Application of recombinant Saccharomyces cerevisiae in producing homopterocarpin by using p -coumaric acid

Abstract

The present invention relates to the field of biotechnology, and particularly to the application of recombinant Saccharomyces cerevisiae in the production of homopterocarpin using p-coumaric acid. The present invention provides an engineered Saccharomyces cerevisiae capable of producing homopterocarpin using p-coumaric acid. Through strategies such as artificial pathway construction, pathway optimization, rational design of enzymes, and fermentation process optimization, the present invention obtains an engineered Saccharomyces cerevisiae capable of producing homopterocarpin using p-coumaric acid. Experiments show that its homopterocarpin yield is 1.005 mmol / l and the conversion rate is 65.8%. In large-scale production in a 5L fermenter, the strain of the present invention can utilize 15.2 mmol / l of p-coumaric acid to produce 3.2 mmol / l of homopterocarpin, and the conversion rate is 21.1%.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of recombinant Saccharomyces cerevisiae in the production of homoeriodictyol using p - coumaric acid. Background Art

[0002] Flavonoids are nutrients widely present in plants and have many health - care functions. Compared with non - O - methylated flavonoids, O - methylated flavonoids have better biological activities and pharmacological properties. Homoeriodictyol is a highly valuable O - methylated flavonoid compound present in Eriodictyon californicum, with functions such as antioxidant, anti - inflammatory, antibacterial, and anticancer effects. More importantly, homoeriodictyol and its derivatives can significantly reduce the bitterness of food or drugs without showing their own strong taste, and the two are widely used as bitterness masking agents in the food and pharmaceutical industries. Therefore, it is crucial to achieve a sustainable supply of homoeriodictyol. Traditional methods for obtaining homoeriodictyol include plant extraction and chemical synthesis. However, the seasonality and regionality of plants make the plant extraction method impractical. Limited by toxic reagents and extreme reaction conditions, the safety of chemical synthesis methods cannot be guaranteed. In recent years, the method of producing homoeriodictyol by microorganisms has received extensive attention due to its advantages such as short process cycle, high efficiency, and environmental friendliness.

[0003] Previous studies have constructed a biosynthetic pathway for producing homoeriodictyol starting from ferulic acid in Escherichia coli ( Figure 1 ). Ferulic acid is a methylated phenylpropionic acid. Most 4 - coumarate - CoA ligases (4CL) and chalcone synthases (CHS) cannot use methylated phenylpropionic acids and their corresponding coenzymes A as substrates, but several 4CLs and CHSs derived from plants with broad specificity can perform this function. The prior art discloses an engineered Escherichia coli containing 4CL from rice and CHS from barley for synthesizing homoeriodictyol using ferulic acid, with a homoeriodictyol yield of 52 mg / l and a conversion rate of 17.2% in this work. The prior art also discloses an engineered Escherichia coli containing 4CL from grape, CHS from Arabidopsis thaliana, and chalcone isomerase (CHI) from Arabidopsis thaliana, which synthesizes homoeriodictyol using glycerol as a carbon source and ferulic acid as an intermediate product, with a homoeriodictyol yield of 17 mg / l in this work.

[0004] The reported microbial production methods of homopterocarpin have the disadvantages of low yield and conversion rate, and there is still a certain distance from large-scale production. In addition, ferulic acid and p-coumaric acid are monomers naturally present in lignin, and the content of p-coumaric acid is 3-4 times that of ferulic acid. Synthesizing homopterocarpin from lignin monomers is not only beneficial to the high-value utilization of lignin but also conducive to the sustainable green production of homopterocarpin. However, the existing biosynthetic pathways of homopterocarpin all use ferulic acid as a precursor or intermediate, and the pathway from p-coumaric acid to homopterocarpin has not been reported. Therefore, constructing a pathway for the efficient synthesis of homopterocarpin starting from p-coumaric acid is of great significance. Summary of the Invention

[0005] In view of this, the strain and its application provided by the present invention provide a promising engineered yeast platform for the large-scale production of homopterocarpin based on fermentation.

[0006] To achieve the above-mentioned invention purposes, the present invention provides the following technical solutions:

[0007] The present invention provides the application of genetic engineering modification in the following items:

[0008] (I), enabling yeast to obtain the ability to produce homopterocarpin; and / or

[0009] (II), improving the yield and / or conversion rate of yeast in producing homopterocarpin;

[0010] The yeast includes Saccharomyces cerevisiae CEN.PK2-1D;

[0011] The substrate for production includes p-coumaric acid;

[0012] The genetic engineering modification includes:

[0013] Adding the gene of 4-coumaroyl-CoA ligase 4CL derived from parsley; and

[0014] Adding the gene of flavonoid 3'-monooxygenase F3'H derived from Arabidopsis thaliana; and

[0015] Adding the gene of cytochrome P450 reductase ATR1 derived from Arabidopsis thaliana; and

[0016] Adding the mutant ROMT-9 of 3'-O-methyltransferase ROMT-9 derived from Oryza sativa Japonica N135T / I324M of the gene; and

[0017] Overexpressing the gene of yeast endogenous acetyl-CoA carboxylase ACC1; and

[0018] Knocking out the gene of yeast endogenous citrate synthase CIT2; and

[0019] Knock out the gene of ferulic acid decarboxylase FDC1 endogenous to yeast; and

[0020] Replace the gene of TSC13 endogenous to yeast with the ECR gene derived from apple; and

[0021] Overexpress the gene of chalcone synthase CHS; and

[0022] Add the gene of the fusion enzyme of chalcone synthase CHS derived from petunia and chalcone isomerase CHI derived from alfalfa; and

[0023] Overexpress the endogenous yeast homocysteine S-methyltransferase MET6; and

[0024] Overexpress the endogenous yeast S-adenosyl-L-homocysteine hydrolase SAH1; and

[0025] Overexpress the endogenous yeast adenosine kinase ADO1; and

[0026] Overexpress the endogenous yeast methylenetetrahydrofolate reductase MET13; and

[0027] Overexpress the methylenetetrahydrofolate reductase MTHFR derived from Arabidopsis thaliana.

[0028] The present invention also provides gene elements, including gene element 1, gene element 2, gene element 3, gene element 4, gene element 5, gene element 6, gene element 7, gene element 8, gene element 9, gene element 10, gene element 11 and gene element 12;

[0029] The gene element 1 has the gene of 4-coumaroyl-CoA ligase 4CL derived from parsley;

[0030] The gene element 2 has the gene of flavonoid 3'-monooxygenase F3'H derived from Arabidopsis thaliana;

[0031] The gene element 3 has the gene of cytochrome P450 reductase ATR1 derived from Arabidopsis thaliana;

[0032] The gene element 4 has the strong promoter PTEF1;

[0033] The gene element 5 has the ECR gene derived from apple;

[0034] The gene element 6 has the gene of the fusion enzyme of chalcone synthase CHS derived from petunia and chalcone isomerase CHI derived from alfalfa;

[0035] The gene element 7 has the gene of the endogenous yeast homocysteine S-methyltransferase MET6;

[0036] The gene element 8 has the gene of yeast endogenous S-adenosyl-L-cysteine hydrolase SAH1;

[0037] The gene element 9 has the gene of yeast endogenous adenosine kinase ADO1;

[0038] The gene element 10 has the gene of yeast endogenous methylenetetrahydrofolate reductase MET13;

[0039] The gene element 11 has the gene of methylenetetrahydrofolate reductase MTHFR derived from Arabidopsis thaliana;

[0040] The gene element 12 has the gene of 3'-O-methyltransferase ROMT-9 mutant ROMT-9 N135T / I324M derived from Japanese rice.

[0041] The present invention also provides expression cassettes, including expression cassette 1, expression cassette 2, expression cassette 3, expression cassette 4, expression cassette 5, expression cassette 6, expression cassette 7, expression cassette 8, expression cassette 9, expression cassette 10 and expression cassette 11;

[0042] The expression cassette 1 has a promoter, a terminator and the gene element 1 among the above gene elements;

[0043] The expression cassette 2 has a promoter, a terminator and the gene element 2 among the above gene elements;

[0044] The expression cassette 3 has a promoter, a terminator and the gene element 3 among the above gene elements;

[0045] The expression cassette 4 has a promoter, a terminator and the gene element 5 among the above gene elements;

[0046] The expression cassette 5 has a promoter, a terminator and the gene element 6 among the above gene elements;

[0047] The expression cassette 6 has a promoter, a terminator and the gene element 7 among the above gene elements;

[0048] The expression cassette 7 has a promoter, a terminator and the gene element 8 among the above gene elements;

[0049] The expression cassette 8 has a promoter, a terminator and the gene element 9 among the above gene elements;

[0050] The expression cassette 9 has a promoter, a terminator and the gene element 10 among the above gene elements;

[0051] The expression cassette 10 has a promoter, a terminator and the gene element 11 among the above gene elements;

[0052] The expression cassette 11 has a promoter, a terminator, and the gene element 12 among the above gene elements;

[0053] The promoter includes PTPI1, PTEF1, or PGPM1;

[0054] The terminator includes TCPS1, TTEF2, or TADH1.

[0055] The present invention also provides an expression system, including an expression vector, a Linker, and any one of the following:

[0056] (a), the above gene element; or

[0057] (b), the above expression cassette; or

[0058] (c), the above expression cassette and the strong promoter PTEF1;

[0059] The expression vector includes a Cas9 coding gene, a green fluorescent protein coding gene, a His3 coding gene, a kanamycin coding gene, and a gRNA.

[0060] In some specific embodiments of the present invention, the expression vector in the above expression system further includes one or more of expression vector 1, expression vector 2, expression vector 3, or expression vector 4;

[0061] The expression vector 1 is a vector for knocking out the endogenous citrate synthase CIT2 gene in yeast;

[0062] The expression vector 2 is a vector for knocking out the endogenous ferulic acid decarboxylase FDC1 gene in yeast;

[0063] The expression vector 3 is a vector for knocking out the gene of the endogenous enoyl reductase TSC13 in yeast;

[0064] The expression vector 4 has:

[0065] (i), a nucleotide sequence as shown in SEQ ID NO:9; or

[0066] (ii), a nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (i), and having the same or similar function as (i); or

[0067] (iii), a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (i) or (ii);

[0068] The plurality is from 2 to 1000.

[0069] The present invention also provides a host cell, including:

[0070] (a), the above gene element; or

[0071] (b), the above expression cassette; or

[0072] (c), the above expression system;

[0073] The host cell includes yeast;

[0074] The yeast includes Saccharomyces cerevisiae CEN.PK2-1D.

[0075] The present invention also provides a recombinant strain of Saccharomyces cerevisiae CEN.PK2-1D, including:

[0076] Adding the gene of 4-coumaroyl-CoA ligase 4CL derived from parsley; and

[0077] Adding the gene of flavonoid 3'-monooxygenase F3'H derived from Arabidopsis thaliana; and

[0078] Adding the gene of cytochrome P450 reductase ATR1 derived from Arabidopsis thaliana; and

[0079] Adding the mutant ROMT-9 of 3'-O-methyltransferase ROMT-9 derived from Japanese rice N135T / I324M of the gene; and

[0080] Overexpressing the gene of yeast endogenous acetyl-CoA carboxylase ACC1; and

[0081] Knocking out the gene of yeast endogenous citrate synthase CIT2; and

[0082] Knocking out the gene of yeast endogenous ferulic acid decarboxylase FDC1; and

[0083] Replacing the gene of yeast endogenous TSC13 with the ECR gene derived from apple; and

[0084] Overexpressing the gene of chalcone synthase CHS; and

[0085] Adding the gene of the fusion enzyme of chalcone synthase CHS derived from Petunia hybrida and chalcone isomerase CHI derived from Medicago sativa; and

[0086] Overexpressing yeast endogenous homocysteine S-methyltransferase MET6; and

[0087] Overexpressing yeast endogenous S-adenosyl-l-homocysteine hydrolase SAH1; and

[0088] Overexpressing yeast endogenous adenosine kinase ADO1; and

[0089] Overexpressing yeast endogenous methylenetetrahydrofolate reductase MET13; and

[0090] Overexpress methylenetetrahydrofolate reductase MTHFR derived from Arabidopsis thaliana.

[0091] The present invention also provides a composition, comprising p - coumaric acid and any one of the following:

[0092] (I) The above - mentioned gene element;

[0093] (II) The above - mentioned expression cassette;

[0094] (III) The above - mentioned expression system;

[0095] (IV) The above - mentioned host cell;

[0096] (V) The above - mentioned recombinant strain.

[0097] The present invention also provides the use of any one of the following in the preparation of homoeriodictyol:

[0098] (I) The above - mentioned gene element;

[0099] (II) The above - mentioned expression cassette;

[0100] (III) The above - mentioned expression system;

[0101] (IV) The above - mentioned host cell;

[0102] (V) The above - mentioned recombinant strain;

[0103] (VI) The above - mentioned composition.

[0104] The present invention also provides a method for preparing homoeriodictyol, comprising:

[0105] (A) Integrating the above - mentioned gene element into the genome of yeast, then mixing with p - coumaric acid and fermenting to obtain the homoeriodictyol; or

[0106] (B) Taking the above - mentioned expression cassette and integrating it into yeast, then mixing with p - coumaric acid and fermenting to obtain the homoeriodictyol; or

[0107] (C) Taking the above - mentioned expression system to transform yeast, then mixing with p - coumaric acid and fermenting to obtain the homoeriodictyol; or

[0108] (D) Taking the above - mentioned host cell and mixing it with p - coumaric acid and fermenting to obtain the homoeriodictyol; or

[0109] (E) Taking the above - mentioned recombinant strain and mixing it with p - coumaric acid and fermenting to obtain the homoeriodictyol; or

[0110] (F) Culturing the above - mentioned composition to obtain the homoeriodictyol;

[0111] The yeast includes Saccharomyces cerevisiae CEN.PK2-1D.

[0112] In some specific embodiments of the present invention, in the above gene elements or the above recombinant strains:

[0113] The gene of 4-coumaroyl-CoA ligase 4CL derived from parsley has:

[0114] (1) The nucleotide sequence as shown in SEQ ID NO:1; or

[0115] (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (1), and having the same or similar function as (1); or

[0116] (3) A nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (1) or (2);

[0117] and / or

[0118] The gene of chalcone synthase CHS derived from petunia has:

[0119] (4) The nucleotide sequence as shown in SEQ ID NO:2; or

[0120] (5) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (4), and having the same or similar function as (4); or

[0121] (6) A nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (4) or (5);

[0122] and / or

[0123] The gene of chalcone isomerase CHI derived from alfalfa has:

[0124] (7) The nucleotide sequence as shown in SEQ ID NO:3; or

[0125] (8) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (7), and having the same or similar function as (7); or

[0126] (9) A nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (7) or (8);

[0127] and / or

[0128] The gene of flavonoid 3'-monooxygenase F3'H derived from Arabidopsis thaliana has:

[0129] (10) The nucleotide sequence as shown in SEQ ID NO:4; or

[0130] (11) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (10), and having the same or similar function as (10); or

[0131] (12) A nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (10) or (11);

[0132] and / or

[0133] The gene of cytochrome P450 reductase ATR1 derived from Arabidopsis thaliana has:

[0134] (13) The nucleotide sequence as shown in SEQ ID NO:5; or

[0135] (14) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (13), and having the same or similar function as (13); or

[0136] (15) A nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (13) or (14);

[0137] and / or

[0138] The gene of 3'-O-methyltransferase ROMT-9 derived from Japanese rice has:

[0139] (16) The nucleotide sequence as shown in SEQ ID NO:6; or

[0140] (17) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (16), and having the same or similar function as (16); or

[0141] (18) A nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (16) or (17);

[0142] and / or

[0143] The gene of the mutant ROMT-9 N135T / I324M has:

[0144] (19) The nucleotide sequence as shown in SEQ ID NO:7; or

[0145] (20) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (19), and having the same or similar function as (19); or

[0146] (21) A nucleotide sequence having at least 90% homology with the nucleotide sequence shown in (19) or (20);

[0147] The mutant ROMT-9 N135T / I324M has:

[0148] (22) The amino acid sequence shown in SEQ ID NO:8; or

[0149] (23) An amino acid sequence obtained by substituting, deleting or adding one or more residues to the amino acid sequence shown in (22), and having the same or similar function as (22); or

[0150] (24) An amino acid sequence having at least 90% homology with the amino acid sequence shown in (22) or (23);

[0151] Said plurality is from 2 to 160.

[0152] In some specific embodiments of the present invention, in the above gene element combination or the above recombinant strain, the fusion enzyme is obtained by connecting the gene of chalcone synthase CHS derived from Petunia hybrida and the gene of chalcone isomerase CHI derived from Medicago sativa with a linker.

[0153] In some specific embodiments of the present invention, in the above gene element combination or the above recombinant strain, the sequence of the linker has the sequence shown in SEQ ID NO:33.

[0154] In some specific embodiments of the present invention, the insertion site of the gene of 4-coumaroyl-CoA ligase 4CL derived from Petroselinum crispum in yeast is Delta15.

[0155] In some specific embodiments of the present invention, the insertion site of the gene of chalcone synthase CHS derived from Petunia hybrida in yeast is Delta15.

[0156] In some specific embodiments of the present invention, the insertion site of the gene of chalcone isomerase CHI derived from Medicago sativa in yeast is Delta15.

[0157] In some specific embodiments of the present invention, the insertion site of the gene of the fusion enzyme of chalcone synthase CHS derived from Petunia hybrida and chalcone isomerase CHI derived from Medicago sativa in yeast is Delta15.

[0158] In some specific embodiments of the present invention, the insertion site of the gene of flavonoid 3'-monooxygenase F3'H derived from Arabidopsis thaliana in yeast is Delta22.

[0159] In some specific embodiments of the present invention, the insertion site of the gene derived from cytochrome P450 reductase ATR1 in yeast is Delta22.

[0160] In some specific embodiments of the present invention, the insertion site of the gene derived from 3'-O-methyltransferase ROMT-9 of Japanese rice in yeast is Delta22.

[0161] In some specific embodiments of the present invention, the mutant ROMT-9 of 3'-O-methyltransferase ROMT-9 derived from Japanese rice N135T / I324M has an insertion site of Delta22 in yeast.

[0162] In some specific embodiments of the present invention, the mutant ROMT-9 of 3'-O-methyltransferase ROMT-9 derived from Japanese rice N135T / I324M has an insertion site of Delta22 in yeast, and the inserted copy number is 1, 2, 3, 4, or 5 copies.

[0163] The strains of the present invention and their applications have the following effects:

[0164] Experiments show that the yield of homopterocarpin in strain Yzsy003 containing the basic pathway is 0.017 mmol / l, and the yield of eriodictyol is 0.069 mmol / l. The yield of homopterocarpin in the optimized strain Yher007 is 1.005 mmol / l. The yields of homopterocarpin of the two strains were analyzed by the student t-test, one-tailed distribution, two-sample heteroscedastic hypothesis, p = 0.008. The conversion rate is 65.8%. For large-scale production in a 5 L fermenter, Yher007 can finally produce 3.2 mmol / l of homopterocarpin from 15.2 mmol / l of p-coumaric acid, and the conversion rate is 21.1%. While the previous best technology can produce 0.17 mmol / l of homopterocarpin with the addition of 1.0 mmol / l of ferulic acid, and the conversion rate is 17.2%. In comparison, the yield and conversion rate of producing homopterocarpin by yeast in the present invention are relatively high, providing a promising engineered yeast platform for large-scale fermentation-based production of homopterocarpin. Brief Description of the Drawings

[0165] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0166] Figure 1 Shows the biosynthetic pathway for producing homopterocarpin starting from ferulic acid;

[0167] Figure 2Shows the biosynthetic pathway for producing homericitrin starting from p - coumaric acid;

[0168] Figure 3 Shows enhancing the supply of the precursor naringenin;

[0169] Figure 4 Shows enhancing the supply of the cofactor SAM;

[0170] Figure 5 Shows that ROMT - 9 catalyzes the conversion of eriodictyol to homericitrin;

[0171] Figure 6 Shows the results of homology modeling and reliable docking conformations;

[0172] Figure 7 Shows the putative catalytic mechanism of ROMT - 9;

[0173] Figure 8 Shows the results of the first - round mutation and the second - round mutation (WT: wild type; N135T: Asn135 mutated to Thr135); among them, a shows the results of the first - round mutation; b shows the results of the second - round mutation;

[0174] Figure 9 Shows the shake - flask fermentation yield. Detailed implementation mode

[0175] The present invention discloses a strain and its application. Those skilled in the art can draw on the content of this article and appropriately improve process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0176] The present invention obtains an engineered Saccharomyces cerevisiae strain capable of producing homericitrin using p - coumaric acid through strategies such as artificial pathway construction, pathway optimization, rational design of enzymes, and fermentation process optimization.

[0177] To establish the pathway from p - coumaric acid to homericitrin, the present invention expressed 4 - coumaroyl - CoA ligase 4CL from parsley, chalcone synthase CHS from petunia, chalcone isomerase CHI from alfalfa, flavonoid 3'-monooxygenase F3'H and cytochrome P450 reductase ATR1 from Arabidopsis thaliana, and 3'-O - methyltransferase ROMT - 9 from Japanese rice in Saccharomyces cerevisiae CEN.PK2 - 1D (which can be purchased from BiobW: https: / / www.biobw.org / , number: Bio - 110854), and achieved the synthesis of homericitrin (Figure 2 )。

[0178] Next, the metabolic pathway is regulated. First, the PDH pathway is strengthened by overexpressing the yeast endogenous acetyl-CoA carboxylase ACC1 and knocking out the yeast endogenous citrate synthase CIT2, so as to provide more malonyl-CoA for the synthesis of homoeriodictyol. Second, in order to further achieve efficient production, the present invention knocks out the side reaction pathway in which yeast itself consumes p-coumaric acid. The yeast endogenous gene ferulic acid decarboxylase FDC1 will cause Saccharomyces cerevisiae to spontaneously decarboxylate p-coumaric acid, and the yeast endogenous essential gene enoyl reductase TSC13 will cause the reduction reaction of p-coumaroyl-CoA. Therefore, the FDC1 gene is knocked out, and the TSC13 is replaced by the homologous gene ECR derived from apple. Then, the rate-limiting enzyme chalcone synthase CHS in the pathway is overexpressed. In order to avoid the problem of low conversion rate caused by the diffusion of intermediates, the present invention performs an enzyme fusion of chalcone synthase CHS and chalcone isomerase CHI using the general enzyme fusion linker (GGGGS)1 (SEQ ID NO:36), and integrates multiple copies of the gene fragment after enzyme fusion into the yeast genome ( Figure 3 )。Then, for the methylation process in this biosynthetic pathway, the present invention strengthens the supply of the cofactor S-adenosylmethionine (SAM). The yeast endogenous genes homocysteine S-methyltransferase MET6, S-adenosyl-L-cysteine hydrolase SAH1, adenosine kinase ADO1, methylenetetrahydrofolate reductase MET13, and the methylenetetrahydrofolate reductase MTHFR derived from Arabidopsis thaliana are overexpressed ( Figure 4 )。

[0179] Finally, in order to improve the efficiency of the methylation reaction, the present invention attempts to improve the binding ability of the O-methyltransferase to the substrate. Through rational design, two rounds of point mutations are performed on the 3'-O-methyltransferase ROMT-9 to obtain the effective mutant ROMT-9 N135T / I324M 。ROMT-9 N135T / I324M expression cassette (PTPI1-ROMT-9 N135T / I324M- TCPS1) multiple copies are integrated into the yeast genome to obtain the final strain Yher007.

[0180] Regarding the 3'-O-methyltransferase ROMT-9, it has been proven to be a highly specific enzyme that can transfer the methyl group of S-adenosylmethionine (SAM) to eriodictyol in vitro to generate homoeriodictyol ( Figure 5 )。The in vitro conversion rate of ROMT-9 is relatively low, only 52.4%, and the in vivo catalytic ability of ROMT-9 has not been confirmed, so it is difficult to efficiently convert eriodictyol into homoeriodictyol in Saccharomyces cerevisiae.

[0181] In the prior art, this enzyme has been expressed in Saccharomyces cerevisiae, and after isolation and purification, the enzyme is used in vitro to catalyze the conversion of eriodictyol to homoeriodictyol. Although the efficiency is low, there is currently no technology to improve the efficiency of this enzyme by enzyme modification. However, there have been reports on predicting the active site of ROMT-9. Researchers compared the sequence of ROMT-9 with caffeic acid O-methyltransferase COMT from alfalfa, O-methyltransferase AtOMT1 from Arabidopsis thaliana, chalcone O-methyltransferase ChOMT from alfalfa, and isoflavone O-methyltransferase IOMT from alfalfa, and predicted that the possible substrate binding sites are Met134, ASN135, LEU140, ALA160, HIS170, PHE176, PHE180, MET184, HIS187, VAL321, ILE324, MET325, ASN329. In addition, Zhu et al. proposed a putative catalytic mechanism for 3'-hydroxy-N-methyldodecyl-4'-O-methyltransferase HOMT from Coptis chinensis, which has a high sequence similarity with ROMT-9. The above results lay a foundation for the rational design and modification of ROMT-9.

[0182] The sequence information involved in the present invention is as follows:

[0183] 4CL sequence (SEQ ID NO:1):

[0184]

[0185]

[0186] CHS sequence (SEQ ID NO:2):

[0187]

[0188] CHI sequence (SEQ ID NO:3):

[0189]

[0190] F3’H sequence (SEQ ID NO:4):

[0191]

[0192] ATR1 sequence (SEQ ID NO:5):

[0193]

[0194] ROMT-9 sequence (SEQ ID NO:6):

[0195]

[0196] ROMT-9 N135T / I324M Sequence (SEQ ID NO:7):

[0197]

[0198]

[0199] ROMT-9 N135T / I324M Amino acid sequence of (SEQ ID NO:8):

[0200]

[0201] CRISPR plasmid sequence, taking the plasmid targeting the delta15 site as an example, the underlined and bold part is the gRNA (SEQ ID NO:9):

[0202]

[0203]

[0204]

[0205] The homopterol described in the present invention refers to a high-value methylated flavonoid compound.

[0206] The Linker described in the present invention is a linker that connects the coding genes of two enzymes.

[0207] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all ordinary commercially available products and can be purchased from the market.

[0208] The present invention will be further described below in conjunction with examples:

[0209] Example 1: Method for integrating the 4CL gene into the delta15 site of the yeast genome

[0210] Mainly using CRISPR and homologous recombination technologies:

[0211] First, construct the expression cassette of the 4CL gene: PTPI1-4CL-TCPS1.

[0212] The promoter PTPI1 is amplified using the yeast genome as a template with the following primers:

[0213] tatatctaggaacccatcaggt (SEQ ID NO:10);

[0214] ttttagtttatgtatgtgttttttgtagt(SEQ ID NO:11).

[0215] The 4CL gene (synthesized by Tsingke Biotechnology Co., Ltd.) was amplified using primers:

[0216] aaacacatacataaactaaaaGCatgggtgactgcgttgc(SEQ ID NO:12);

[0217] gactattcaatcattgcgcGCttacttcggcaggtcgcc(SEQ ID NO:13).

[0218] Here, the 5' ends of the upstream and downstream primers of 4CL each carry a 20bp region homologous to the promoter and terminator respectively.

[0219] The terminator TCPS1 was amplified using the yeast genome as a template with the following primers:

[0220] gcgcaatgattgaatagtcaaa(SEQ ID NO:14);

[0221] agaataggtttcgttttctggaa(SEQ ID NO:15).

[0222] The above three amplified fragments were subjected to overlap PCR to obtain the 4CL expression cassette. Next, the yeast genome was used as a template to amplify the linker fragment for homologous recombination.

[0223] Linker1-1 was amplified using primers, and the downstream primer carried a 20bp region homologous to the promoter:

[0224] cgattcaattttggggattct(SEQ ID NO:16);

[0225] atttgagaaagtggtgtattttaagattatatctaggaacccatcaggt(SEQ ID NO:17).

[0226] Linker2-1 was amplified using primers, and the upstream primer carried a 20bp region homologous to the terminator:

[0227] agaataggtttcgttttctggaaatggcaaagactataatattatgcat(SEQ ID NO:18);

[0228] atattttggcattactcttcatcat (SEQ ID NO:19).

[0229] Perform overlap PCR on linker1-1 and the promoter fragment, and overlap PCR on linker2-1 and the terminator fragment to obtain linker1 and linker2 respectively. Next, search for the 20 bp before the pam sequence (NGG) at the delta15 site as the gRNA. In this example, the gRNA is: ATATGTTTGGTTTCGATTGT (SEQ ID NO:20). Next, transform the CRISPR-gRNA-Cas9-his plasmid, the 4CL expression cassette, linker1, and linker2 into Saccharomyces cerevisiae CEN.PK2-1D, and spread them on yeast minimal medium (SC-his) and culture for 3 - 4 days to obtain recombinant yeast strains. Search for the first pair of verification primers upstream of the insertion site and within the gene, and verify that the length of interface 1 is about 1000 bp. Search for the second pair of verification primers downstream of the insertion site and within the gene, and verify that the length of interface 2 is about 1000 bp. In this example, the first pair of verification primers are: aggaatgaaacatataaaacgaaagg (SEQ ID NO:21), atgctttggaatgtaaatgtcc (SEQ ID NO:22). The second pair of verification primers are: agattctgcgtaaggatctg (SEQ ID NO:23), ttgaaattgtaatcttaagatgctctt (SEQ ID NO:24).

[0230] The gene of chalcone synthase CHS from Petunia hybrida, the gene of chalcone isomerase CHI from Medicago sativa, the gene of flavonoid 3'-monooxygenase F3'H from Arabidopsis thaliana, the gene of cytochrome P450 reductase ATR1, the gene of 3'-O-methyltransferase ROMT-9 from Oryza sativa japonica, ROMT-9 N135T / I324M The method of integrating the gene of the mutant, the gene of the fusion enzyme of chalcone synthase CHS and chalcone isomerase CHI, or the gene of methylenetetrahydrofolate reductase MTHFR from Arabidopsis thaliana into the genome of Saccharomyces cerevisiae CEN.PK2-1D is the same as the method of integrating the 4CL gene into the delta15 site of the yeast genome described above.

[0231] The said fusion enzyme is obtained by enzymatically fusing chalcone synthase CHS and chalcone isomerase CHI using the general enzyme fusion linker (GGGGS)1.

[0232] The method of homologous gene replacement of TSC13 with the ECR gene from Malus domestica is the same as the method of integrating the 4CL gene into the delta15 site of the yeast genome described above.

[0233] The overexpression methods of the genes of rate-limiting enzyme chalcone synthase CHS, yeast endogenous gene homocysteine S-methyltransferase MET6, S-adenosyl-l-homocysteine hydrolase SAH1, adenosine kinase ADO1, methylenetetrahydrofolate reductase MET13, and methylenetetrahydrofolate reductase MTHFR from Arabidopsis thaliana are the same as the method of integrating the 4CL gene into the yeast genome delta15 locus described above.

[0234] The overexpression method of the gene of acetyl-CoA carboxylase ACC1 endogenous to Saccharomyces cerevisiae CEN.PK2-1D is as follows: Replace the promoter of the ACC1 gene with PTEF1, and the specific method is the same as the method of integrating the 4CL gene into the yeast genome delta15 locus described above.

[0235] Example 2: Method for knocking out the FDC1 gene

[0236] First, using the genome of Saccharomyces cerevisiae CEN.PK2-1D as a template, amplify linker1 with primers, where the downstream primer has a 20-bp homologous sequence of linker2:

[0237] cactttttctgagcattttattacg(SEQ ID NO:25);

[0238] ccgtagaaagtctatggcaagtcaagaatagaataactcagagg(SEQ ID NO:26).

[0239] Then use primers: ttgccatagactttctacgga (SEQ ID NO:27), acatcatcatggtgctttactaa (SEQ ID NO:28) to amplify linker2. Perform overlap PCR on the above two linkers to obtain the linker. Search for gRNA: AATACCATCTCACTCGTTGC (SEQ ID NO:29) on the FDC1 gene. Finally, transform the CRISPR-gRNA-Cas9-his plasmid and the linker into Saccharomyces cerevisiae CEN.PK2-1D, and spread it on yeast minimal medium (SC-his) and culture for 3-4 days to obtain the yeast strain with FDC1 knocked out. Search for verification primers upstream and downstream of the linker. In this example, the verification primers are: tgggaaggaataaaaagcaagt (SEQ ID NO:30), tactctataaatgtaacatcgttaaagca (SEQ ID NO:31). If the gene is knocked out, the verified length is within 1000bp; otherwise, the length is 2500bp.

[0240] Linker sequence selection criteria: For genes integrated into the genome, select a 400bp fragment upstream and downstream of the gRNA for the linker; for genes to be knocked out, select a 400bp fragment upstream and downstream of the gene to be knocked out for the linker.

[0241] The method for knocking out the gene of endogenous citrate synthase CIT2 in Saccharomyces cerevisiae CEN.PK2-1D is the same as the method for knocking out the FDC1 gene described above.

[0242] Example 3: Rational design and modification of ROMT-9

[0243] First, perform homology modeling using the SWISS-MODEL (www.swissmodel.expasy.org / ) website. Using the caffeic acid O-methyltransferase (with SAM ligand) from sorghum as a template, select the complex structure of ROMT-9 and the ligand SAM (see Figure 6In a). Subsequently, the Autodock software was used to perform molecular docking on the complex and the substrate eriodictyol. Before molecular docking, dehydration and hydrogenation were performed on the ROMT-9 and SAM complex, and hydrogenation and automatic charge assignment were performed on eriodictyol. The coordinates of the docking grid box were adjusted to surround all substrate binding sites: MET134, ASN135, LEU140, ALA160, HIS170, PHE176, PHE180, MET184, HIS187, VAL321, ILE324, MET325, ASN329. During docking, the ROMT-9 and SAM complex was regarded as a rigid structure, and the substrate eriodictyol was regarded as a flexible structure. The docking method was semi-flexible docking.

[0244] To reveal the true binding conformation between the enzyme and the substrate as much as possible, the docking results were screened according to the catalytic mechanism of HOMT. Since HOMT and ROMT-9 have a high degree of sequence similarity, the catalytic mechanism of ROMT-9 can be inferred based on the sequence alignment results. It can be inferred that the O-methylation reaction of eriodictyol involves the His274 and Asp275 residues of ROMT-9. Electrons are transferred from the water molecule at the reaction center to the imidazole ring of His274, and then to Asp275, resulting in the 3'-hydroxyl group of eriodictyol becoming an electron-rich group. Finally, the methyl group of SAM is nucleophilically attacked by the 3'-hydroxyl group of eriodictyol to form homopterocarpin and S-adenosylhomocysteine (SAH)( Figure 7 ). Based on the above catalytic mechanism and the docking result scores, three reliable conformations were selected( Figure 6 b, c, d in).

[0245] According to Figure 6 the reliable conformations of b, c, d in, the active site residues Asn135, Ile324 and Asn329 were selected as candidate mutation sites. To find mutants with enhanced binding ability between the substrate and the enzyme, virtual amino acid saturation mutagenesis was performed on these three sites using Discovery Studio TM respectively. In the Effect column of the output results, "stabilizing" indicates that the mutation may enhance the binding ability between the enzyme and the substrate, and experimental verification was performed on the point mutations with the result of "stabilizing".

[0246] Mutation method (taking the mutation of Asn135 to Ala135 as an example):

[0247] The coding gene of ROMT-9 was divided into fragment A and fragment B for PCR, using KOD-FX high-fidelity enzyme. The upstream primer of fragment A, in addition to the part for amplifying fragment A, also carried 20 bp homologous to the promoter; the downstream primer introduced a point mutation near the 5'-end, replacing the codon of Asn with the codon of Ala. The upstream primer of fragment B introduced a point mutation near the 5'-end, replacing the codon of Asn with the codon of Ala; the downstream primer, in addition to the part for amplifying fragment B, also carried 20 bp homologous to the terminator. At the same time, it was necessary to ensure that after introducing this mutation, fragments A and B had a homologous region of about 20 bp. Therefore, when constructing P TPI1 -ROMT9 N135A -T CPS1 , the upstream primer sequence of fragment A was: actacaaaaaacacatacataaactaaaaG (SEQ ID NO:32), and the downstream primer sequence was: GACCTTGTCTTGTGCCATCAAAGCCAATGC (SEQ ID NO:33); the upstream primer sequence of fragment B was: ATTGGCTTTGATGGCACAAGACAAGGTCTTG (SEQ ID NO:34); the downstream primer sequence was: tgactattcaatcattgcgcGCTTACTTAGTGAATTCAATAGCCCAAG (SEQ ID NO:35). Then, the two fragments were subjected to overlap-PCR using the upstream primer of fragment A and the downstream primer of fragment B. The PCR product was seamlessly cloned with linearized pRS413-P TPI1 -T CPS1 . A free expression cassette with the mutant was obtained. This expression cassette was transformed into the yeast strain Yeri001 that produces eriodictyol (the yield was 0.75 mmol / l, the original chassis was CEN.PK2-1D, and the strain carried 4-coumaroyl-CoA ligase 4CL from parsley, chalcone synthase CHS from petunia, chalcone isomerase CHI from alfalfa, flavonoid 3'-monooxygenase F3'H from Arabidopsis thaliana, and cytochrome P450 reductase ATR1. This strain overexpressed the yeast endogenous acetyl-CoA carboxylase ACC1, knocked out the yeast endogenous citrate synthase CIT2, knocked out the yeast endogenous ferulic acid decarboxylase FDC1, homologously replaced the yeast endogenous essential gene enoyl reductase TSC13 with the ECR gene from apple, and carried out enzyme fusion of chalcone synthase CHS and chalcone isomerase CHI using the general enzyme fusion linker (GGGGS)1 (SEQ ID NO:36).), fermented for 72 h to determine the yield of homoeriodictyol, and compared with the yeast strain carrying pRS413-P TPI1 -ROMT9-T CPS1 to determine whether the mutant was effective.

[0248] By transferring pRS413-P into Yeri001 TPI1 -ROMT9-T CPS1 After fermentation for 72 h, eriodictyol at 0.36 mmol / l and homoeriodictyol at 0.25 mmol / l were obtained. It can be seen that the in vivo conversion rate of ROMT-9 was approximately 41.2%. First, the first-round site-directed mutagenesis was performed on Asn135 to obtain ROMT-9 N135T with a conversion rate of 62.6%, which was 51.9% higher than that of ROMT-9 (see Figure 8 a and Table 1), p < 0.01. Subsequently, the mutant ROMT-9 N135T was used as the template for Ile324 mutagenesis, and the second-round site-directed mutagenesis was carried out. The conversion rate of the double mutant ROMT-9 N135T / I324M reached 77.6%, which was 89.3% higher than that of ROMT-9 (see Figure 8 b and Table 2), p < 0.05. Finally, Asn329 site-directed mutagenesis was verified using ROMT-9 N135T / I324M as the template, but no effective mutants were found.

[0249] Table 1: Results of the first-round mutagenesis

[0250] Mutant Homoeriodictyol (mmol / 1) - Parallel 1 Homoeriodictyol (mmol / 1) - Parallel 2 WT 0.25208 0.25413 N135T 0.38359 0.39274 N135A 0.07757 0.07616 N135M 0.02452 0.02446 N135W 0.02258 0.02324 N135L 0.02171 0.02194 N135Y 0.01928 0.01895 N135R 0.01879 0.01901 N135Q 0.01397 0.01413 N135I 0.00607 0.00638 N135F 0 0 N135K 0 0 N135H 0 0

[0251] Table 2: Results of the second-round mutagenesis

[0252] Mutant Homoeriodictyol (mmol / 1) - Parallel 1 Homoeriodictyol (mmol / 1) - Parallel 2 N135T 0.43998 0.42045 N135T / I324M 0.56787 0.57105 N135T / I324L 0.33015 0.32793 N135T / I324V 0.15737 0.16356 N135T / I324C 0.07083 0.0718 N135T / I324H 0.06803 0.06592 N135T / I324A 0.05655 0.05876 N135T / I324Q 0.05447 0.05443 N135T / I324F 0.02993 0.03063 N135T / I324S 0.01829 0.01817 N135T / I324G 0.01357 0.01351 N135T / I324T 0 0 N135T / I324R 0 0 N135T / I324K 0 0

[0253] In this example, first, the conversion rate of wild-type ROMT-9 in Saccharomyces cerevisiae was measured, and then the verification was carried out in the order of Asn135, Ile324, and Asn329. After obtaining the N135T mutant, this mutant was used as the template for Ile324 mutagenesis; after obtaining the N135T / I324M mutant, Asn329 mutagenesis verification was carried out using this mutant as the template. The verification method was to construct the expression cassette P TPI1 -ROMT9 mut -T CPS1 on a common plasmid and perform free expression in the eriodictyol-producing yeast strain Yeri001, measure the yield of homoeriodictyol and the residual amount of eriodictyol after fermentation of the strain, and calculate the conversion rate. The finally obtained effective mutant was ROMT-9 N135T / I324M . Compared with the previous technology of expressing methyltransferase in recombinant Escherichia coli to produce homoeriodictyol from eriodictyol, the present invention combines rational design of the enzyme to improve the conversion rate of the enzyme. Even when the copy number of the enzyme expression cassette is low (1 - 2 copies), a high conversion rate (77.6%) can be achieved.

[0254] Effect example

[0255] After the strain optimization and enzyme modification are completed according to the methods described in Examples 1 and 2, the final strain Yher007 is obtained, and the production level of the final strain Yher007 is evaluated. First, shake-flask fermentation is carried out, and the medium is yeast extract peptone dextrose medium YPD. Fermentation conditions: initial OD 600 = 0.1, add 1.52 mmol / l of p-coumaric acid at 0 h, culture in a shaker at 30 °C and 220 rpm for 72 h. The yields are as Figure 9 (corresponding data are shown in Table 3). Yzsy003 is a strain containing the basic pathways 4CL, CHS, CHI, F3’H, ATR1, and ROMT-9, with the yield of homoeriodictyol being 0.017 mmol / l and the yield of eriodictyol being 0.069 mmol / l. Yher007 is the strain optimized as above, with the yield of homoeriodictyol being 1.005 mmol / l. The yields of homoeriodictyol of the two are analyzed by the student t-test, one-tailed distribution, two-sample heteroscedastic hypothesis, p = 0.008. The conversion rate is 65.8%.

[0256] Next, scale-up production is carried out in a 5 L fermenter. Inoculate the Yher007 colony into 5 ml of yeast basal medium (lacking uracil and leucine) SC-URA-LEU and culture at 30 °C and 220 rpm for 18 hours. Next, inoculate the primary seed into 50 ml of SC-URA-LEU medium at an inoculation amount of 1% (v / v) and culture at 30 °C and 220 rpm. When OD 600 reaches 6, transfer the secondary seed to a 5 L fermenter containing 2.5 L of YPD medium at an inoculation amount of 1% (v / v). The fermentation temperature is 30 °C, the air flow rate is 3.0 vvm, and the pH is controlled at 5.5. When 20 g / l of glucose in the medium is exhausted, add a 600 g / l glucose mother liquor at a rate of 18 ml / h. Add 100 ml of concentrated yeast extract solution (100 g / l) at 12 h, 24 h, 36 h, and 48 h of fermentation. When OD 600 reaches 15, add 50 ml of p-coumaric acid solution (25 g / l) every 12 h for a total of 5 times. Finally, 3.2 mmol / l of homoeriodictyol can be produced using 15.2 mmol / l of p-coumaric acid, and the conversion rate is 21.1%.

[0257] The previous best technology can produce 0.17 mmol / l of homoeriodictyol with a conversion rate of 17.2% when adding 1.0 mmol / l of ferulic acid. This yield is far from large-scale production. In contrast, the advantage of the present invention is that both the yield and conversion rate of producing homoeriodictyol using yeast are relatively high, providing a promising engineered yeast platform for large-scale fermentation-based production of homoeriodictyol.

[0258] Table 3

[0259] Strain Eriodictyol - 1 Eriodictyol - 2 Homoeriodictyol - 1 Homoeriodictyol - 2 Yzsy003 0.070 0.068 0.0145 0.0185 Yher007 0 0 0.98 1.03

[0260] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Use of genetic engineering modification in the following aspects: (I), enabling yeast to obtain the ability to produce homopterol; and / or (II), increasing the yield and / or conversion rate of yeast in producing homopterol; The yeast is Saccharomyces cerevisiae CEN.PK2-1D; The substrate for production is p-coumaric acid; The genetic engineering modification is: Adding the gene of 4-coumaroyl-CoA ligase 4CL derived from parsley; and Add the gene of flavonoid 3'-monooxygenase F3'H derived from Arabidopsis thaliana; and Add the gene of cytochrome P450 reductase ATR1 derived from Arabidopsis thaliana; and Add the gene of the mutant ROMT-9 of 3'-O-methyltransferase ROMT-9 derived from Japanese rice N135T / I324M ; and Overexpress the gene of yeast endogenous acetyl-CoA carboxylase ACC1; and Knock out the gene of yeast endogenous citrate synthase CIT2; and Knock out the gene of yeast endogenous ferulic acid decarboxylase FDC1; and Replace the gene of yeast endogenous TSC13 with the ECR gene derived from apple; and Add the gene of the fusion enzyme of chalcone synthase CHS derived from Petunia hybrida and chalcone isomerase CHI derived from Medicago sativa; and Overexpress yeast endogenous homocysteine S-methyltransferase MET6; and Overexpress yeast endogenous S-adenosyl-L-cysteine hydrolase SAH1; and Overexpress yeast endogenous adenosine kinase ADO1; and Overexpress yeast endogenous methylenetetrahydrofolate reductase MET13; and Overexpress methylenetetrahydrofolate reductase MTHFR derived from Arabidopsis thaliana.

2. A recombinant strain of Saccharomyces cerevisiae CEN.PK2-1D, characterized in that: Add the gene of 4-coumaroyl-CoA ligase 4CL derived from Petroselinum crispum; and Add the gene of flavonoid 3'-monooxygenase F3'H derived from Arabidopsis thaliana; and Add the gene of cytochrome P450 reductase ATR1 derived from Arabidopsis thaliana; and Add the gene of the mutant ROMT-9 of 3'-O-methyltransferase ROMT-9 derived from Japanese rice N135T / I324M ; and Overexpress the gene of yeast endogenous acetyl-CoA carboxylase ACC1; and Knock out the gene of yeast endogenous citrate synthase CIT2; and Knock out the gene of yeast endogenous ferulic acid decarboxylase FDC1; and Replace the gene of yeast endogenous TSC13 with the ECR gene derived from apple; and Add the gene of the fusion enzyme of chalcone synthase CHS derived from Petunia hybrida and chalcone isomerase CHI derived from Medicago sativa; and Overexpress yeast endogenous homocysteine S-methyltransferase MET6; and Overexpress yeast endogenous S-adenosyl-L-cysteine hydrolase SAH1; and Overexpress yeast endogenous adenosine kinase ADO1; and Overexpress yeast endogenous methylenetetrahydrofolate reductase MET13; and Overexpress methylenetetrahydrofolate reductase MTHFR derived from Arabidopsis thaliana.

3. A composition, characterized in that, It consists of p-coumaric acid and the recombinant strain described in claim 2.

4. Use of any of the following in the preparation of homopterocarpin: (I) The recombinant strain as described in claim 2; (II) The composition as described in claim 3.

5. A method for preparing homopterocarpin, characterized in that, It is: (A), Mix the recombinant strain described in claim 2 with p-coumaric acid, ferment, and obtain the said eriodictyol; or (B), Culture the composition described in claim 3, and obtain the said eriodictyol.

Images