Application of recombinant Saccharomyces cerevisiae in producing homoeriochoride using ferulic acid

Abstract

The present invention relates to the field of biotechnology, and in particular to the application of recombinant saccharomyces cerevisiae in producing homoeriodictyol using ferulic acid. The present invention obtains an engineered saccharomyces cerevisiae capable of producing homoeriodictyol using ferulic acid through artificial pathway construction and pathway enzyme screening strategy. Experiments show that the yield of homoeriodictyol produced by the strain of the present invention is 0.04 mmol / l, and the yield is 28.6%. The yield of homoeriodictyol produced by Escherichia coli using ferulic acid as a substrate in the prior art is 17.2%.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of recombinant saccharomyces cerevisiae in producing homoeriodictyol by utilizing ferulic acid. Background Art

[0002] Flavonoids are a kind of nutrient widely found in plants and have many health care effects. Compared with non-oxymethylated flavonoids, oxymethylated flavonoids have better biological activity and pharmacological properties. Homoergocristinol is a high-value oxymethylated flavonoid compound found in North American sage grass, which has antioxidant, anti-inflammatory, antibacterial and anticancer effects. More importantly, homoergocristinol and its derivatives can significantly reduce the bitterness of food or medicine without showing their own strong taste. Both are widely used as bitter masking agents in the food and pharmaceutical industries. Therefore, it is crucial to achieve a sustainable supply of homoergocristinol. Traditional methods for obtaining homoergocristinol include plant extraction and chemical synthesis. However, the seasonality and regionality of plants make plant extraction methods impractical. Limited by toxic reagents and extreme reaction conditions, the safety of chemical synthesis methods cannot be guaranteed. In recent years, the method of producing homoergocristinol by microorganisms has attracted widespread attention due to its advantages such as short process cycle, high efficiency and environmental friendliness.

[0003] Previous studies have constructed a biosynthetic pathway for producing homoeriochoric acid from ferulic acid in Escherichia coli ( Figure 1 ). Ferulic acid is a methylated phenylpropionic acid. Most 4-p-coumarate-CoA ligases (4CL) and chalcone synthases (CHS) cannot use methylated phenylpropionic acid and its corresponding CoA as substrates, but several 4CL and CHS derived from plants with broad specificity can perform this function. The prior art discloses an engineered Escherichia coli containing 4CL from rice and CHS from barley, which is used to synthesize homochoric acid using ferulic acid. The yield of homochoric acid in this work is 52 mg / l, and the conversion rate is 17.2%. The prior art discloses an engineered Escherichia coli containing 4CL from grapes, CHS from Arabidopsis thaliana, and chalcone isomerase (CHI) from Arabidopsis thaliana, which synthesizes homochoric acid using glycerol as a carbon source and ferulic acid as an intermediate product. The yield of homochoric acid in this work is 17 mg / l.

[0004] The microbial production of homoeriodictyol reported so far is limited to the transformation of Escherichia coli as the base bacteria, and there is no report on the production of homoeriodictyol in Saccharomyces cerevisiae. Therefore, providing an engineered Saccharomyces cerevisiae that can produce homoeriodictyol using ferulic acid has important practical significance. Summary of the invention

[0005] In view of this, the strain provided by the present invention and its application can produce homoeriodictyol using ferulic acid, and has higher yield and conversion rate than the prior art.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides the application of genetic engineering modification in improving the conversion rate of microorganisms in converting substrates into homoeriodictyol;

[0008] The genetic engineering modification is:

[0009] (i) adding the gene for p-coumaroyl-CoA ligase 4CL from parsley;

[0010] The genetic engineering modification also includes:

[0011] (ii), adding a gene for chalcone synthase CHS derived from highland barley; and

[0012] (iii) adding the gene of chalcone isomerase CHI from highland barley;

[0013] The microorganisms include Escherichia coli and / or yeast;

[0014] The yeast includes Saccharomyces cerevisiae CEN.PK2-1D;

[0015] The substrate includes ferulic acid.

[0016] The present invention also provides a genetic element, comprising:

[0017] (I), genetic element 1; or

[0018] (II), genetic element 1, genetic element 2, and genetic element 3;

[0019] The genetic element 1 has a gene for p-coumaroyl-CoA ligase 4CL derived from parsley;

[0020] The gene element 2 has a gene of chalcone synthase CHS derived from highland barley;

[0021] The gene element 3 has a gene for chalcone isomerase CHI derived from highland barley.

[0022] In some specific embodiments of the present invention, the above-mentioned genetic elements include:

[0023] The gene sequence of the p-coumaroyl-CoA ligase 4CL derived from parsley includes:

[0024] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0025] (2) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as (1); or

[0026] (3) a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (1) or (2);

[0027] The gene sequence of chalcone synthase CHS derived from highland barley includes:

[0028] (4) the nucleotide sequence shown in SEQ ID NO: 2; or

[0029] (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or

[0030] (6) a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (4) or (5);

[0031] The gene sequence of chalcone isomerase CHI derived from highland barley includes:

[0032] (7), the nucleotide sequence shown in SEQ ID NO: 3; or

[0033] (8) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as (7); or

[0034] (9) a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (7) or (8);

[0035] The plurality is 2 to 160.

[0036] The present invention also provides an expression cassette, comprising:

[0037] (I), expression cassette 1; or

[0038] (II), expression cassette 1, expression cassette 2 and expression cassette 3;

[0039] The expression cassette 1 comprises a promoter, a terminator and the gene element 1 among the above gene elements;

[0040] The expression cassette 2 comprises a promoter, a terminator and the gene element 2 among the above gene elements;

[0041] The expression cassette 3 comprises a promoter, a terminator and the gene element 3 among the above gene elements;

[0042] The promoter includes PTPI1, PTEF1 or PGPM1;

[0043] The terminator includes TCPS1, TTEF2 or TADH1.

[0044] The present invention also provides an expression vector having:

[0045] (10), the nucleotide sequence shown in SEQ ID NO: 4; or

[0046] (11) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as (10); or

[0047] (12) A nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (10) or (11);

[0048] The plurality is 2 to 1000.

[0049] The present invention also provides an expression vector, comprising a Cas9 encoding gene, a green fluorescent protein encoding gene, a His3 encoding gene, a kanamycin encoding gene and a gRNA, as well as acceptable gene elements.

[0050] The present invention also provides an expression system, comprising the above-mentioned expression vector, Linker and any one of the following:

[0051] (a) the above genetic elements; or

[0052] (b) the above expression cassette.

[0053] The present invention also provides a host cell, comprising any of the following:

[0054] (a) the above-mentioned genetic elements;

[0055] (b) the expression cassette described above;

[0056] (c) the above-mentioned expression system;

[0057] The host cell includes yeast;

[0058] The yeast includes Saccharomyces cerevisiae CEN.PK2-1D.

[0059] The present invention also provides a recombinant strain of Saccharomyces cerevisiae CEN.PK2-1D, comprising a gene of p-coumaroyl-CoA ligase 4CL derived from parsley.

[0060] In some specific embodiments of the present invention, the above-mentioned recombinant strain further comprises:

[0061] Adding a gene for chalcone synthase CHS derived from highland barley; and

[0062] The gene of chalcone isomerase CHI derived from highland barley was added.

[0063] The present invention also provides a composition comprising ferulic acid and any one of the following:

[0064] (e), the above host cell; or

[0065] (f) the above-mentioned recombinant strain.

[0066] The present invention also provides a method for preparing homoeriodictyol, comprising:

[0067] (A), integrating the above gene element into the genome of yeast, and then mixing with ferulic acid, and fermenting to obtain the homoeriodictyol; or

[0068] (B), integrating the above expression cassette into the genome of yeast, and then mixing with ferulic acid and fermenting to obtain the homoeriodictyol; or

[0069] (C), introducing the above expression system into yeast, and then mixing with ferulic acid, and fermenting to obtain the homoeriochoride; or

[0070] (D), mixing the host cell or the recombinant strain with ferulic acid, and fermenting to obtain the homoeriodictyol; or

[0071] (E), culturing the above composition to obtain the homoeriochoride;

[0072] The yeast includes Saccharomyces cerevisiae CEN.PK2-1D.

[0073] In some specific embodiments of the present invention, the insertion site of the gene of p-coumaroyl-CoA ligase 4CL derived from parsley in yeast is Delta15.

[0074] In some specific embodiments of the present invention, the insertion site of the chalcone synthase CHS gene derived from highland barley in yeast is Delta15.

[0075] In some specific embodiments of the present invention, the insertion site of the gene of chalcone isomerase CHI derived from highland barley in yeast is Delta15.

[0076] The strain of the present invention and its application have the following effects:

[0077] Experiments have shown that the initial OD 600=0.1, 0.26mmol / l of ferulic acid was added at 0h, and cultured in a shaking table at 30°C and 220rpm for 72h, the yield of homoeriodictyol was 0.04mmol / l, and the yield was 28.6%. The prior art can produce homoeriodictyol in Escherichia coli using ferulic acid as a substrate, and the yield is 17.2%. This yield is relatively low. The present invention uses Saccharomyces cerevisiae to produce homoeriodictyol from ferulic acid for the first time, and the yield is 66.3% higher than that of the prior art. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0079] Figure 1 The biosynthetic pathway for producing homoeriochoric acid from ferulic acid is shown;

[0080] Figure 2 The results of pathway enzyme screening are shown. DETAILED DESCRIPTION

[0081] The present invention discloses strains and their applications, and those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0082] The invention obtains an engineered brewer's yeast capable of producing homoeriodictyol by utilizing ferulic acid through artificial pathway construction and pathway enzyme screening strategy.

[0083] In order to open up the pathway from ferulic acid to homoeriodictyol, the present invention screens a combination of 4-p-coumaroyl-CoA ligase 4CL, chalcone synthase CHS, and chalcone isomerase CHI that can successfully synthesize homoeriodictyol in Saccharomyces cerevisiae. The present invention first attempts to express 4-p-coumaroyl-CoA ligase 4CL from Japanese rice, chalcone synthase CHS from highland barley, and chalcone isomerase CHI from highland barley in Saccharomyces cerevisiae, but homoeriodictyol is not detected after strain fermentation, and ferulic acid is almost not consumed (YFA001 strain). Next, the present invention replaces the 4CL gene, using p-coumaroyl-CoA ligase 4CL from Arabidopsis thaliana and p-coumaroyl-CoA ligase 4CL from parsley as candidate genes. Similarly, the combination of p-coumaryl-CoA ligase 4CL from Arabidopsis thaliana, chalcone synthase CHS from highland barley, and chalcone isomerase CHI from highland barley cannot achieve the synthesis of homoeriodictyol (YFA002 strain). However, Saccharomyces cerevisiae containing a combination of p-coumaryl-CoA ligase 4CL from parsley, chalcone synthase CHS from highland barley, and chalcone isomerase CHI from highland barley can successfully synthesize homoeriodictyol using ferulic acid (YFA003 strain). Finally, the present invention integrates the effective combination into the genome of Saccharomyces cerevisiae CEN.PK2-1D (available for purchase at BiobW: https: / / www.biobw.org / , numbered: Bio-110854).

[0084] The sequence information involved in the present invention is as follows:

[0085] 4CL sequence (SEQ ID NO: 1):

[0086]

[0087] CHS sequence (SEQ ID NO: 2):

[0088]

[0089] CHI sequence (SEQ ID NO: 3):

[0090] ATGGCTGTTTCTGAATTAGAAGTTGATGGTGTTGTTTTTCCACCATTAGCTAGACCACCAGGTTCTGCTCATGCTCATTTTTTAGCTGGTGCTGGTGTTAGAGGTATGGAAATTGGTGGTCATTTTATTAAATTCACCGCTATTGGTGTTTACTTACAAGCTGATGCTGCTGTTTCTGCTTTGGCTGCTAAATGGGCTGGTAAACCAGCTGCTGATTTAGCTTCTGATGCTGCTTTTTTTAGAGATGTTGTTACAGGTGAATTTGAAAAATTCACAAGAGTTACAATGATCTTGCCATTAACTGGTGCTCAATATTCTGATAAAGTTACAGAAAACTGCGTTGCTTATTGGAAAGCTGCTGGTGTTTATACAGATGCTGAAGCTGCTGCTGTTGATAAATTTAAAGAAGCTTTTGGTCCACATTCTTTTGCTCCAGGTGCTTCTATTTTGTTTACTCATTCTCCAGCTGGTGTTTTGACAGTTGCTTTTTCTAAAGATTCTTCTGTTCCAGAATCTGGTGGTGTTGCTATTGAAAATGCTAGATTGTGTGAAGCTGTTTTAGAATCTATTATCGGTGAACATGGTGTTTCTCCAGCTGCTAAATTGTCTTTGGCTAATAGAGTTGCTGAATTGTTGAAAGGTGCTGCTCATGCTGGTGGTGAACCAGCTGCTGAACCAGTTCCAGTTTCTGTTTAA

[0091] CRISPR plasmid sequence, taking the plasmid targeting the delta15 site as an example, the underlined and bold part is the gRNA (SEQ ID NO: 4):

[0092]

[0093]

[0094]

[0095] The Linker described in the present invention is a connector that connects the coding genes of two enzymes.

[0096] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all common commercial products and can be purchased from the market.

[0097] The present invention will be further described below in conjunction with embodiments:

[0098] Example: Method for integrating 4CL gene into the delta15 site of yeast genome

[0099] The main technologies used are CRISPR and homologous recombination. First, the expression cassette of the 4CL gene is constructed: PTPI1-4CL-TCPS1.

[0100] The promoter of PTPI1 was amplified using the yeast genome as template with the following primers:

[0101] tatatctaggaacccatcaggt(SEQ ID NO: 5);

[0102] ttttagtttatgtatgtgttttttgtagt (SEQ ID NO: 6).

[0103] The 4CL gene (synthesized by Qingke Biotechnology Co., Ltd.) was amplified using primers:

[0104] aaacacatacataaactaaaaGCatgggtgactgcgttgc (SEQ ID NO: 7);

[0105] gactattcaatcattgcgcGCttacttcggcaggtcgcc (SEQ ID NO: 8).

[0106] Here, the 5' ends of the upper and lower primers of 4CL respectively carry 20 bp regions homologous to the promoter and terminator.

[0107] The terminator TCPS1 was amplified using the yeast genome as a template with the following primers:

[0108] gcgcaatgattgaatagtcaaa(SEQ ID NO:9);

[0109] agaataggtttcgttttctggaa (SEQ ID NO: 10).

[0110] The three amplified fragments were subjected to overlap PCR to obtain the 4CL expression cassette. Next, the yeast genome was used as a template to amplify the connector fragment used for homologous recombination.

[0111] Linker1-1 was amplified using primers with 20 bp of homology to the promoter in the lower primer:

[0112] cgattcaattttggggattct(SEQ ID NO:11);

[0113] atttgagaaagtggtgtattttaagattatatctaggaacccatcaggt (SEQ ID NO: 12).

[0114] Linker2-1 was amplified using primers with 20 bp of homology to the terminator in the upper primer:

[0115] agaataggtttcgttttctggaaatggcaaagactataatattatgcat (SEQ ID NO: 13);

[0116] atattttggcattactcttcatcat (SEQ ID NO: 14).

[0117] Overlap PCR was performed on linker1-1 and the promoter fragment, and overlap PCR was performed on linker2-1 and the terminator fragment to obtain linker1 and linker2, respectively. Next, the first 20 bp of the pam sequence (NGG) was searched at the delta15 site as gRNA. The gRNA in this example is: ATATGTTTGGTTTCGATTGT (SEQ ID NO: 15). Next, the CRISPR-gRNA-Cas9-his plasmid and the 4CL expression cassette, linker1, and linker2 were transformed into Saccharomyces cerevisiae CEN.PK2-1D, and spread on yeast basal medium (SC-his) and cultured for 3-4 days to obtain a recombinant yeast strain. The first pair of verification primers were found upstream of the insertion site and the gene, and the length of the verification interface 1 was about 1000 bp. The second pair of verification primers were found downstream of the insertion site and the gene, and the length of the verification interface 2 was about 1000 bp. The first pair of verification primers in this example are: aggaatgaaacatataaaacgaaagg (SEQ ID NO: 16), atgctttggaatgtaaatgtcc (SEQ ID NO: 17). The second pair of verification primers are: agattctgcgtaaggatctg (SEQ ID NO: 18), ttgaaattgtaatcttaagatgctctt (SEQ ID NO: 19).

[0118] The method for integrating the gene of chalcone synthase CHS derived from highland barley or the gene of chalcone isomerase CHI derived from highland barley into the genome of Saccharomyces cerevisiae CEN.PK2-1D is the same as the method for integrating the 4CL gene into the delta15 site of the yeast genome.

[0119] Effect example

[0120] According to the method of the above embodiment, after completing the pathway enzyme screening, the present invention successfully obtained a cerevisiae strain that can use ferulic acid to synthesize homoeriodictyol. Shake flask fermentation was carried out, and the culture medium was yeast extract peptone glucose medium YPD. Fermentation conditions: initial OD 600 =0.1, 0.26mmol / l of ferulic acid was added at 0h, and cultured in a shaking incubator at 30℃ and 220rpm for 72h. The yield of homoeriodictyol was 0.04mmol / l, and the yield was 28.6%. Figure 2 As shown (the corresponding data are shown in Table 1).

[0121] The prior art can produce homoeriodictyol in Escherichia coli using ferulic acid as a substrate, with a yield of 17.2%. This yield is relatively low. In contrast, the present invention has the advantages of using saccharomyces cerevisiae to produce homoeriodictyol from ferulic acid for the first time, with a yield 66.3% higher than the prior art.

[0122] Table 1

[0123] strain Ferulic acid-1 Ferulic acid-2 Homoeriocarb-1 High eriodictyol-2 <![CDATA[OD 600 -1]]> <![CDATA[OD 600 -2]]> YFA001 0.26763 0.23653 0 0 9.887 9.524 YFA002 0.25733 0.23122 0 0 9.668 8.973 YFA003 0.11306 0.13246 0.04253 0.0403 7.052 7.103

[0124] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The application of genetic engineering modification in improving the conversion rate of yeast from ferulic acid to homoeriochoric acid; The genetic engineering modification is: (i) adding a gene of p-coumaroyl-CoA ligase 4CL derived from parsley, wherein the sequence of the gene of p-coumaroyl-CoA ligase 4CL is shown in SEQ ID NO: 1; and (ii), adding a chalcone synthase CHS gene derived from highland barley, wherein the sequence of the chalcone synthase CHS gene is shown in SEQ ID NO: 2; and (iii) adding a gene of chalcone isomerase CHI derived from highland barley, wherein the sequence of the gene of chalcone isomerase CHI is shown in SEQ ID NO:

3.

2. The use according to claim 1, characterized in that The yeast is Saccharomyces cerevisiae CEN.PK2-1D.

3. A genetic element, characterized in that are genetic element 1, genetic element 2, and genetic element 3; The gene element 1 has a gene of p-coumaroyl-CoA ligase 4CL derived from parsley, and the sequence of the gene of p-coumaroyl-CoA ligase 4CL is shown in SEQ ID NO: 1; The gene element 2 has a chalcone synthase CHS gene derived from highland barley, and the sequence of the chalcone synthase CHS gene is shown in SEQ ID NO: 2; The gene element 3 has a gene of chalcone isomerase CHI derived from highland barley, and the sequence of the gene of chalcone isomerase CHI is shown in SEQ ID NO:

3.

4. An expression cassette, characterized in that are expression cassette 1, expression cassette 2 and expression cassette 3; The expression cassette 1 comprises a promoter, a terminator and the gene element 1 among the gene elements according to claim 3; The expression cassette 2 comprises a promoter, a terminator and the gene element 2 in the gene element according to claim 3; The expression cassette 3 comprises a promoter, a terminator and the gene element 3 in the gene element according to claim 3; The promoter is PTPI1, PGPM1 or PTEF1; The terminator is TCPS1, TTEF2 or TADH1.

5. An expression system, characterized in that Includes expression vector, linker and any of the following: (a) the genetic element according to claim 3; or (b) The expression cassette of claim 4; The expression vector comprises a Cas9 encoding gene, a green fluorescent protein encoding gene, a His3 encoding gene, a kanamycin encoding gene and a gRNA; or The nucleotide sequence of the expression vector is shown in SEQ ID NO:

4.

6. A host cell, characterized in that Includes any of the following: (a) The genetic element according to claim 3; (b) The expression cassette of claim 4; (c) The expression system according to claim 5; The host cell is yeast.

7. The host cell according to claim 6, characterized in that The yeast is Saccharomyces cerevisiae CEN.PK2-1D.

8. A recombinant strain of Saccharomyces cerevisiae CEN.PK2-1D, characterized in that Adding a gene of p-coumaroyl-CoA ligase 4CL derived from parsley, wherein the sequence of the gene of p-coumaroyl-CoA ligase 4CL is shown in SEQ ID NO: 1; and Adding a chalcone synthase CHS gene derived from highland barley, wherein the sequence of the chalcone synthase CHS gene is shown in SEQ ID NO: 2; and A gene of chalcone isomerase CHI derived from highland barley is added, and the sequence of the gene of chalcone isomerase CHI is shown in SEQ ID NO:

3.

9. A composition, characterized in that Includes ferulic acid and any of the following: (e) the host cell according to claim 6 or 7; or (f) The recombinant strain according to claim 8.

10. A method for preparing homoeriodictyol, characterized in that: include: (A) integrating the gene element as claimed in claim 3 into the genome of yeast, and then mixing with ferulic acid and fermenting to obtain the homoeriodictyol; or (B) integrating the expression cassette as claimed in claim 4 into the genome of yeast, and then mixing with ferulic acid and fermenting to obtain the homoeriodictyol; or (C) introducing the expression system as claimed in claim 5 into yeast, mixing with ferulic acid, and fermenting to obtain the homoeriochoride; or (D) mixing the host cell according to claim 6 or 7 or the recombinant strain according to claim 8 with ferulic acid and fermenting to obtain the homoeriochoride; or (E) Cultivating the composition according to claim 9 to obtain the homoeriochoride.

11. The preparation method according to claim 10, characterized in that: The yeast is Saccharomyces cerevisiae CEN.PK2-1D.

Images