Sweet buckwheat faespds gene vigs system and application thereof

By constructing the FaesPDS gene VIGS system of sweet buckwheat and inducing gene silencing in sweet buckwheat using the tobacco brittle virus vector, the problems of low yield and breeding difficulty of sweet buckwheat were solved, the ornamental traits were improved and the agronomic traits were identified, and the development of new varieties of sweet buckwheat was promoted.

CN116716310BActive Publication Date: 2025-11-07YANGTZE UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310524930.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-10
Publication Date
2025-11-07
Estimated Expiration
2043-05-10

AI Technical Summary

Technical Problem

The low yield, difficulty in hybridization breeding, and lagging genetic engineering research of sweet buckwheat due to the hetero-self-incompatible (HSI) system formed by dimorphic flowers have hindered its development and utilization.

Method used

A VIGS system for the FaesPDS gene in sweet buckwheat was constructed. Young leaves of sweet buckwheat were infected by leaf injection, and gene silencing was induced by the tobacco brittle virus (TRV) vector to achieve the silencing of the FaesPDS gene, resulting in photobleaching symptoms and reducing gene expression.

Benefits of technology

The FaesPDS gene VIGS system of sweet buckwheat was successfully constructed, which significantly reduced the expression of the FaesPDS gene and improved the ornamental value of sweet buckwheat leaves. This will accumulate gene resources for the breeding of new varieties that are suitable for both ornamental and edible purposes, and assist in the identification of the function of agronomic trait genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure HDA0004234009180000011
    Figure HDA0004234009180000011
  • Figure HDA0004234009180000012
    Figure HDA0004234009180000012
Patent Text Reader

Abstract

The present application relates to the field of plant molecular biology, in particular to a kind of sweet buckwheat FaesPDS gene VIGS system and its application.The present application successfully isolates 3500bp sweet buckwheat FaesPDS gene genomic DNA sequence by homologous cloning.Select 478bp sequence in sweet buckwheat FaesPDS gene genomic DNA, construct pTRV2-FaesPDS gene silencing vector, transform into agrobacterium.The agrobacterium carrying pTRV1 and the agrobacterium carrying pTRV2-FaesPDS gene silencing vector are infected into sweet buckwheat by leaf injection method, and the newly grown leaf appears light bleaching symptom.Real-time fluorescent quantitative PCR verifies the leaf appearing light bleaching symptom, and the relative expression level of its FaesPDS gene is greatly reduced.The leaf of sweet buckwheat light bleaching symptom improves the ornamental value of sweet buckwheat leaf, can enrich the landscape elements in the landscape of rural buckwheat flower sea construction, and simultaneously accumulates gene resources for the cultivation of new variety of edible and ornamental flower leaf sweet buckwheat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a type of sweet buckwheat. FaesPDS Gene VIGS system and its application. Background Technology

[0002] Sweet buckwheat ( Fagopyrum esculentum Sweet buckwheat (Sweet Buckwheat) is an economic crop with multiple uses, including food, medicine, ornamental value, and soil remediation. Its grains are gluten-free but rich in bioactive substances such as rutin, quercetin polyphenols, polysaccharides, and lysine. In recent years, it has received considerable attention as an important functional food, with a broad market prospect. Meanwhile, sweet buckwheat, due to its short growth period, wide adaptability, strong resistance, and vibrant flower colors, can be developed into agritourism, making it one of the characteristic crops for rural agricultural restructuring and an important industrial material to support rural revitalization. However, as a typical dimorphic crop, sweet buckwheat suffers from low yields and difficulties in hybridization breeding due to the hetero-self-incompatible (HSI) system formed by dimorphic flowers, becoming a bottleneck restricting the development and utilization of this important economic crop. Compared with major food crops, research on sweet buckwheat genetic engineering is relatively lagging. The establishment and application of this system are of great significance for identifying the function of genes controlling important agronomic traits in sweet buckwheat, creating male-sterile lines, conducting molecular breeding of sweet buckwheat, and cultivating new varieties of sweet buckwheat suitable for both ornamental and edible purposes.

[0003] Virus-induced gene silencing (VIGS) is a post-transcriptional gene silencing technique widely used in plant genetic engineering and gene function identification research. Its principle is that plants initiate RNA silencing mechanisms to defend against viral infection. Tobacco brittle virus (TRV) is a widely used, efficient, and persistent viral vector that mediates gene silencing without inducing virus-induced symptoms. Modified TRV can promote the insertion of non-viral sequences and subsequent infection of plants; therefore, TRV has broad applications in plant gene function identification (Liu et al., 2002; Velásquez et al., 2009). Summary of the Invention

[0004] To address the above problems, the present invention provides a sweet buckwheat... FaesPDS Gene VIGS system and its application.

[0005] First, this invention provides a sweet buckwheat FaesPDS The gene, whose nucleotide sequence is shown in SEQ ID No. 1.

[0006] Secondly, the present invention provides a method for VIGS. FaesPDSA gene fragment, whose nucleotide sequence is shown as SEQ ID No. 2.

[0007] The application also provides a method for constructing the F. esculentum FaesPDS The application also provides a method for constructing the F. esculentum

[0008] The application provides a VIGS vector containing the F. esculentum FaesPDS gene or a fragment thereof, or a host cell and an engineering bacterium.

[0009] The application also provides the F. esculentum FaesPDS gene or a fragment thereof, or a VIGS vector containing the F. esculentum FaesPDS gene or a fragment thereof.

[0010] In one specific embodiment of the application, the VIGS vector containing the F. esculentum FaesPDS gene or a fragment thereof is used to infect young leaves of F. esculentum by leaf injection together with an RNAi vector of TRV, so as to induce VIGS of the F. esculentum FaesPDS gene.

[0011] The application also provides a method for inducing the F. esculentum FaesPDS gene or a fragment thereof is used to infect young leaves of F. esculentum by leaf injection together with an RNAi vector of TRV, so as to induce VIGS of the F. esculentum FaesPDS gene.

[0012] The application first constructs a VIGS system of the F. esculentum FaesPDS gene, and obtains a system capable of silencing the F. esculentum FaesPDS gene. FaesPDS gene expression of the F. esculentum FaesPDS gene is greatly reduced compared with the control. The F. esculentum leaves with light bleaching symptoms improve the ornamental value of F. esculentum leaves, enrich the landscape elements in garden greening and rural buckwheat flower sea construction, and accumulate gene resources for the cultivation of new varieties of mottled F. esculentum for both viewing and eating. The establishment of the system has a very important reference value for the functional identification of important agronomic trait genes of F. esculentum. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 shown is a F. esculentum FaesPDSPCR detection of Agrobacterium transformed with gene silencing vectors.

[0014] Figure 2 Figure shows the photobleaching phenotype of tobacco infected by leaf injection. (A) Control (pTRV2 empty vector); (B) pTRV2-FaesPDS2; (C) pTRV2-FaesPDS2-2; (D) pTRV2-FaesPDS2-3. FaesPDS Infected.

[0015] Figure 3 Figure shows the photobleaching phenotype of green leaf white flower isopistilous buckwheat infected by leaf injection. (A) Control (pTRV2 empty vector); (B, C, D) pTRV2-FaesPDS2-2; (E, F, G) pTRV2-FaesPDS2-3. FaesPDS Infected.

[0016] Figure 4 Figure shows the photobleaching phenotype of purple leaf red flower isopistilous buckwheat infected by leaf injection. (A) Control (pTRV2 empty vector); (B, C, D) pTRV2-FaesPDS2-2; (E, F, G) pTRV2-FaesPDS2-3. FaesPDS Infected.

[0017] Figure 5 Figure shows the leaves used for real-time fluorescence quantification. (A, B) Photobleaching phenotype leaves of green leaf white flower isopistilous buckwheat; (CK1) Control (pTRV2 empty vector) of green leaf white flower isopistilous buckwheat; (C) Photobleaching phenotype leaves of green leaf red flower isopistilous buckwheat; (D) Photobleaching phenotype leaves of purple leaf red flower isopistilous buckwheat; (CK2) Control (pTRV2 empty vector) of purple leaf red flower isopistilous buckwheat.

[0018] Figure 6 Figure shows the buckwheat FaesPDS gene in Figure 5 corresponding plants. DETAILED DESCRIPTION

[0019] The following examples are provided to illustrate the present application, but not to limit the scope of the present application. If not specifically indicated, the examples are carried out according to the conventional experimental conditions or the conditions suggested by the manufacturer's instruction.

[0020] Example 1 Cloning buckwheat FaesPDS gene

[0021] According to the PDS homologous gene sequence of tobacco and bitter buckwheat in NCBI, specific primers (FaesPDS2-F, FaesPDS2-R) are designed in the conservative region, and the buckwheat FaesPDS gene is amplified by PCR with buckwheat genomic DNA as a template, electrophoresis, gel recovery of the target DNA fragment, and ligation to pTOPO-TA vector, which is transformed into E. coli , LB solid medium (containing 50 μg / mL Amp +Screening, picking single clone, PCR detection, positive clone sequencing.

[0022] FaesPDS2-F: TCGGTTGCAGTGGAAGGAACATTC;

[0023] FaesPDS2-R: CAAAATCTTGGCCTTGCTCTGATC.

[0024] By homologous cloning, 3500bp F. esculentum PDS gene was successfully isolated FaesPDS Genomic DNA sequence, the sequence is shown as SEQ ID No. 1.

[0025] Example 2

[0026] Using F. esculentum genomic DNA sequence as template, 400-500bp DNA sequence of more conservative segment was selected, and primers (PDSVIGS-F492, PDSVIGS-R) were designed, the target DNA fragment was amplified by PCR, electrophoresis, gel recovery, and the target DNA fragment was cloned into pTRV2 vector. FaesPDS PDSVIGS-F492: GTTACCGAATTC

[0027] GGCTCAAGATGGATTGACT G; TCTAGA

[0028] PDSVIGS-R: CTCGAGACGCGT GAGCTC GATCAACAATAGGCATGCAC.

[0029] The pTRV2 plasmid was extracted, digested with Sac I and XBa I endonuclease, electrophoresis, gel recovery and purification of pTRV2 linear plasmid, and the 400-500bp F. esculentum gene cloned in front was connected to pTRV2 vector by Exnase II enzyme. FaesPDS After that, the ligation product was transformed into E. coli, screened on LB solid medium (containing 50 μg / mL kanamycin), and the positive clone was picked and cultured in LB liquid medium (containing 50 μg / mL kanamycin). Bacterial liquid PCR detection, extraction of plasmid for sequencing, and the correct plasmid was named as pTRV2- FaesPDS .

[0030] The GV3101 Agrobacterium was prepared, and pTRV1 (RNAi vector of tobacco virus (TRV)), pTRV2 and the correct pTRV2- FaesPDS ​The GV3101 Agrobacterium strain was transformed, and the single colonies were picked and cultured in LB solid medium (containing 50 μg / mL kanamycin, 50 μg / mL rifampicin) at 28°C under inversion, and the positive clones were verified by PCR and sequencing, and the positive clones with correct sequencing were reserved.

[0031] F. esculentum FaesPDS The 478 bp conserved sequence (as shown in SEQ ID No. 2) in the genomic DNA was cloned into the pTRV2 vector, and the pTRV2- FaesPDS Figure 1 The pTRV2- FaesPDS The gene silencing vector has been successfully transformed into Agrobacterium.

[0032] Example 3 pTRV2- FaesPDS Gene silencing vector infects tobacco and F. esculentum

[0033] 1. 50 μL of GV3101 Agrobacterium liquid containing pTRV1, pTRV2 empty vector and pTRV2- FaesPDS plasmid, respectively, was added to 5 mL of LB liquid medium (containing 50 μg / mL kanamycin, 50 μg / mL rifampicin), and cultured at 28°C and 180 rpm for 12 h.

[0034] 2. Prepare 4 bottles of 50 mL liquid LB medium, and add 50 μL of kanamycin, 25 μL of rifampicin, 500 μL of MES buffer, and 5 μL of acetyl-syringone solution to the LB medium.

[0035] 3. Take 1-2 ml of the expanded culture, and inoculate the pTRV1-containing liquid into 2 bottles of liquid LB medium; inoculate the pTRV2 empty vector, pTRV2- FaesPDS recombinant plasmid-containing liquid into the remaining 2 bottles of liquid LB medium, respectively. Continue to expand the culture at 28°C and 180 rpm until the concentration of Agrobacterium in each bottle is at OD600=0.6-0.8.

[0036] 4. Transfer the bacterial liquid to a 50 mL centrifuge tube, and centrifuge at 4°C and 5000 rpm for 5 min to enrich the bacterial bodies, and then resuspend the bacterial bodies with 20 mL of infiltration buffer, and slowly shake at 28°C and 90 rpm for 3 h.

[0037] 5. Mix pTRV1 with pTRV2, pTRV2- FaesPDS at a ratio of 1:1, and then use a 1 mL sterile syringe to inject the mixed bacterial liquid into the tobacco leaves and the 1-week-old F. esculentum cotyledons, respectively, and inject the true leaves once after 2 weeks.

[0038] ​6. The injected plants were completely covered with black plastic bags to ensure high temperature and humidity inside, and placed in the plant growth room. The plastic bags were removed after 2 days.

[0039] After injection for about 2 weeks, the phenotype changes of tobacco and sweet potato leaves were observed.

[0040] After injection for about 2 weeks, the newly grown leaves of tobacco showed obvious photobleaching symptoms (Fig. 2), indicating that the basic principle and experimental method of the experiment were feasible. The newly grown leaves of the same long-styled F. esculentum infected with green leaf white flower and the same long-styled F. esculentum infected with purple leaf red flower showed photobleaching symptoms (Fig. 3), indicating that the experimental method was feasible on sweet potato plants, and the virus-induced gene silencing (VIGS) system was successfully constructed on sweet potato plants. Figure 2 Figure 3 4

[0041] Example 4 Real-time fluorescent quantitative PCR detection verification

[0042] The sweet potato leaves with photobleaching symptoms were cut, and the sweet potato leaves injected with pTRV1 and pTRV2 empty vector bacterial solution were used as controls. The RNA of the leaves was extracted, and cDNA was obtained by reverse transcription.

[0043] The relative expression of the sweet potato gene in the leaves was detected, and the sweet potato actin gene (Genbank accession number: HQ398855.1) was used as an internal reference gene for real-time fluorescent quantitative qRT-PCR detection. FaesPDS Fresh leaves of the treated and control groups of sweet potato were taken, and the relative expression of the sweet potato gene in the leaves was detected. The results showed that the relative expression level of the sweet potato gene in the leaves with photobleaching symptoms was significantly reduced (P < 0.05), indicating that the VIGS system of sweet potato was successfully constructed.

[0044] FaesPDS FaesPDS P <0.05), indicating that the VIGS system of sweet potato was successfully constructed. Figure 5 Figure 6

[0045]

[0046] Although the present application has been described in detail in the foregoing description with general principles and specific embodiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application.​​​​​​​​

Claims

1. A device for VIGS FaesPDS The gene fragment, whose nucleotide sequence is shown in SEQ ID No.

2.

2. A method of constructing a sweet buckwheat FaesPDS gene VIGS system, characterized by, Amplification of sweet buckwheat FaesPDS a fragment of the gene, the fragment comprising at least the nucleotide sequence of SEQ ID No. 1, is cloned into a Tobacco Rattle Virus (TRV) gene silencing expression vector pTRV2, wherein the sweet buckwheat FaesPDS The nucleotide sequence of the gene is shown in SEQ ID No.

1.

3. A VIGS vector comprising the gene fragment of claim 1. FaesPDS 1.

4. An engineered bacterium comprising the genetic fragment of claim 1 or the vector of claim 3.

5. Use of the genetic fragment of claim 1 or the vector of claim 3 in inducing the appearance of mosaic leaf traits in leaves of sweet buckwheat.

6. Use according to claim 5, characterized in that, The vector of claim 3 was used to infect young leaves of sweet buckwheat by leaf injection method with the RNAi vector of tobacco rattle virus (TRV) to induce VIGS of sweet buckwheat FaesPDS genes.

7. A method of inducing the appearance of mosaic leaf traits in leaves of T. estivum, characterized in that, The vector of claim 3 was used to infect young leaves of sweet buckwheat by leaf injection method with the RNAi vector of tobacco rattle virus (TRV) to induce VIGS of sweet buckwheat FaesPDS genes.

Citation Information

Patent Citations

  • VIGS (virus-induced gene silencing) system for hibiscus HcPDS (phytoene desaturase) gene

    CN111088237A

  • Loquat EjFADC1 gene as well as encoded protein and application thereof

    CN116064436A