0081] Further, in the composition according to the present disclosure, other component(s) can be mixed as long as the effect of 1-(2-hydroxyethyl)-2-imidazolinone or its derivative and pyridine carboxamide, or a salt thereof is not substantially impaired. The other component(s) is not particularly limited and can be appropriately selected depending on the purpose, dosage form, administration form, and the like of the pharmaceutical composition. Examples of the other component(s) include carriers and / or adjuvants that are pharmaceutically acceptable. Examples of the adjuvant include diluents, binders, disintegrants, thickening agents, dispersants, resorption promoters, flavoring agents, buffers, surfactants, solubilizers, preservatives, emulsifiers, isotonic agents, stabilizers, pH adjustors, and the like.

[0082] As specific examples, in the composition according to the present disclosure, components generally used for external agents such as whitening agents, moisturizing agents, antioxidants, oily components, ultraviolet absorbers, surfactants, thickening agents, alcohols, powder components, coloring agents, aqueous components, water, various skin nutrients, and the like can be appropriately mixed as needed. Further, ethylenediaminetetraacetic acid disodium salt, ethylenediaminetetraacetic acid trisodium salt, sodium citrate, sodium polyphosphate, sodium metaphosphate, gluconic acid, and the like metal ion blocking agents, methyl paraben, ethyl paraben, butyl paraben, and the like preservatives, caffeine, tannin, verapamil, tranexamic acid and its derivatives, licorice extract, glabridin, hot water extract of the fruit of papaya, various crude drugs, tocopherol acetate, glycyrrhizic acid and its derivatives or salts thereof, vitamin C, ascorbic acid magnesium phosphate, ascorbic acid glucoside, arbutin, kojic acid, and the like whitening agents, glucose, fructose, mannose, sucrose, trehalose, and the like sugars, retinoic acid, retinol, retinol acetate, retinol palmitate, and the like vitamin A derivatives, and the like medicaments can also be appropriately mixed.

[0083] The above components are examples and are not limited thereto. Further, these components can be appropriately combined and mixed according to a prescription corresponding to the desired form.

[0084] The dosage form of the external agent for skin according to the present disclosure is not particularly limited and can be, for example, any of a solution system, a solubilization system, an emulsion system, a powder dispersion system, a water-oil two-layer system, a water-oil-powder three-layer system, an ointment, a gel, an aerosol, and the like. Further, the use form is not particularly limited and can be, for example, any of a cosmetic water, an emulsion, a cream, an essence, a jelly, a gel, an ointment, a pack, a mask, a foundation, and the like.

[0085] The composition according to the present disclosure can be used in a cosmetic method for improving the skin condition by applying to the skin. The use and the amount of the skin external preparation according to the present disclosure in such a cosmetic method are not particularly limited, and are appropriately determined depending on the dosage form, the condition of the skin to be treated, but typically, it can be applied several times a day, for example, 1 to 5 times, in an appropriate amount, for example, 0.1 to 1 ml directly to the skin, or after allowing it to be appropriately infiltrated into gauze or the like and then adhered to the skin. 2 0.1 ml ~ 1 ml directly to the skin, or after allowing it to be appropriately infiltrated into gauze or the like and then adhered to the skin.

[0086] The above, the specific examples are described, but the above specific examples ultimately is an example, the present invention can be added to any change within the scope of the patent claims, and implemented. The above-mentioned various features and embodiments of the present invention plus appropriate, necessary changes, can also be applied to other parts of the record. Therefore, the features specified in a certain embodiment can be appropriately combined with the functions specified in other embodiments. All references cited in the present specification, including patents, patent applications, papers, textbooks, and sequence accession numbers, and references cited therein are incorporated by reference in their entirety into the present specification. One or more of the incorporated literature and the same materials regarding the defined terms, the use of terms, the described techniques, etc., but not limited to them, in cases different from, or contradictory to, the present application, the record of the present application is preferred.

[0087] The following, the examples are described more specifically, but the present invention is not limited to the following examples.

[0088] Example

[0089] 1. Materials and methods

[0090] Culture of epidermal three-dimensional skin model

[0091] Epidermal three-dimensional skin model (EPI-200-3S) purchased from MatTek Corporation was cultured in a special medium (EPI-100ASY) to which nicotinamide (final concentration 7.5 x 10 -3 M), CGS27023A (reference 1) as an MMP-9 inhibitor (final concentration 10 -5 M), BIPBIPU (reference 2) as an heparanase inhibitor (final concentration 10 -5 M) was added. For the control, a medium to which an equal amount of DMSO solvent not containing these agents was added was used for culture. The medium was replaced once every 2 days, and the tissue pieces were recovered on the 4th day.

[0092] Culture of three-dimensional skin model containing dermis

[0093] A three-dimensional skin model containing dermis (EFT-400) purchased from MatTek Corporation was cultured in a special medium (EFT400-ASY) to which nicotinamide (final concentration 7.5 x 10 -3 M), CGS27023A (final concentration 10 -5 M), BIPBIPU (final concentration 10 -5 M) were added. For the control, a medium to which an equal amount of DMSO solvent not containing these agents was added was used. Medium replacement was performed once every 2 days, and the tissue pieces were recovered on day 4.

[0094] Culture of fresh human skin

[0095] A fresh skin sample from the abdomen of a subject (20s to 30s) who gave informed consent was obtained from Kao Corporation. Culture was performed using an equal mixture medium of 10% FBS-DMEM (Thermo Fisher Science, 11885084) to which nicotinamide (final concentration 7.5 x 10 -3 M or 1.5 x 10 -2 M), a uniquely developed ingredient having effects of inhibiting both MMP-9 and heparanase, 1-(2-hydroxyethyl)-2-imidazolidinone (reference 3) (S173, final concentration 0.01%), Humedia-KG2 (KURABO, KK-2150S), added, for the control, a medium to which an equal amount of DMSO solvent not containing these agents was added was used. Medium replacement was performed every day, and the tissue pieces were recovered on day 2.

[0096] Paraffin embedding, sectioning

[0097] The recovered skin model, fresh human skin was dehydrated and fixed according to the AMeX method using cold acetone, and was embedded in paraffin after replacement in the order of acetone, methyl benzoate, xylene. Sections were prepared at a thickness of 3 μm, and sections for tissue staining were prepared.

[0098] Various immunostainings

[0099] After the paraffin section made with a thickness of 3 μm was deparaffinized with xylene, hydration was performed using EtOH. Fluorescent immunostaining was performed using an antibody against Ki-67 (Thermo Fisher Scientific, RM-9106-S, rabbit mouse monoclonal antibody) and an antibody against MCSP (melanoma-associated chondroitin sulphate proteoglycan) (Millopore, MAB2029, 9.2.27, mouse monoclonal antibody).

[0100] In addition, in the fluorescent immunostaining of various collagens, an antibody against collagen type I (ROCKLAND, 600-401-103-0.5, rabbit polyclonal antibody), an antibody against collagen type III (ROCKLAND, 600-401-105S, rabbit polyclonal antibody), an antibody against collagen type IV (Progen, 10760, rabbit polyclonal antibody), and an antibody against collagen type V (ORIGENE, AM10159PU-N, mouse monoclonal antibody) were used.

[0101] Gene expression of MCSP

[0102] The recovered fresh human skin was heat-treated with an electric hot plate at 60°C for 1 minute and then cooled on ice, whereby the epidermis was separated from the dermis. The epidermis was added to 1 mL of Trizol solution with zirconium oxide balls, and the epidermis was crushed by vibrating it with a tissue crusher for 3 minutes. RNA was extracted using chloroform and isopropyl alcohol, and the RNA was refined using an RNeasy mini kit (QIAGEN). After measuring the RNA concentration with a NanoDrop, cDNA was synthesized using Superscript VILO (Invitrogen). Then, using the synthesized cDNA, quantitative PCR analysis was performed using platinum SYBER green (Invitrogen). The primers of the genes used are shown in Table 1.

[0103] Table 1

[0104] Primer name Sequence Sequence number MCSP forward CACGGCTCTGACCGACATAG 1 MCSP reverse CCCAGCCCTCTACGACAGT 2 b2m forward GTGGGATCGAGACATGTAAGCA 3 b2m reverse CAATCCAAATGCGGCATCT 4

[0105] In addition, collagen gene expression analysis was performed using the separated dermis in the same manner as described above. The primers used are shown in Table 2.

[0106] Table 2

[0107] Primer name Sequence Sequence number Collagen 5A1 forward GTGGCACAGAATTGCTCTCA 5 Collagen 5A1 reverse TCACCCTCAAACACCTCCTC 6 Procollagen 1A1 forward CTCGAGGTGGACACCACCCT 7 Procollagen 1A1 reverse CAGCTGGATGGCCACATCGC 8 Collagen 3A1 forward TCCGGGTGAGAAAGGTGA 9 Collagen 3A1 reverse GCAGGTCCAGAACCTCCAG 10 Collagen 4A1 forward TGCGCAAGTTCAGCACAATG 11 Collagen 4A1 reverse GGCACGGTGGGATCTGAATG 12

[0108] 2. Results and Considerations

[0109] Effect on keratinocytes with niacinamide and BIPBIPU+CGS

[0110] The results of investigating the effect of the combination of nicotinamide (NAM), and CGS27023A as an MMP-9 inhibitor and BIPBIPU as an heparanase inhibitor on the proliferation of keratinocytes in the epidermal three-dimensional skin model are shown in Figure 1 . The results of Figure 1 show that the number of cells positive for Ki-67 as a cell proliferation marker increased by treatment with nicotinamide (NAM), and CGS27023A + BIPBIPU.

[0111] In addition, the results of investigating the effect of the combination of nicotinamide (NAM), and CGS27023A as an MMP-9 inhibitor and BIPBIPU as an heparanase inhibitor on the proliferation of keratinocytes in the dermal three-dimensional skin model are shown in Figure 2 . The results of Figure 2 show that the number of cells positive for Ki-67 as a cell proliferation marker increased by treatment with nicotinamide (NAM), and CGS27023A + BIPBIPU.

[0112] Effect on keratinocytes with combination of niacinamide and S173

[0113] The results of investigating the effect of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolidinone (S173) on fresh skin samples by H&E staining are shown in Figure 3 . The results of Figure 3 show that the proliferation of keratinocytes in the basal layer cells was maintained by the combination of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolidinone (S173) (NAM + S173). This is Figure 4 , 5As shown, this was also confirmed by the increased number of Ki-67-positive cells, a marker of cell proliferation, obtained through the combination of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) (NAM+S173). Therefore, these results demonstrate that treatment with the combination of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) (NAM+S173) promotes an increase in keratinocytes.

[0114] Effect on epidermal stem cells with combination of niacinamide and S173

[0115] The results of investigating the effects of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) on epidermal stem cells are presented in... Figure 6 , 7 middle. Figure 6 , 7 The results showed that treatment with nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) increased the number of MCSP-positive cells, a marker of epidermal stem cells. Furthermore, the results of investigating MCSP mRNA expression levels by qPCR analysis are shown below. Figure 8 middle. Figure 8 The results showed that the number of epidermal stem cells, as expressed by MCSP mRNA, was synergistically increased by the combination of NAM and S173 (NAM+S173). These results demonstrate that treatment with the combination of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) promotes the increase of epidermal stem cells.

[0116] Effect on collagen type V with combination of niacinamide and S173

[0117] The results of the investigation into the effects of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) on V-type collagen production are presented in... Figure 9A , 9B And in 9C. Figure 9A The results of fluorescent immunostaining of type V collagen are shown. Figure 9B The graph shows how the intensity of the staining was quantified by dividing the area. Figure 9C A graph showing the relative expression levels of collagen 5A1 mRNA. Figure 9A , 9B The results from 9C showed that treatment with nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) increased the expression of type V collagen. Figure 9A , 9BThe results of FIGS. 10 to 12 show that the collagen of the dermis is increased by the treatment with nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173). The results of FIGS. 10 to 12 show that the expression of the collagen of the dermis is promoted by the treatment with the combination of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173).

[0118] Effect on dermal collagens with combination of niacinamide and S173

[0119] The results of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173) on the effect of the collagen production of the dermis are shown in FIGS. 10 to 12. Figure 10A The results of the fluorescent immunostaining of the collagen I are shown. Figure 10B The graph in which the intensity of the staining is quantified by the area. Figure 10C The graph showing the relative expression amount of procollagen 1A1 mRNA. Figure 11A The results of the fluorescent immunostaining of the collagen III are shown. Figure 11B The graph in which the intensity of the staining is quantified by the area. Figure 11C The graph showing the relative expression amount of collagen 3A1 mRNA. Figure 12A The results of the fluorescent immunostaining of the collagen IV are shown. Figure 12B The graph in which the intensity of the staining is quantified by the area. Figure 12C The graph showing the relative expression amount of collagen 4A1 mRNA. The results of FIGS. 10 to 12 show that the collagen I, the collagen III, and the collagen IV are increased by the treatment with nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173). The results of FIGS. 10 to 12 show that the expression of the collagen of the dermis is synergistically increased by the combination of NAM and S173 (NAM + S173). The above results show that the expression of the collagen of the dermis is promoted by the treatment with the combination of nicotinamide (NAM) and 1-(2-hydroxyethyl)-2-imidazolinone (S173).

[0120] References

[0121] 1) Pan W, Miao HQ, Xu YJ, Navarro EC, Tonra JR, Corcoran E, et al. 1-[4-(1H-Benzoimidazol-2-yl)-phenyl]-3-[4-(1H-benzoimidazol-2-yl)-phenyl]-urea derivatives as small molecule heparanase inhibitors. Bioorganic & medicinal chemistry letters. 2006; 16(2): 409-12.

[0122] 2) MacPherson LJ, Bayburt EK, Capparelli MP, Carroll BJ, Goldstein R, Justice MR, et al. Discovery of CGS 27023A, a non-peptidic, potent, and orally active stromelysin inhibitor that blocks cartilage degradation in rabbits. Journal of medicinal chemistry. 1997; 40(16): 2525-32.

[0123] 3) Iriyama S, Yamanishi H, Kunizawa N, Hirao T, Amano S. 1-(2-Hydroxyethyl)-2-imidazolidinone, a heparanase and matrix metalloproteinase inhibitor, improves epidermal basement membrane structure and epidermal barrier function. Experimental dermatology. 2019; 28(3): 247-53.

[0124] 4) Iriyama S, Yasuda M, Nishikawa S, Takai E, Hosoi J, Amano S. Decrease of laminin-511 in the basement membrane due to photoaging reduces epidermal stem / progenitor cells. Scientific reports. 2020; 10(1): 12592.

[0125] Industrial applicability

[0126] The composition related to the present disclosure can be used as, for example, a cosmetic composition such as a cosmetic for improving skin conditions, because it promotes the increase of epidermal stem cells and the increase of keratinocytes.

Claims

1. A topical skin composition, characterized in that, It contains 1-(2-hydroxyethyl)-2-imidazolinone or its salt, and 3-pyridinecarboxamide or its salt as active ingredients.

2. The topical skin composition according to claim 1 is a cosmetic composition.

3. The topical skin composition according to claim 1 or 2, wherein it is a composition for promoting the increase of epidermal stem cells.

4. The topical skin composition according to claim 3, wherein the epidermal stem cells are MCSP-positive cells.

5. The topical skin composition according to claim 1 or 2, which promotes the increase of keratinocytes.

6. The topical skin composition according to claim 1 or 2, wherein it is a composition for promoting collagen expression in the papillary layer of the dermis.

7. The topical skin composition according to claim 1 or 2, wherein it is a composition for promoting collagen expression in the dermis.

8. A non-therapeutic cosmetic method, characterized in that, Apply the skin composition of claim 1 to the skin.

Images