Messenger RNA vaccines against poxviruses

Abstract

The present invention provides an anti-pox virus vaccine, which contains the following antigens and / or mRNAs of fusion antigens: (a) one or more monkeypox virus antigens selected from the following: A35R, M1R, B6R and A29L, and / or (b) a fusion antigen formed by fusion of two or more monkeypox virus antigens or parts of antigens selected from the following: A35R, M1R, B6R and A29L. The present invention also provides a kit for preparing an anti-pox virus vaccine, which contains: (i) DNA encoding: (a) one or more monkeypox virus antigens selected from the following: A35R, M1R, B6R and A29L, and / or (b) a fusion antigen formed by fusion of two or more monkeypox virus antigens or parts of antigens selected from the following: A35R, M1R, B6R and A29L, and optionally (ii) a reagent for transcribing the DNA of (i) into mRNA. The present invention also provides the use of the above vaccine and kit for preparing the above vaccine.

Description

[Technical field]

[0001] The present invention relates to an anti-pox virus vaccine and a kit for preparing the anti-pox virus vaccine. The present invention also relates to the use of the vaccine and the kit for preparing the vaccine. [Background technology]

[0002] Poxviruses (i.e., Poxviridae viruses) are a class of large, pathogenic, double-stranded DNA viruses.

[0003] An infectious disease vaccine is a substance that can induce an immune response in the body and protect the body from infection or serious infection. It can be the pathogen itself, such as a virus or bacteria, or a part of the pathogen, such as a protein, or it can be genetic information encoding the pathogen protein, such as its ribonucleic acid sequence (RNA) or deoxyribonucleic acid sequence (DNA).

[0004] Since the genes and protein sequences of various viruses in the Poxviridae family are highly similar, a vaccine for one poxvirus can also prevent another poxvirus. There are currently two poxvirus vaccines on the market, both of which are whole virus vaccines. They are ACAM2000 and JYNNEOS. ACAM2000 is a replication-competent vaccinia virus, which may cause significant side effects after vaccination, such as systemic infection, eczema, myocarditis and even death. Therefore, people are more concerned about the safety of this vaccine and are not very willing to get vaccinated with it. JYNNEOS is a replication-deficient vaccinia virus, which cannot replicate in the human body. However, since it is still a whole virus, containing hundreds of proteins, the specific antigen information is unclear, and some proteins play an immunomodulatory function, and the specific role is still unclear. Therefore, people are also concerned about this vaccine. At present, there are reports on animal experiments on subunit vaccines of poxviruses, such as protein and DNA vaccines. Proteins usually need to be expressed in vitro cells, and the purification steps are relatively complicated. Moreover, since they are products of in vitro expression, their three-dimensional structure may be different from the protein structure during viral infection, so there is uncertainty about the immunogenicity. DNA vaccines are relatively simple to prepare, but their delivery requires the use of a gene gun, which is complex to operate and has the risk of integrating into the human genome. Therefore, it is not the best vaccine choice. [Summary of the invention]

[0005] The present invention relates to the following embodiments:

[0006] 1. An anti-pox virus vaccine comprising mRNA of the following antigens and / or fusion antigens:

[0007] (a) one or more monkeypox virus antigens selected from the group consisting of A35R, M1R, B6R and A29L, and / or

[0008] (b) A fusion antigen formed by fusing two or more monkeypox virus antigens or parts of the antigens selected from the group consisting of A35R, M1R, B6R and A29L.

[0009] 2. The vaccine according to embodiment 1, wherein the fusion antigen is a fusion antigen formed by fusion of the following monkeypox virus antigens or parts of antigens: A35R and M1R.

[0010] 3. The vaccine according to embodiment 1 or 2, wherein a signal peptide is attached to the 5' end of the fusion antigen.

[0011] 4. The vaccine according to embodiment 1, wherein the DNA encoding the monkeypox virus antigen and the fusion antigen is selected from:

[0012] A35R encoding DNA shown in SEQ ID NO: 1,

[0013] The DNA encoding M1R shown in SEQ ID NO: 3,

[0014] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 5,

[0015] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 7,

[0016] The DNA encoding B6R shown in SEQ ID NO: 9, and

[0017] The DNA encoding A29L shown in SEQ ID NO:11.

[0018] 5. The vaccine according to embodiment 4, wherein the mRNA comprises, from 5' to 3':

[0019] (1) 5' cap,

[0020] (2) 5'UTR,

[0021] (3) The corresponding RNA of the encoding DNA is selected from the following:

[0022] A35R encoding DNA shown in SEQ ID NO: 1,

[0023] The DNA encoding M1R shown in SEQ ID NO: 3,

[0024] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 5,

[0025] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 7,

[0026] The DNA encoding B6R shown in SEQ ID NO: 9, and

[0027] A29L encoding DNA shown in SEQ ID NO: 11,

[0028] (4) 3'UTR, and

[0029] (5) Poly A tail.

[0030] 6. The vaccine of embodiment 5, wherein the 5' cap is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

[0031] 7. The vaccine according to embodiment 5, wherein

[0032] The sequence of the 5'UTR encoding DNA is shown in SEQ ID NO: 13, and / or

[0033] The sequence of the 3'UTR encoding DNA is shown in SEQ ID NO:14.

[0034] 8. A vaccine according to embodiment 5, wherein the uridine triphosphate in the mRNA is N1-methylpseudouridine triphosphate.

[0035] 9. The vaccine according to embodiment 1, wherein the mRNA is selected from:

[0036] mRNA of A35R shown in SEQ ID NO: 2,

[0037] The mRNA of M1R shown in SEQ ID NO: 4,

[0038] mRNA of the fusion antigen of A35R and M1R shown in SEQ ID NO: 6,

[0039] mRNA of the fusion antigen of A35R and M1R shown in SEQ ID NO: 8,

[0040] The mRNA of B6R shown in SEQ ID NO: 10, and

[0041] The mRNA of A29L shown in SEQ ID NO:12.

[0042] 10. The vaccine according to embodiment 1, wherein when the vaccine contains a mixture of two or more mRNAs,

[0043] First, the two or more mRNAs are encapsulated separately and then mixed with each other, or

[0044] The two or more mRNAs are first mixed with each other and then encapsulated as a whole.

[0045] 11. A vaccine according to embodiment 1, wherein the mRNA is encapsulated with lipid nanoparticles.

[0046] 12. Use of the following antigens and / or mRNA of fusion antigens in the manufacture of anti-pox virus vaccines:

[0047] (a) one or more monkeypox virus antigens selected from the group consisting of A35R, M1R, B6R and A29L, and / or

[0048] (b) A fusion antigen formed by fusing two or more monkeypox virus antigens or parts of the antigens selected from the group consisting of A35R, M1R, B6R and A29L.

[0049] 13. The use according to embodiment 12, wherein the fusion antigen is a fusion antigen formed by fusion of the following monkeypox virus antigens or parts of antigens: A35R and M1R.

[0050] 14. The use according to embodiment 12 or 13, wherein a signal peptide is attached to the 5' end of the fusion antigen.

[0051] 15. The use according to embodiment 12, wherein the DNA encoding the monkeypox virus antigen and the fusion antigen is selected from:

[0052] A35R encoding DNA shown in SEQ ID NO: 1,

[0053] The DNA encoding M1R shown in SEQ ID NO: 3,

[0054] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 5,

[0055] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 7,

[0056] The DNA encoding B6R shown in SEQ ID NO: 9, and

[0057] The DNA encoding A29L shown in SEQ ID NO:11.

[0058] 16. The use according to embodiment 15, wherein the mRNA comprises, from 5' to 3':

[0059] (1) 5' cap,

[0060] (2) 5'UTR,

[0061] (3) The corresponding RNA of the encoding DNA is selected from the following:

[0062] A35R encoding DNA shown in SEQ ID NO: 1,

[0063] The DNA encoding M1R shown in SEQ ID NO: 3,

[0064] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 5,

[0065] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 7,

[0066] The DNA encoding B6R shown in SEQ ID NO: 9, and

[0067] A29L encoding DNA shown in SEQ ID NO: 11,

[0068] (4) 3'UTR, and

[0069] (5) Poly A tail.

[0070] 17. The use according to embodiment 16, wherein the 5' cap is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

[0071] 18. The use according to embodiment 16, wherein

[0072] The sequence of the 5'UTR encoding DNA is shown in SEQ ID NO: 13, and / or

[0073] The sequence of the 3'UTR encoding DNA is shown in SEQ ID NO:14.

[0074] 19. The use according to embodiment 16, wherein the uridine triphosphate in the mRNA is N1-methylpseudouridine triphosphate.

[0075] 20. The use according to embodiment 12, wherein the mRNA is selected from:

[0076] mRNA of A35R shown in SEQ ID NO: 2,

[0077] The mRNA of M1R shown in SEQ ID NO: 4,

[0078] mRNA of the fusion antigen of A35R and M1R shown in SEQ ID NO: 6,

[0079] mRNA of the fusion antigen of A35R and M1R shown in SEQ ID NO: 8,

[0080] The mRNA of B6R shown in SEQ ID NO: 10, and

[0081] The mRNA of A29L shown in SEQ ID NO:12.

[0082] 21. The use according to embodiment 12, wherein when a vaccine is manufactured from a mixture of two or more mRNAs,

[0083] First, the two or more mRNAs are encapsulated separately and then mixed with each other, or

[0084] The two or more mRNAs are first mixed with each other and then encapsulated as a whole.

[0085] 22. The use according to embodiment 12, wherein the mRNA is encapsulated with lipid nanoparticles.

[0086] 23. The use according to embodiment 12, wherein the vaccine is used against poxviruses of one or more genera selected from the group consisting of Orthopoxvirus, Capripoxvirus, Cervidpoxvirus, Suipoxvirus, Leporipoxvirus, Molluscipoxvirus, Yatapoxvirus, Avipoxvirus, Crocodylidpoxvirus and Parapoxvirus.

[0087] 24. The use according to embodiment 12, wherein the vaccine is used to fight against one or more poxviruses selected from the group consisting of: Variola virus / Smallpox virus, Vaccinia virus, Cowpox virus, Camelpox virus, Ectromelia virus, Monkeypox virus, Uasin Gishu disease virus, Tatera poxvirus, Raccoonpox virus, Volepoxvirus, Skunkpox virus, Sheeppox virus, Goatpox virus, Lumpy skin disease virus, Deerpoxvirus, Swinepox virus, Myxoma virus, Rabbitfibroma virus, Harefibroma virus virus), Squirrelfibroma virus, Molluscum contagiosum virus, Yabapoxvirus, Tanapox virus, Fowlpox virus, Canarypox virus, Crowpox virus, Juncopox virus, Mynahpox virus, Pigeonpox virus, Psittacinepoxvirus, Quailpox virus, Sparrowpox virus, Starlingpox virus, Turkeypox virus, Crocodilepoxvirus, Orf virus, Pseudocowpox virus, Bovine papular stomatitis virus, Sealpox virusvirus, Parapoxvirus of red deer in New Zealand, Carp edema virus, Salmonid gill poxvirus and Squirrelpox virus.

[0088] 25. A kit for preparing an anti-pox virus vaccine, comprising:

[0089] (i) DNA encoding:

[0090] (a) one or more monkeypox virus antigens selected from the group consisting of A35R, M1R, B6R and A29L, and / or

[0091] (b) a fusion antigen formed by fusing two or more monkeypox virus antigens or parts of the antigens selected from the group consisting of A35R, M1R, B6R and A29L, and

[0092] Optionally (ii) a reagent for transcribing the DNA of (i) into mRNA.

[0093] 26. The kit according to embodiment 25, wherein the fusion antigen is a fusion antigen formed by fusion of the following monkeypox virus antigens or parts of antigens: A35R and M1R.

[0094] 27. The kit according to embodiment 25 or 26, wherein a signal peptide is attached to the 5' end of the fusion antigen.

[0095] 28. The kit according to embodiment 25, wherein the DNA is selected from:

[0096] A35R encoding DNA shown in SEQ ID NO: 1,

[0097] The DNA encoding M1R shown in SEQ ID NO: 3,

[0098] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 5,

[0099] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 7,

[0100] The DNA encoding B6R shown in SEQ ID NO: 9, and

[0101] The DNA encoding A29L shown in SEQ ID NO:11.

[0102] 29. The kit according to embodiment 25, wherein the reagent for transcribing the DNA of (i) into mRNA is a reagent for transcribing the DNA of (i) into mRNA in vitro.

[0103] 30. The kit according to embodiment 29, wherein the reagents for in vitro transcription of the DNA of (i) into mRNA comprise:

[0104] A nucleic acid vector for in vitro transcription, comprising a promoter linked from 5' to 3', a coding DNA of a 5'UTR and a coding DNA of a 3'UTR,

[0105] adenosine triphosphate, cytidine triphosphate, guanosine triphosphate and uridine triphosphate,

[0106] 5' cap, and

[0107] RNA polymerase.

[0108] 31. The kit according to embodiment 30, wherein

[0109] The sequence of the 5'UTR encoding DNA is shown in SEQ ID NO: 13, and / or

[0110] The sequence of the 3'UTR encoding DNA is shown in SEQ ID NO:14.

[0111] 32. The kit of embodiment 30, wherein the 5' cap is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

[0112] 33. A kit according to embodiment 30, wherein the uridine triphosphate is N1-methylpseudouridine triphosphate.

[0113] 34. A kit according to embodiment 30, wherein the RNA polymerase is T7 RNA polymerase.

[0114] 35. Use of the following substances in the manufacture of a kit for preparing an anti-pox virus vaccine:

[0115] (i) DNA encoding:

[0116] (a) one or more monkeypox virus antigens selected from the group consisting of A35R, M1R, B6R and A29L, and / or

[0117] (b) a fusion antigen formed by fusing two or more monkeypox virus antigens or parts of the antigens selected from the group consisting of A35R, M1R, B6R and A29L, and

[0118] Optionally (ii) a reagent for transcribing the DNA of (i) into mRNA.

[0119] 36. The use according to embodiment 35, wherein the fusion antigen is a fusion antigen formed by fusion of the following monkeypox virus antigens or parts of antigens: A35R and M1R.

[0120] 37. The use according to embodiment 35 or 36, wherein a signal peptide is attached to the 5' end of the fusion antigen.

[0121] 38. The use according to embodiment 35, wherein the DNA is selected from:

[0122] A35R encoding DNA shown in SEQ ID NO: 1,

[0123] The DNA encoding M1R shown in SEQ ID NO: 3,

[0124] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 5,

[0125] A DNA encoding the fusion antigen of A35R and M1R as shown in SEQ ID NO: 7,

[0126] The DNA encoding B6R shown in SEQ ID NO: 9, and

[0127] The DNA encoding A29L shown in SEQ ID NO:11.

[0128] 39. The use according to embodiment 35, wherein the reagent for transcribing the DNA of (i) into mRNA is a reagent for transcribing the DNA of (i) into mRNA in vitro.

[0129] 40. The use according to embodiment 39, wherein the reagent for in vitro transcribing the DNA of (i) into mRNA comprises:

[0130] A nucleic acid vector for in vitro transcription, comprising a promoter linked from 5' to 3', a coding DNA of a 5'UTR and a coding DNA of a 3'UTR,

[0131] adenosine triphosphate, cytidine triphosphate, guanosine triphosphate and uridine triphosphate,

[0132] 5' cap, and

[0133] RNA polymerase.

[0134] 41. The use according to embodiment 40, wherein

[0135] The sequence of the 5'UTR encoding DNA is shown in SEQ ID NO: 13, and / or

[0136] The sequence of the 3'UTR encoding DNA is shown in SEQ ID NO:14.

[0137] 42. The use according to embodiment 40, wherein the 5' cap is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

[0138] 43. The use according to embodiment 40, wherein the uridine triphosphate is N1-methylpseudouridine triphosphate.

[0139] 44. The use according to embodiment 40, wherein the RNA polymerase is T7 RNA polymerase.

[0140] 45. The use according to embodiment 35, wherein the vaccine is used against poxviruses of one or more genera selected from the group consisting of Orthopoxvirus, Capripoxvirus, Cervidpoxvirus, Suipoxvirus, Leporipoxvirus, Molluscipoxvirus, Yatapoxvirus, Avipoxvirus, Crocodylidpoxvirus, and Parapoxvirus.

[0141] 46. ​​The use according to embodiment 35, wherein the vaccine is used to fight against one or more poxviruses selected from the group consisting of: Variola virus / Smallpox virus, Vaccinia virus, Cowpox virus, Camelpox virus, Ectromelia virus, Monkeypox virus, Uasin Gishu disease virus, Tatera poxvirus, Raccoonpox virus, Volepoxvirus, Skunkpox virus, Sheeppox virus, Goatpox virus, Lumpy skin disease virus, Deerpoxvirus, Swinepox virus, Myxoma virus, Rabbitfibroma virus, Harefibroma virus virus), Squirrelfibroma virus, Molluscum contagiosum virus, Yabapoxvirus, Tanapox virus, Fowlpox virus, Canarypox virus, Crowpox virus, Juncopox virus, Mynahpox virus, Pigeonpox virus, Psittacinepoxvirus, Quailpox virus, Sparrowpox virus, Starlingpox virus, Turkeypox virus, Crocodilepoxvirus, Orf virus, Pseudocowpox virus, Bovine papular stomatitis virus, Sealpox virusvirus, Parapoxvirus of red deer in New Zealand, Carp edema virus, Salmonid gill poxvirus and Squirrelpox virus.

[0142]

Technical Effect

[0143] Through the above implementation, the present invention achieves at least the following technical effects:

[0144] (1) The mRNA vaccine of the present invention does not require the aid of cell expression and has no risk of integration into the human genome. The preparation of mRNA is also simple and easy. Vaccines can be produced without contacting poxviruses that are capable of infection and reproduction, thus avoiding biosafety risks.

[0145] (2) The mRNA vaccine of the present invention has no obvious side effects and is highly safe.

[0146] (3) Thanks to the optimized sequence and combination with translation elements, proteins can be expressed efficiently and effective immune responses can be generated.

Brief Description of the Figures

[0147]

Figure 1

[0148]

Figure 2

[0149]

Figure 3

[0150]

Figure 4

[0151]

Figure 5

[0152]

Figure 6

[0153] Poxvirus

[0154] The genes and protein sequences of the viruses of the Poxviridae family are highly similar, and vaccines for one poxvirus can often prevent another poxvirus. Therefore, the mRNA vaccine of the present invention can be used for immunization of various Poxviridae viruses listed in the table below.

[0155]

[0156] 【5' cap】

[0157] The 5' end of eukaryotic mRNA usually has a bridged 7-methylguanosine (m7G) cap structure (Cap0). The 2' hydroxyl group of the first nucleoside after m7G in the Cap0 structure is methylated to form a Cap1 structure (m7GpppmN). Existing studies have found that the 5' end cap structure can regulate the splicing and maturation of mRNA and help RNA transcription products pass through the selective pores of the nuclear membrane and enter the cytoplasm. In addition, the 5' cap structure can also protect mRNA from degradation by nuclease exonucleases, work in conjunction with translation initiation factor proteins, recruit ribosomes, and assist ribosomes in binding to mRNA, so that translation starts from AUG. Normally, the Cap structure can recognize each other with the eukaryotic initiation factor 4E (eIF4E) at the initiation stage of translation and start the subsequent translation process. At the same time, the Cap1 structure can greatly reduce the immunogenicity of mRNA in vivo.

[0158] As long as it does not hinder the realization of the technical effects of the present invention, the 5' cap that can be used in the present invention is not particularly limited. In a preferred embodiment, the 5' cap is Cap1-GAG (3'OMe), i.e., m7 (3'OMeG) (5') ppp (5') (2'OMeA) pG, whose molecular formula is C 33 H 45 N 15 O 24 P 4 , the structural formula is as follows;

[0159]

[0160] There are different "capping" methods for preparing mRNA by in vitro transcription, including enzymatic capping, co-transcriptional capping, etc.

[0161] Enzymatic capping is a more traditional capping method. After the IVT reaction involving T7 polymerase is completed, the uncapped mRNA is purified first, and then Cap0 is produced by vaccinia virus capping enzyme (which has RNA triphosphatase activity, guanylyltransferase activity and guanine methyltransferase activity), which is then converted into Cap1 by 2'-O-methyltransferase and S-adenosylmethionine, and purified again to obtain the final mRNA.

[0162] One-step co-transcriptional capping is to directly add a cap analog to the IVT reaction system involving T7 polymerase to obtain mRNA containing the Cap1 structure in one step, and only one purification is required throughout the process. This reaction method reduces the preparation steps, thereby effectively shortening the overall processing time, simplifying the purification steps, and reducing the number of enzymes required. Therefore, chemical co-transcriptional capping is relatively simple in process, introduces fewer impurities, and can rapidly increase the production capacity of mRNA vaccines and drugs. At present, one-step co-transcriptional capping is gradually becoming the mainstream technical route for mRNA preparation technology.

[0163]

Uridine triphosphate (UTP)

[0164] As long as it does not hinder the realization of the technical effects of the present invention, the uridine triphosphate that can be used in the present invention is not particularly limited, and can be natural uridine triphosphate or any modified uridine triphosphate commonly used in the art. In a preferred embodiment, UTP is N1-methyl pseudouridine triphosphate (N1-Me-pUTP, usually represented by "Ψ"), and its molecular formula is C 10 H 14 N 2 Na 3 O 15 P 3 , the structural formula is as follows:

[0165]

[0166] Incorporation of N1-methylpseudouridine triphosphate during the production of mRNA vaccines and drugs can improve the translation efficiency of mRNA and reduce the immunogenicity of mRNA in vivo.

[0167] 【5'UTR and 3'UTR】

[0168] As long as it does not hinder the realization of the technical effects of the present invention, the 5'UTR and 3'UTR that can be used in the present invention are not particularly limited. In a preferred embodiment,

[0169] The coding DNA sequence of 5'UTR is as follows (SEQ ID NO: 13):

[0170] gcttgttctttttgcagaag ctcagaataa acgctcaact ttggccgcca cc

[0171] The coding DNA sequence of 3'UTR is as follows (SEQ ID NO: 14):

[0172]

[0173]

Antigen and fusion antigen

[0174] The poxvirus immunogen used in the present invention is preferably:

[0175] (a) one or more monkeypox virus antigens selected from the group consisting of A35R, M1R, B6R and A29L, and / or

[0176] (b) A fusion antigen formed by fusing two or more monkeypox virus antigens or parts of the antigens selected from the group consisting of A35R, M1R, B6R and A29L.

[0177] In a preferred embodiment, the fusion antigen is a fusion antigen formed by the fusion of the following monkeypox virus antigens or parts of the antigens: A35R and M1R. In a further preferred embodiment, the integral extracellular domain (IECD) of A35R is fused with M1R to form a fusion antigen (A35R_IECD-M1R). In another further preferred embodiment, the small extracellular domain (sECD) of A35R is fused with M1R to form a fusion antigen (A35R_sECD-M1R). In a preferred embodiment, a signal peptide (SP) may be attached to the 5' end of the fusion antigen.

[0178] As long as the technical effects of the present invention are not hindered, the DNA sequences and mRNA sequences of the above-mentioned antigens and fusion antigens that can be used in the present invention are not particularly limited, and can be the DNA sequences and mRNA sequences of the above-mentioned antigens and fusion antigens of any virus from the Poxviridae family. In a preferred embodiment, the present invention uses the DNA sequences and mRNA sequences of the above-mentioned antigens and fusion antigens derived from the genus Orthopoxvirus. In a preferred embodiment, the present invention uses the DNA sequences and mRNA sequences of the above-mentioned antigens and fusion antigens derived from Monkeypox virus. In a further preferred embodiment, the DNA sequences and mRNA sequences of the above-mentioned antigens and fusion antigens are as follows:

[0179]

A35R

[0180] [DNA](SEQ ID NO:1)

[0181]

[0182] [mRNA](SEQ ID NO:2)

[0183]

[0184]

[0185]

M1R

[0186] [DNA](SEQ ID NO:3)

[0187]

[0188] [mRNA](SEQ ID NO:4)

[0189]

[0190]

SP-A35R_IECD-M1R

[0191] [DNA](SEQ ID NO:5)

[0192]

[0193]

[0194] [mRNA](SEQ ID NO:6)

[0195]

[0196]

SP-A35R_sECD-M1R

[0197] [DNA](SEQ ID NO:7)

[0198]

[0199]

[0200] [mRNA](SEQ ID NO:8)

[0201]

[0202]

B6R

[0203] [DNA](SEQ ID NO:9)

[0204]

[0205] [mRNA] (SEQ ID NO: 10)

[0206]

[0207]

A29L

[0208] [DNA] (SEQ ID NO: 11)

[0209]

[0210] [mRNA] (SEQ ID NO: 12)

[0211]

[0212]

mRNA encapsulation vector and delivery method using the vector

[0213] Since naked mRNA cannot effectively enter the cells of the body for protein expression, and the stability of mRNA is poor and easy to degrade, the mRNA vaccine of the present invention is preferably encapsulated in a protective carrier. As long as it is sufficient to keep the mRNA vaccine of the present invention from degrading for a sufficiently long time and does not hinder the realization of the technical effects of the present invention, the encapsulation carrier of mRNA that can be used in the present invention is not particularly limited. In a preferred embodiment, nanoparticle-type carriers are used to encapsulate mRNA in the present invention. In a further preferred embodiment, nanoparticles containing lipids (also referred to as "lipid nanoparticles (lipidnanopartical, LNP)") are used in the present invention to encapsulate mRNA. In a further preferred embodiment, LNP may include but is not limited to liposomes and micelles. In a specific embodiment, the lipid nanoparticles may include cationic and / or ionizable lipids, anionic lipids, neutral lipids, amphiphilic lipids, pegylated lipids and / or structural lipids.

[0214] In one embodiment, the LNP may comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) cationic and / or ionizable lipids. "Cationic lipid" generally refers to a lipid that carries any number of net positive charges at a certain pH (e.g., physiological pH). The cationic lipids may include, but are not limited to, SM102, 3-(didodecylamino)-N1,N1,4-triadecyl-1-piperazineethylamine (KL10), N1-[2-(triadecylamino)ethyl]-N1,N4,N4-triadecyl-1,4-piperazinediethylamine (KL22), 14,25-tricosyl-15,18,21,24-tetraazaoctaporane (KL25), DLin-DMA, DLin-K-DMA, DLin-KC2-DMA, octyl-CLinDMA, octyl-CLinDMA (2S), DODAC, DOTMA, DDAB, DOTAP, DOTAP.C1, DC-Choi, DOSPA, DOGS, DODAP, DODMA and DMRIE.

[0215] In certain embodiments, the molar ratio of the cationic lipid in the lipid nanoparticle is about 40-70%, for example, about 40-65%, about 40-60%, about 45-55% or about 48-53%.

[0216] In a specific embodiment, the LNP may include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) non-cationic lipids. The non-cationic lipids may include anionic lipids. Anionic lipids suitable for lipid nanoparticles of the present application may include phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamine, N-succinylphosphatidylethanolamine, N-glutarylphosphatidylphosphatidylethanolamine, and other neutral lipids having anionic groups connected thereto.

[0217] In a more specific embodiment, the non-cationic lipid may include a neutral lipid, which may include, for example, a phospholipid, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (PO ...phosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (DPPC), dioleoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (DPPG), dioleoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmito In some embodiments, the present invention relates to a lipid having a mixture of saturated and unsaturated fatty acid chains. The lipid having a mixture of saturated and unsaturated fatty acid chains can be used. For example, the neutral lipid described in the present application can be selected from DOPE, DSPC, DPPC, POPC or any related phosphatidylcholine.

[0218] In certain embodiments, the molar ratio of the phospholipid in the lipid nanoparticles is about 5-20%.

[0219] In some embodiments, the LNP may include lipid conjugates, for example, polyethylene glycol (PEG)-modified lipids and derived lipids. PEG-modified lipids may include, but are not limited to, polyethylene glycol chains covalently linked to lipids with alkyl chains of lengths of C6 to C20, up to a length of 5 kDa. The addition of these components can prevent lipid aggregation, increase circulation duration, facilitate lipid-nucleic acid compositions to be delivered to target cells, or rapidly release nucleic acids. For example, the polyethylene glycol (PEG)-modified lipid molecule may be a PEG-ceramide with a shorter acyl chain (e.g., C14 or C18). In some embodiments, the polyethylene glycol (PEG)-modified lipid molecule has a molar ratio of about 0.5 to 2% in lipid nanoparticles, for example, about 1 to 2%, about 1.2 to 1.8%, or about 1.4 to 1.6%. In some embodiments, the polyethylene glycol (PEG)-modified lipid molecule may be PEG2000-DMG.

[0220] In some embodiments, the LNP may further comprise cholesterol. In some embodiments, the molar ratio of cholesterol in the lipid nanoparticle is about 30-50%, for example, about 35-45%, or about 38-42%.

[0221] In some embodiments, the LNP may include cationic lipids, cholesterol, phospholipids and lipid molecules modified with polyethylene glycol. In some embodiments, the molar ratio of the cationic lipids, cholesterol, phospholipids and lipid molecules modified with polyethylene glycol may be 45-55:35-45:5-15:0.5-2.

[0222] There is no particular limitation on the delivery method using the above-mentioned encapsulation carrier, and any delivery method conventionally used in the art may be adopted, for example, the delivery method mentioned in US20160376224A1 or WO2015199952A1 may be adopted.

[0223] [Example]

[0224] [Example 1: Preparation of mRNA vaccine]

[0225] The sequences of DNA encoding several protein (or fusion protein) antigens derived from monkeypox virus listed in Table 1 below were obtained.

[0226] [Table 1: Several protein (or fusion protein) antigens from monkeypox virus and their encoding DNA sequences]

[0227] Protein (or fusion protein) antigen The sequence of the coding DNA A35R SEQ ID NO: 1 M1R SEQ ID NO: 3 SP-A35R_IECD-M1R SEQ ID NO: 5 SP-A35R_sECD-M1R SEQ ID NO: 7 B6R SEQ ID NO: 9 A29L SEQ ID NO: 11

[0228] The coding DNA sequence listed in Table 1 above was inserted between the 5' untranslated region (UTR) (SEQ ID NO: 13) and 3' UTR (SEQ ID NO: 14) downstream of the T7 promoter in an in vitro transcription (IVT) vector based on T7 RNA polymerase and used as an IVT template.

[0229] Prepare 20 μL of IVT reaction system according to Table 2 below.

[0230] [Table 2: 20μL IVT reaction system]

[0231] Components quantity 10× reaction buffer (Novozyme, DD4101R-02) 2μL 100 mM ATP solution (Novozyme, DD4106-PA-01) 2μL 100 mM CTP solution (Novozyme, DD4107-PA-01) 2μL 100 mM GTP solution (Novozyme, DD4108-PA-01) 2μL 100mM N1-Me-pUTP solution (Novozyme, DD4114-PA-01) 2μL IVT Template 1 μg Cap1-GAG (3'OMe) (Novozymes, DD4119-PC-01) 2μL T7 RNA polymerase (250U / μL) (Novozymes, DD4101-02) 1μL Inorganic pyrophosphatase (Novozyme, D4103-PC-02) 0.04U <![CDATA[RNase-free ddH 2 O (Beyotime, R0022)]]> Up to 20 μL

[0232] IVT was performed, and the transcription product was purified to obtain the mRNA shown in Table 3 below ( Figure 1 ).

[0233] [Table 3: mRNA]

[0234] Protein (or fusion protein) antigen mRNA sequence A35R SEQ ID NO: 2 M1R SEQ ID NO: 4 SP-A35R_IECD-M1R SEQ ID NO: 6 SP-A35R_sECD-M1R SEQ ID NO: 8 B6R SEQ ID NO: 10 A29L SEQ ID NO: 12

[0235] The mRNA or a combination thereof listed in Table 3 above was encapsulated with lipid nanoparticles (LNP) to prepare the mRNA vaccines (LNP-mRNA) of each group shown in Table 4 below.

[0236]

Table 4: mRNA vaccines in each group

[0237]

[0238] [Example 2: Administration and efficacy of mRNA vaccines]

[0239] (1) Administration of mRNA vaccines

[0240] like Figure 2 As shown, each group of mRNA vaccines (LNP-mRNA) prepared in Example 1 was initially administered to mice by intramuscular injection (Prime) on day 0, and was boosted by intramuscular injection (Boost) on day 14. The control group was administered Dulbecco's phosphate buffered saline (DPBS, Thermo Fisher, 14190136).

[0241] Blood was collected on days 7, 13, 29 and 35 after each group of mRNA vaccines were administered to mice. Spleens were collected on day 30 after each group of mRNA vaccines were administered to mice. On day 36 after each group of mRNA vaccines were administered to mice, vaccinia virus was used to challenge the virus through the intranasal route.

[0242] (2) Determination of total antibody concentration

[0243] For the blood collected on the 29th day after the administration of each group of mRNA vaccines to mice, the concentrations of total anti-A35R antibody, total anti-M1R antibody, total anti-B6R antibody and total anti-A29L antibody therein were detected by measuring the absorbance at 450 nm (OD450) ( Figure 3 ).

[0244] like Figure 3 As shown, after each group of mRNA vaccines were administered to mice,

[0245] The total anti-A35R antibody levels in the blood of each test group increased significantly, and the total anti-A35R antibody levels in the blood of AB group 2, A+B group 1, A+B group 2, A+B+C+D group 1, and A+B+C+D group 2 increased more significantly, among which the total anti-A35R antibody levels in the blood of AB group 2, A+B group 1, and A+B group 2 increased most significantly;

[0246] The total anti-M1R antibody levels in the blood of each test group increased, and the total anti-M1R antibody levels in the blood of AB group 1, AB group 2, A+B group 2, and A+B+C+D group 2 increased more significantly, among which the total anti-M1R antibody levels in the blood of AB group 1, AB group 2, and A+B group 2 increased most significantly;

[0247] The total anti-B6R antibody levels in the blood of A+B+C+D group 1 and A+B+C+D group 2 were significantly increased;

[0248] The total anti-A29L antibody levels in the blood of A+B+C+D Group 1 and A+B+C+D Group 2 were significantly increased.

[0249] (3) Serum neutralization test

[0250] Serum was separated from the blood collected on the 29th day after each group of mRNA vaccines were administered to mice and diluted in 1:2 ratio. n (n = positive integer) dilutions to prepare a dilution series.

[0251] Take the vaccinia virus stock solution and dilute it to 400-500 PFU (plaque forming units) / ml.

[0252] The serum dilution series and the virus dilution were mixed in equal volumes in a 96-well plate and incubated at 37°C for 1 hour. The PFU of each mixture was then determined. The serum dilution that reduced the PFU by 50% compared to the control group without serum addition was set as the neutralizing antibody titer of the serum.

[0253] As shown in Figure 4, the neutralizing antibody levels (PFU / well) against vaccinia virus in the serum collected on the 29th day after each group of mRNA vaccines were administered to mice.

[0254] like Figure 4 As shown, after each group of mRNA vaccines were administered to mice, the sera of AB group 1, AB group 2 and A+B group 2 achieved complete neutralization of vaccinia virus, indicating that the level of neutralizing antibodies against vaccinia virus was the most abundant among them.

[0255] (4) Weight changes after viral attack

[0256] On day 36 after administration of each group of mRNA vaccines to mice, the treated mice were challenged with vaccinia virus by intranasal administration, and the treated mice were weighed on consecutive days thereafter.

[0257] like Figure 5 As shown, in sharp contrast to the control group administered with DPBS, the mice administered with each group of mRNA vaccines did not undergo significant weight changes due to challenge with vaccinia virus.

[0258] (5) Changes in viral load in the lungs after viral attack

[0259] The mice described in (4) above were killed, lung tissues were collected, and the viral load (PFU / g) therein was measured.

[0260] like Figure 6As shown, in sharp contrast to the control group administered with DPBS, the viral load in the lungs of mice administered with each group of mRNA vaccines was close to 0. This indicates that each group of mRNA vaccines exhibited significant anti-vaccinia virus immune efficacy.

Claims

1. An anti-poxvirus vaccine comprising mRNA of a fusion antigen formed by fusing a portion of a monkeypox virus antigen A35R with a portion of a monkeypox virus antigen M1R, wherein the mRNA of the fusion antigen formed by fusing a portion of A35R with a portion of M1R is as shown in SEQ ID NO: 6 or SEQ ID NO:

8.

2. The vaccine according to claim 1, wherein the anti-poxvirus vaccine further comprises one or two monkeypox virus antigens selected from B6R and A29L.

3. The vaccine according to claim 2, wherein The coding DNA of B6R is shown in SEQ ID NO: 9, and The A29L encoding DNA is shown in SEQ ID NO:

11.

4. The vaccine according to claim 1 or 2, wherein the 5' cap in the mRNA is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

5. The vaccine according to claim 1 or 2, wherein the uridine triphosphate in the mRNA is N1-methylpseudouridine triphosphate.

6. The vaccine according to claim 2, wherein The mRNA of B6R is shown in SEQ ID NO: 10, and The mRNA of A29L is shown in SEQ ID NO:

12.

7. The vaccine according to claim 1 or 2, in, When the vaccine contains a mixture of two or more mRNAs, First, the two or more mRNAs are encapsulated separately and then mixed with each other, or The two or more mRNAs are first mixed with each other and then encapsulated together. The encapsulation is performed using lipid nanoparticles.

8. Use of mRNA of a fusion antigen formed by fusing a portion of monkeypox virus antigen A35R with a portion of monkeypox virus antigen M1R in the manufacture of an anti-orthopoxvirus poxvirus vaccine, The mRNA of the fusion antigen formed by the fusion of a part of A35R and a part of M1R is as shown in SEQ ID NO: 6 or SEQ ID NO: 8, and The poxvirus of the genus Orthopoxvirus is selected from the group consisting of: cowpox virus and monkeypox virus.

9. The use according to claim 8, wherein the anti-Optopoxvirus vaccine further comprises one or two monkeypox virus antigens selected from B6R and A29L.

10. The use according to claim 9, wherein The coding DNA of B6R is shown in SEQ ID NO: 9, and The A29L encoding DNA is shown in SEQ ID NO:

11.

11. The use according to claim 8 or 9, wherein the 5' cap in the mRNA is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

12. The method according to claim 8 or 9, wherein the uridine triphosphate in the mRNA is N1-methylpseudouridine triphosphate.

13. The use according to claim 9, wherein The mRNA of B6R is shown in SEQ ID NO: 10, and The mRNA of A29L is shown in SEQ ID NO:

12.

14. The use according to claim 8 or 9, in, When a vaccine is made from a mixture of two or more mRNAs, First, the two or more mRNAs are encapsulated separately and then mixed with each other, or The two or more mRNAs are first mixed with each other and then encapsulated together. The encapsulation is performed using lipid nanoparticles.

15. A kit for preparing an anti-pox virus vaccine, comprising: (i) a DNA encoding a fusion antigen formed by fusing a portion of monkeypox virus antigen A35R and a portion of monkeypox virus antigen M1R, and (ii) a reagent for in vitro transcription of the DNA of (i) into mRNA, The DNA encoding the fusion antigen formed by the fusion of a part of A35R and a part of M1R is shown in SEQ ID NO: 5 or SEQ ID NO: 7, A signal peptide is attached to the 5' end of the fusion antigen. The reagent for in vitro transcription of the DNA of (i) into mRNA comprises a nucleic acid vector for in vitro transcription, wherein the nucleic acid vector for in vitro transcription comprises a promoter linked from 5' to 3', a coding DNA of a 5'UTR, and a coding DNA of a 3'UTR, and in The sequence of the 5'UTR encoding DNA is shown in SEQ ID NO: 13, and The sequence of the 3'UTR encoding DNA is shown in SEQ ID NO:

14.

16. The kit according to claim 15, wherein the kit further comprises DNA encoding one or two monkeypox virus antigens selected from B6R and A29L.

17. The kit according to claim 16, wherein The coding DNA of B6R is shown in SEQ ID NO: 9, and The A29L encoding DNA is shown in SEQ ID NO:

11.

18. The kit according to claim 15, wherein the reagent for in vitro transcription of the DNA of (i) into mRNA further comprises: adenosine triphosphate, cytidine triphosphate, guanosine triphosphate and uridine triphosphate, 5' cap, and RNA polymerase.

19. The kit of claim 18, wherein the 5' cap is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

20. The kit of claim 18, wherein the uridine triphosphate is N1-methylpseudouridine triphosphate.

21. The kit of claim 18, wherein the RNA polymerase is T7 RNA polymerase.

22. Use of the following substances in the manufacture of a kit for preparing an anti-orthopoxvirus vaccine: (i) a DNA encoding a fusion antigen formed by fusing a portion of monkeypox virus antigen A35R and a portion of monkeypox virus antigen M1R, and (ii) a reagent for in vitro transcription of the DNA of (i) into mRNA, The DNA encoding the fusion antigen formed by the fusion of a part of A35R and a part of M1R is shown in SEQ ID NO: 5 or SEQ ID NO: 7, A signal peptide is attached to the 5' end of the fusion antigen. The reagent for in vitro transcription of the DNA of (i) into mRNA comprises a nucleic acid vector for in vitro transcription, wherein the nucleic acid vector for in vitro transcription comprises a promoter linked from 5' to 3', a coding DNA of a 5'UTR, and a coding DNA of a 3'UTR, in The sequence of the 5'UTR encoding DNA is shown in SEQ ID NO: 13, and The sequence of the 3'UTR encoding DNA is shown in SEQ ID NO: 14, and The poxvirus of the genus Orthopoxvirus is selected from the group consisting of: cowpox virus and monkeypox virus.

23. The use according to claim 22, wherein the kit further comprises DNA encoding one or two monkeypox virus antigens selected from B6R and A29L.

24. The use according to claim 23, wherein The coding DNA of B6R is shown in SEQ ID NO: 9, and The A29L encoding DNA is shown in SEQ ID NO:

11.

25. The use according to claim 22, wherein the reagent for in vitro transcription of the DNA of (i) into mRNA further comprises: adenosine triphosphate, cytidine triphosphate, guanosine triphosphate and uridine triphosphate, 5' cap, and RNA polymerase.

26. The use according to claim 25, wherein the 5' cap is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

27. The method of claim 25, wherein the uridine triphosphate is N1-methylpseudouridine triphosphate.

28. The use according to claim 25, wherein the RNA polymerase is T7 RNA polymerase.

Images