A Pien Tze Huang small RNA for the prevention and / or treatment of alcoholic liver injury, a small RNA composition, its preparation method, and its uses.
By extracting and combining 33 small RNAs from Pien Tze Huang, the treatment challenge of alcoholic liver injury has been solved, achieving effective prevention and treatment, and providing a new method for the quality control of Pien Tze Huang.
Patent Information
- Application Number
- CN202310933804.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-27
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2043-07-27
AI Technical Summary
Existing technologies are not ideal for treating alcoholic liver injury, and the desired results are difficult to achieve due to factors such as the patient's psychological state and lifestyle. The prevention and treatment mechanism of the traditional Chinese medicine Pien Tze Huang is unclear.
Thirty-three small RNAs were extracted from the traditional Chinese medicine Pien Tze Huang and combined into a small RNA composition. This composition was used to prevent and treat alcoholic liver injury by inhibiting CYP2E1 gene expression, increasing superoxide dismutase content, and reducing malondialdehyde, ALT, AST, TBIL and LDH content.
The 33 small RNA compositions can effectively prevent and treat alcoholic liver damage, are stable in the body, have significant therapeutic effects, and can be used as quality control markers to improve the efficiency of Pien Tze Huang's research and development and quality control.
Smart Images

Figure CN116751782B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a Pien Tze Huang small RNA for the prevention and / or treatment of alcoholic liver injury, a small RNA composition, its preparation method, and its uses. Background Technology
[0002] Alcoholic liver injury is a toxic liver disease caused by long-term heavy drinking, and it is the second most common liver disease in my country after viral hepatitis. Based on the severity of liver damage, alcoholic liver injury can be divided into three stages: stage one is alcoholic fatty liver, stage two is alcoholic hepatitis, and stage three is alcoholic cirrhosis, which may eventually develop into liver cancer. Currently, the treatment effect of chemotherapy for alcoholic liver injury is not ideal. The treatment model mainly focuses on abstinence from alcohol, supplemented by nutritional support therapy. However, this approach is often affected by the patient's negative psychological state and lifestyle habits, failing to achieve the desired treatment results.
[0003] To address the aforementioned issues, patent application CN104042656A utilizes Pien Tze Huang and its preparations to treat alcoholic liver injury, improving efficacy and reducing side effects. The Pien Tze Huang formula is classified as a national top secret, primarily composed of various precious Chinese medicinal herbs such as Panax notoginseng, snake gall, bezoar, and musk. It possesses multiple functions, including protecting hepatocytes, regulating liver lipid metabolism, reducing collagen deposition, and alleviating inflammatory responses. Its formulation closely aligns with traditional Chinese medicine treatments for liver diseases, such as clearing heat, resolving blood stasis, and dispersing nodules. This multi-pathway pharmacodynamic effect is likely related to the multi-component, multi-target mechanism of action of traditional Chinese medicine. However, the mechanism by which Pien Tze Huang prevents and treats alcoholic liver injury remains unclear.
[0004] Small RNAs (sRNAs) are a class of non-coding RNA molecules, typically less than 200 nt in length, including microRNAs (miRNAs), small interference RNAs (siRNAs), and piwi-interacting RNAs (piRNAs). Small RNAs regulate expression at the post-transcriptional level in eukaryotic cell differentiation, proliferation, and apoptosis, and are closely related to physiological and pathological processes such as metabolism and immunity. Due to their small molecular weight, mobility, and more precise targeting, sRNAs have been developed in the pharmaceutical field. Research has found that some sRNAs in traditional Chinese medicines can be stably absorbed into the body to exert their specific pharmacological effects. For example, small RNAs found in honeysuckle have the ability to directly inhibit the replication of H5N1 and SARS-CoV-2 viruses, providing a new research direction for drug development and quality control of traditional Chinese medicine. If sRNAs with anti-alcoholic liver damage properties can be found in Pien Tze Huang, it would undoubtedly benefit the development and quality control of Pien Tze Huang. Summary of the Invention
[0005] The purpose of this invention is to provide a Pien Tze Huang small RNA, a small RNA composition, a preparation method, and its uses for the prevention and / or treatment of alcoholic liver injury.
[0006] The present invention provides a small RNA for the prevention and / or treatment of alcoholic liver injury, which is a nucleotide sequence as shown in any one of SEQ ID NO.1-3, SEQ ID NO.6, SEQ ID NO.8-16, SEQ ID NO.18-31, and SEQ ID NO.33.
[0007] The present invention also provides the use of the small RNA nucleotide sequence shown in any one of SEQ ID NO. 1 to 33 in the preparation of a medicament for the prevention and / or treatment of alcoholic liver injury;
[0008] Preferably, the drug is a drug that inhibits the expression of the CYP2E1 gene.
[0009] Furthermore, the drug is a drug that increases the content of superoxide dismutase; and / or, the drug is a drug that decreases the content of malondialdehyde; and / or, the drug is a drug that decreases the content of ALT, AST, TBIL and LDH in serum.
[0010] The present invention also provides a small RNA composition for the prevention and / or treatment of alcoholic liver injury, which is composed of nucleotide sequences as shown in SEQ ID NO. 1 to 33.
[0011] Furthermore, the molar percentage of the nucleotide sequence shown in SEQ ID NO.1 is 7-10%.
[0012] The nucleotide sequence shown in SEQ ID NO.2 has a molar percentage of 6–10%.
[0013] The nucleotide sequence shown in SEQ ID NO.3 has a molar percentage of 4–10%.
[0014] The nucleotide sequence shown in SEQ ID NO.4 has a molar percentage of 3-9%.
[0015] The nucleotide sequence shown in SEQ ID NO.5 has a molar percentage of 3-9%.
[0016] The nucleotide sequence shown in SEQ ID NO.6 has a molar percentage of 3-9%.
[0017] The nucleotide sequence shown in SEQ ID NO.7 has a molar percentage of 3-9%.
[0018] The nucleotide sequence shown in SEQ ID NO.8 has a molar percentage of 2-8%.
[0019] The nucleotide sequence shown in SEQ ID NO.9 has a molar percentage of 2-8%.
[0020] The nucleotide sequence shown in SEQ ID NO. 10 has a molar percentage of 2-8%.
[0021] The nucleotide sequence shown in SEQ ID NO. 11 has a molar percentage of 2-8%.
[0022] The nucleotide sequence shown in SEQ ID NO.12 has a molar percentage of 2-8%.
[0023] The nucleotide sequence shown in SEQ ID NO.13 has a molar percentage of 2-8%.
[0024] The nucleotide sequence shown in SEQ ID NO.14 has a molar percentage of 1-7%.
[0025] The nucleotide sequence shown in SEQ ID NO. 15 has a molar percentage of 1–7%.
[0026] The nucleotide sequence shown in SEQ ID NO. 16 has a molar percentage of 1–7%.
[0027] The nucleotide sequence shown in SEQ ID NO.17 has a molar percentage of 1-7%.
[0028] The nucleotide sequence shown in SEQ ID NO.18 has a molar percentage of 1–7%.
[0029] The nucleotide sequence shown in SEQ ID NO.19 has a molar percentage of 1-7%.
[0030] The nucleotide sequence shown in SEQ ID NO.20 has a molar percentage of 0.5% to 6%.
[0031] The nucleotide sequence shown in SEQ ID NO.21 has a molar percentage of 0.5% to 6%.
[0032] The nucleotide sequence shown in SEQ ID NO.22 has a molar percentage of 0.5% to 6%.
[0033] The nucleotide sequence shown in SEQ ID NO.23 has a molar percentage of 0.5% to 6%.
[0034] The nucleotide sequence shown in SEQ ID NO.24 has a molar percentage of 0.5% to 6%.
[0035] The nucleotide sequence shown in SEQ ID NO.25 has a molar percentage of 0.5% to 6%.
[0036] The nucleotide sequence shown in SEQ ID NO.26 has a molar percentage of 0.5% to 6%.
[0037] The nucleotide sequence shown in SEQ ID NO.27 has a molar percentage of 0.5% to 6%.
[0038] The nucleotide sequence shown in SEQ ID NO.28 has a molar percentage of 0.5% to 6%.
[0039] The nucleotide sequence shown in SEQ ID NO.29 has a molar percentage of 0.5% to 6%.
[0040] The nucleotide sequence shown in SEQ ID NO. 30 has a molar percentage of 0.5% to 6%.
[0041] The nucleotide sequence shown in SEQ ID NO.31 has a molar percentage of 0.5% to 6%.
[0042] The nucleotide sequence shown in SEQ ID NO.32 has a molar percentage of 0.5% to 6%.
[0043] The nucleotide sequence shown in SEQ ID NO.33 has a molar percentage of 0.5% to 6%.
[0044] Furthermore, the molar percentage of the nucleotide sequence shown in SEQ ID NO.1 is 9-10%, and the molar percentage of the nucleotide sequence shown in SEQ ID NO.2 is 8-9%.
[0045] The nucleotide sequence shown in SEQ ID NO.3 has a molar percentage of 5-6%.
[0046] The nucleotide sequence shown in SEQ ID NO.4 has a molar percentage of 4-5%.
[0047] The nucleotide sequence shown in SEQ ID NO.5 has a molar percentage of 4-5%.
[0048] The nucleotide sequence shown in SEQ ID NO.6 has a molar percentage of 4-5%.
[0049] The nucleotide sequence shown in SEQ ID NO.7 has a molar percentage of 4-5%.
[0050] The nucleotide sequence shown in SEQ ID NO.8 has a molar percentage of 3-4%;
[0051] The nucleotide sequence shown in SEQ ID NO.9 has a molar percentage of 3-4%.
[0052] The nucleotide sequence shown in SEQ ID NO.10 has a molar percentage of 3-4%.
[0053] The nucleotide sequence shown in SEQ ID NO. 11 has a molar percentage of 3-4%.
[0054] The nucleotide sequence shown in SEQ ID NO.12 has a molar percentage of 3-4%.
[0055] The nucleotide sequence shown in SEQ ID NO.13 has a molar percentage of 3-4%.
[0056] The nucleotide sequence shown in SEQ ID NO.14 has a molar percentage of 2-3%.
[0057] The nucleotide sequence shown in SEQ ID NO.15 has a molar percentage of 2-3%.
[0058] The nucleotide sequence shown in SEQ ID NO.16 has a molar percentage of 2-3%.
[0059] The nucleotide sequence shown in SEQ ID NO.17 has a molar percentage of 2-3%.
[0060] The nucleotide sequence shown in SEQ ID NO.18 has a molar percentage of 2-3%.
[0061] The nucleotide sequence shown in SEQ ID NO.19 has a molar percentage of 2-3%.
[0062] The nucleotide sequence shown in SEQ ID NO.20 has a molar percentage of 2-3%.
[0063] The nucleotide sequence shown in SEQ ID NO.21 has a molar percentage of 1–2%.
[0064] The nucleotide sequence shown in SEQ ID NO.22 has a molar percentage of 1–2%.
[0065] The nucleotide sequence shown in SEQ ID NO.23 has a molar percentage of 1–2%.
[0066] The nucleotide sequence shown in SEQ ID NO.24 has a molar percentage of 1–2%.
[0067] The nucleotide sequence shown in SEQ ID NO.25 has a molar percentage of 1–2%.
[0068] The nucleotide sequence shown in SEQ ID NO.26 has a molar percentage of 1–2%.
[0069] The nucleotide sequence shown in SEQ ID NO.27 has a molar percentage of 1–2%.
[0070] The nucleotide sequence shown in SEQ ID NO.28 has a molar percentage of 1–2%.
[0071] The nucleotide sequence shown in SEQ ID NO.29 has a molar percentage of 1–2%.
[0072] The nucleotide sequence shown in SEQ ID NO.30 has a molar percentage of 1–2%.
[0073] The nucleotide sequence shown in SEQ ID NO.31 has a molar percentage of 1–2%.
[0074] The nucleotide sequence shown in SEQ ID NO.32 has a molar percentage of 1–2%.
[0075] The nucleotide sequence shown in SEQ ID NO.33 has a molar percentage of 1–2%.
[0076] Further, the molar ratio of the nucleotide sequences shown in SEQ ID NO. 1 to 33 is 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17:0.17.
[0077] The present invention also provides a method for preparing the aforementioned small RNA composition, which includes the following steps:
[0078] The nucleotide sequences shown in SEQ ID NO.1 to 33 are mixed to obtain the product.
[0079] The present invention also provides the use of the aforementioned small RNA composition in the preparation of medicaments for the prevention and / or treatment of alcoholic liver injury;
[0080] Preferably, the drug is a drug that inhibits the expression of the CYP2E1 gene.
[0081] Furthermore, the drug is a drug that increases the content of superoxide dismutase; and / or, the drug is a drug that decreases the content of malondialdehyde; and / or, the drug is a drug that decreases the content of ALT, AST, TBIL and LDH in serum.
[0082] The present invention also provides a medicament for the prevention and / or treatment of alcoholic liver injury, which is a preparation made from the aforementioned small RNA or the aforementioned small RNA composition as the active ingredient, plus pharmaceutically acceptable excipients or auxiliary ingredients.
[0083] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0084] This invention extracts 33 small RNAs from the traditional Chinese medicine Pien Tze Huang. All 33 small RNAs exhibit preventative and / or therapeutic effects against alcoholic liver injury. Furthermore, the combination of these 33 small RNAs provides both preventative protection and therapeutic benefits against alcoholic liver injury. Simultaneously, all 33 small RNAs are effectively absorbed through ingestion and remain stable, making them convenient and effective. These 33 small RNAs can also serve as biomarkers for quality control of Pien Tze Huang; Pien Tze Huang with higher levels of these 33 small RNAs shows better efficacy in preventing and treating alcoholic liver injury. This invention's discovery of small RNAs in Pien Tze Huang that are beneficial in preventing and treating alcoholic liver injury is of significant importance for the further research and development and quality control of Pien Tze Huang. Based on the screened small RNA molecular pointers, product quality control can be performed on each batch of Pien Tze Huang.
[0085] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0086] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0087] Figure 1 This is a flowchart of a small RNA high-throughput sequencing experiment.
[0088] Figure 2 This study validates the absorption of small RNA derived from Pien Tze Huang in serum.
[0089] Figure 3 The concentration of the small RNA of Pien Tze Huang from this invention in serum.
[0090] Figure 4 The concentration of the small RNA of Pien Tze Huang from this invention in the liver.
[0091] Figure 5 To verify the binding ability of Pien Tze Huang small RNA to the target site in a luciferase reporter assay.
[0092] Figure 6 This study aims to detect the levels of SOD and MDA in the liver.
[0093] Figure 7 H&E staining and Oil Red O staining of the liver. Scale bar: 100 μm.
[0094] Figure 8 For the detection of blood biochemical indicators.
[0095] Figure 9 Western blot analysis of CYP2E1 in mouse liver.
[0096] Figure 10 To detect SOD activity and MDA levels in mouse liver.
[0097] Figure 11 H&E staining and Oil Red O staining of mouse liver. Scale bar: 100 μm. Detailed Implementation
[0098] The raw materials and equipment used in the specific embodiments of the present invention are all known products, obtained by purchasing commercially available products.
[0099] The Pien Tze Huang used in this invention was provided by Zhangzhou Pien Tze Huang Pharmaceutical Co., Ltd.
[0100] In the preliminary study, this invention first extracted total RNA from Pien Tze Huang and performed high-throughput sequencing of small RNAs. Then, mice were administered Pien Tze Huang by gavage, and RNA was extracted from the mouse serum for high-throughput sequencing of small RNAs. Small RNAs derived from Pien Tze Huang were screened, and those with a copy number greater than 100 were selected for further study. Ultimately, it was found that 33 small RNAs of this invention are associated with alcoholic liver injury.
[0101] Example 1: Validation of the 33 small RNAs of the present invention in Pien Tze Huang
[0102] 1. Extraction of total RNA from Pien Tze Huang
[0103] Take an appropriate amount of Pien Tze Huang, grind it into a 100-mesh powder at room temperature or low temperature, and then extract total RNA from the sample using Trizol reagent. The specific extraction method is as follows:
[0104] 1) Grind Pien Tze Huang into powder using a low-temperature grinder, weigh 50mg and put it into a 1.5ml centrifuge tube, add 1ml of trizol and vortex, then let it stand on ice for 10min;
[0105] 2) Add 200 μl of chloroform, shake vigorously to mix well, and then let stand for 5 min;
[0106] 3) Centrifuge at 14000g for 20 minutes at 4℃;
[0107] 4) Transfer the supernatant to a new 1.5ml centrifuge tube, add 1-2 times the volume of the supernatant in isopropanol, mix well, and place in -20℃ to precipitate for at least 1 hour.
[0108] 5) Centrifuge at 14000g for 20 minutes at 4℃;
[0109] 6) Discard the supernatant and keep the precipitate. Add 1 ml of 75% alcohol prepared with DEPC water and agitate.
[0110] 7) Centrifuge at 14000g for 20 minutes at 4℃;
[0111] 8) Discard the supernatant, invert the 1.5ml centrifuge tube to air dry the alcohol for about 5-10 minutes;
[0112] 9) Dissolve in DEPC water, store at -80℃ to obtain total RNA from Pien Tze Huang.
[0113] 2. Detection of the content of 33 small RNAs in this invention
[0114] After total RNA extraction from Pien Tze Huang, sequencing can be performed using high-throughput sequencing, reverse transcription PCR (RT-PCR), real-time quantitative PCR (qPCR), RNA microarray, Northern blotting, and in situ hybridization. The specific methods in this embodiment are as follows:
[0115] Total RNA extracted from Pien Tze Huang was subjected to PAGE electrophoresis to recover 18-45 nt RNA molecules. After adding 3' adapters, RT primers containing UMI were added to the system for reverse transcription elongation to synthesize cDNA strands. Small RNA high-throughput sequencing technology (experimental procedure as follows) was then used. Figure 1 As shown in Table 1, 33 small RNA sequences and their contents were detected. RT primers with UMIs were provided by the sequencing company (BGI Genomics Co., Ltd., Shenzhen).
[0116] Table 1. Names and sequences of small RNAs
[0117]
[0118]
[0119] The following specific experimental examples demonstrate the beneficial effects of the present invention.
[0120] Example 1: Stability study of the small RNA of Pien Tze Huang (the present invention) after ingestion.
[0121] 1. Experimental Methods
[0122] RT-qPCR was used to detect small RNAs from Pien Tze Huang that are stably present in animals after ingestion. Primers were designed using the small RNAs listed in Table 1 to detect small RNAs derived from Pien Tze Huang in serum, further verifying the absorption of small RNAs in serum. Primers used for reverse transcription PCR and qPCR detection of Pien Tze Huang small RNAs are shown in Table 2. Only the forward primer was needed for qPCR detection; the reverse primer was provided with the kit and its sequence was AGTGCAGGGTCCGAGGTATT (SEQ ID NO. 34).
[0123] Mouse species: C57BL / 6J;
[0124] The initial in vivo absorption experiment involved administering Pien Tze Huang via gavage;
[0125] Pien Tze Huang oral administration dosage: once a day, with a dose of 1g / kg per administration;
[0126] The mice were administered Pien Tze Huang via gavage for 10 days, and the levels of various small RNAs in their serum were measured 3 hours after the last administration.
[0127] Control group: The mice were administered the same volume of PBS solution by gavage for 10 days. The levels of small RNAs in the serum of the mice were measured 3 hours after the last administration.
[0128] Table 2. List of primers for reverse transcription PCR and qPCR detection
[0129]
[0130]
[0131]
[0132]
[0133] The sRNA of Pien Tze Huang was reverse transcribed using the system shown in Table 3 (10 μl).
[0134] Table 3. sRNA reverse transcription reaction system
[0135]
[0136]
[0137] After the system is prepared, mix it well and put it into the PCR instrument for reaction. The reaction procedure is shown in Table 4.
[0138] Table 4. Reverse transcription procedure for sRNA
[0139]
[0140] After reverse transcription, qPCR primers are used for quantitative detection. The qPCR system is shown in Table 5, and the reaction procedure is shown in Table 6.
[0141] Table 5. sRNA Real-Time PCR Reaction System
[0142]
[0143] Table 6. Quantitative Real-Time PCR Reaction Procedure
[0144]
[0145] 2. Experimental Results
[0146] Experimental results are as follows Figure 2 As shown, Figure 2 In the control group, mice were not administered the drug via gavage; in the PTH group, mice were administered the drug. Figure 2 It can be seen that after oral administration of Pien Tze Huang to mice, the vast majority of drug-derived small RNAs detected by sequencing were significantly elevated in mouse serum. This result proves that drug-derived small RNAs can be absorbed by mammals and enter the circulatory system.
[0147] Experimental Example 2: Detection of Pien Tze Huang sRNA Content in Serum and Liver
[0148] 1. Experimental Methods
[0149] Male C57 mice were randomly divided into a PBS control group, a single-dose Pien Tze Huang group, and a multiple-dose Pien Tze Huang group. After fasting for 12 hours, Pien Tze Huang was ground into a 100-mesh powder and prepared into a suspension with PBS for gavage administration. The single-dose group received the drug once by gavage, while the multiple-dose group received the drug every 3 hours for a total of three administrations. The dosage of Pien Tze Huang administered by gavage was 0.1 g / 100 g each time. The PBS control group received the same volume of PBS by gavage. Six hours after the last gavage, blood was collected from the mice to separate serum, and liver tissue was also collected. The total content of 33 sRNAs (as shown in Table 1) in the serum and liver of each group of mice was detected by RT-qPCR. Primer sequences are shown in Table 2, and reaction systems and procedures are shown in Tables 3-6.
[0150] 2. Experimental Results
[0151] Experimental results are as follows Figure 3 and Figure 4 As shown, the results indicate that the 33 types of Pien Tze Huang small RNAs of this invention can be absorbed through the digestive tract and reach serum and liver tissue. The experimental results demonstrate that the 33 types of Pien Tze Huang sRNAs of this invention can enter the animal body through ingestion and remain stable.
[0152] Experimental Example 3: The inhibitory effect of Pien Tze Huang small RNA on target genes
[0153] 1. Experimental Methods
[0154] The 33 small RNAs from Pien Tze Huang used in this invention were obtained from Pien Tze Huang using the method described in Example 1, or they can be synthesized directly using conventional techniques.
[0155] The inhibitory effect of Pien Tze Huang small RNA on the target gene (CYP2E1 gene) was demonstrated using a luciferase reporter assay.
[0156] The sequence fragments of the CYP2E1 target gene combined with the 33 small RNAs of Pien Tze Huang (the 33 small RNAs are PTH sRNAs, composed of PTH-cRNA-1 to PTH-cRNA-33 in a molar ratio of 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17:0.17) were inserted into pMIR-REPORT. A luciferase reporter plasmid was constructed using the Luciferase plasmid. Positive clones were screened and sequenced for verification. The clones were amplified and the plasmid was purified. Relevant cells were cultured and seeded in 24-well plates. After 12-16 hours, the luciferase expression plasmid carrying the predicted target gene was co-transfected into the cells with the Pien Tze Huang small RNA plasmid. After 24 hours, the cells were collected and lysed, and the luciferase substrate was added. The luciferase reacted with the substrate to produce luciferin. By detecting the fluorescence intensity, the luciferase activity could be measured and compared with the non-punty small RNA group, thereby determining whether the predicted target could be inhibited by the Pien Tze Huang small RNA.
[0157] The specific sequences of the regions in which the CYP2E1 target gene binds to the 33 small RNAs of Pien Tze Huang in this invention are as follows:
[0158] CTTTCCCAATTCCTTTCTTTTGGAAACATTTTCAGCTGGATTTGAAG
[0159] GATATTCCCAAGTCTTTAACCAAGTTGGCAAAGCGCTTCGGGCCAGTGT
[0160] TCACACTGCACCTGGGTCAGAGGCGCATCGTGGTCCTGCATGGCTACA
[0161] AGGCTGTCAAGGAGGTGCTACTGAACCACAAGAATGAGTTCTCTGGCC
[0162] GAGGGGACATTCCTGTGTTCCAGGAGTACAAGAACAAGGGGATTATTT
[0163] TCAATAATGGACCCACATGGAAGGACGTGCGGAGGTTTTCCCTAAGTAT
[0164] CCTCCGTGACTGGGGAATGGGGAAACAGGGTAATGAGGCCCGCATCCA
[0165] AAGAGAGGCACACTTCCTGGTGGAGGAGCTCAAAAAGACCAAAGGCC
[0166] AGCCTTTTGACCCTACCTTTCTGATTGGCT(SEQ ID NO.101)
[0167] Nonsense small RNAs are small RNA sequences that do not bind to target genes. Nonsense small RNA sequence: GUCUCGCGUAUACCUCUGACCUCA (SEQ ID NO. 102)
[0168] 2. Experimental Results
[0169] Results of luciferase reporter assay as follows Figure 5 As shown, "control" refers to the group transfected with nonsense small RNA, serving as a control. Figure 5 This indicates that the Pien Tze Huang small RNA composition of the present invention has a significant inhibitory effect on the CYP2E1 gene.
[0170] Experiment 4: Verification of the restorative effect of Pien Tze Huang small RNA on alcoholic liver injury
[0171] 1. Experimental Methods
[0172] All 33 small RNAs from Pien Tze Huang used in this invention were directly synthesized using conventional techniques.
[0173] (1) Establishment of a mouse model of alcoholic liver injury:
[0174] A number of 8-week-old male C57 mice were purchased and acclimatized for 2 weeks at an animal testing center before modeling began. Phase 1: The mice were fed a control liquid diet (ethanol-free) for 5 days. The feeding tubes were cleaned and the feed changed daily, with no additional food or water added. A special feeding tube was used; a gloved hand was placed over the hole at the tube opening, the tube was filled, and the cap was tightened. Phase 2: On day 6, the control diet was replaced with Lieber-DeCarli ethanol liquid diet. The feed was changed daily between 3 PM and 5 PM to ensure fresh food was available at the start of the mice's peak feeding period. During feeding, the feeding tubes were checked twice daily for blockages or leaks. Phase 3: On day 16, from 7 AM to 9 AM, the mice were administered an alcohol solution at a dose of 5 g alcohol / kg body weight (i.e., 31.5% alcohol administered via gavage = mouse body weight (g) × 20 μl) to model alcoholic liver injury. Mice will experience hypothermia after being given an alcohol solution by gavage, so the cages need to be placed on a heating pad.
[0175] (2) Therapeutic administration:
[0176] Mice with the model were randomly divided into a control group, a nonsense small RNA group, and a Pien Tze Huang sRNA group (PTH sRNA, composed of PTH-sRNA-1 to PTH-sRNA-33 in a molar ratio of 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17:0.17). After the model was established, the mice were treated according to their grouping. The control group received no treatment; the Pien Tze Huang sRNA group was administered a mixture of 33 sRNAs by gavage at a dose of 0.16 nmol / g, once daily for a total of 10 days; the nonsense small RNA group was administered a nonsense small RNA solution by gavage at a dose of 0.16 nmol / g, once daily for a total of 10 days; wild-type mice without modeling were used as a control (WT).
[0177] The 33 small RNAs were synthesized into dry powder by the company, then dissolved in an equal volume of DEPC water. The 33 small RNA solutions were mixed and administered to mice by gavage at a dose of 0.16 nmol / g.
[0178] The nonsense small RNA was also synthesized as a dry powder by the company, dissolved in an equal volume of DEPC-treated water, and administered by gavage at a dose of 0.16 nmol / g. The scramble RNA sequence is shown in SEQ ID NO.102.
[0179] (3) Indicator Testing
[0180] Mice were euthanized after treatment, and their livers were collected to detect the levels of superoxide dismutase (SOD) and malondialdehyde (MDA). The livers were also stained with H&E and Oil Red O.
[0181] 2. Experimental Results
[0182] The results of SOD and MDA content are as follows: Figure 6 As shown, compared with the control group, the SOD content of the Pien Tze Huang sRNA group was significantly increased and the MDA content was significantly decreased, indicating that the small RNA in Pien Tze Huang has a positive effect on liver repair in alcoholic liver injury.
[0183] The results of H&E staining and Oil Red O staining are as follows: Figure 7 As shown, wild-type mouse hepatocytes are neatly arranged with round and clear nuclei and abundant cytoplasm. Control mice, after alcohol-induced oxidative stress, exhibited lobular destruction, increased hepatocyte volume, slightly cracked nuclei, and significant lipid droplet accumulation upon Oil Red O staining. Compared to the control group, the livers of mice treated with the sRNA of this invention showed no obvious histological lesions, clearer nuclei, a corresponding reduction in the number of lipid droplets, and some relief from fatty degeneration. This demonstrates that the small RNA composition of this invention can effectively treat alcoholic liver injury.
[0184] Experimental Example 5: Verification of the preventive and protective effect of Pien Tze Huang small RNA on alcoholic liver injury.
[0185] 1. Experimental Methods
[0186] All 33 small RNAs from Pien Tze Huang used in this invention were directly synthesized using conventional techniques.
[0187] First, C57BL / 6J mice were fed an adaptive liquid diet (ethanol-free) for 5 days. On day 6, they were switched to a liquid diet containing 5% alcohol (Lieber-DeCarli ethanol liquid diet) for a total of 10 days. Simultaneously, drug administration began on day 6, and the model mice were randomly divided into three groups: a control group, a nonsense small RNA group, and a Pien Tze Huang sRNA administration group (PTH sRNA). The control group received no treatment; the Pien Tze Huang sRNA group was administered a mixture of 33 sRNAs by gavage (composed of PTH-sRNA-1 to PTH-sRNA-33 in a molar ratio of 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17:0.17); the nonsense small RNA group was administered a nonsense small RNA solution by gavage.
[0188] The 33 small RNAs were synthesized into dry powder by the company, then dissolved in an equal volume of DEPC water. The 33 small RNA solutions were mixed and administered to mice by gavage at a dose of 0.16 nmol / g.
[0189] The nonsense small RNA sequence, as shown in SEQ ID NO.102, was also synthesized as a dry powder by the company. It was dissolved in an equal amount of DEPC water and administered by gavage at a dose of 0.16 nmol / g.
[0190] The alcohol was administered once daily during the feeding period. On the morning of day 16, 9 hours after the mice were given the alcohol solution, blood was collected to separate serum, which was stored at -80°C for later use. Half of the liver was collected and frozen at -80°C, while the other half was fixed with 4% paraformaldehyde. Wild-type mice without modeling were used as a control (WT).
[0191] Biochemical parameters (ALT, AST, LDH, TBIL) were measured using mouse serum; some livers were fixed for HE staining and Oil Red O staining, and some livers were used for liver vitality testing (SOD, MDA) and Western blotting to detect CYP2E1 content.
[0192] 2. Experimental Results
[0193] In control mice, alcoholic liver injury was induced by feeding them with the Lieber-DeCarli diet, resulting in a sharp increase in serum ALT, AST, TBIL, and LDH levels. However, after prophylactic administration of PTH sRNA to the mice, these serum biochemical indicators decreased. This result suggests that Pien Tze Huang small RNA possesses hepatoprotective activity in the context of alcoholic liver injury. Figure 8 ).
[0194] The CYP2E1 protein is ethanol-induced and exacerbates oxidative damage by accelerating ROS production. Figure 9 As shown, compared with wild-type mice, the CYP2E1 protein level in the control group was increased, while the CYP2E1 protein level in mice given Pien Tze Huang sRNA prophylactic administration was reduced to near the level of normal mice.
[0195] In addition, the levels of SOD and MDA in the liver were measured; these two indicators are important factors reflecting the body's oxidative and antioxidant capacity. The results are as follows: Figure 10 As shown, ethanol induces a decrease in SOD levels and an increase in MDA levels in the liver of mice, while prophylactic administration of the drug can reduce the degree of oxidative damage to the liver to some extent.
[0196] The results of tissue section staining showed that ( Figure 11 The hepatocytes of wild-type mice were intact, without fat gaps or inflammatory infiltration. In the control group, significant fatty degeneration was observed, with large areas of fat gaps and inflammatory infiltration, and severe lipid droplet accumulation. Compared with the control group, liver slices from the Pien Tze Huang sRNA group showed a few inflammatory cells and a lower degree of fat accumulation. This indicates that the small RNA composition of the present invention can effectively prevent alcoholic liver injury.
[0197] In summary, this invention extracts 33 small RNAs from the traditional Chinese medicine Pien Tze Huang. All 33 small RNAs exhibit preventative and / or therapeutic effects against alcoholic liver injury. Furthermore, the composition obtained by combining these 33 small RNAs demonstrates both preventative and therapeutic effects against alcoholic liver injury. Simultaneously, all 33 small RNAs are effectively absorbed through ingestion and remain stable, making them convenient and effective. These 33 small RNAs can also serve as biomarkers for quality control of Pien Tze Huang; Pien Tze Huang with higher levels of these 33 small RNAs shows better efficacy in preventing and treating alcoholic liver injury. This invention's discovery of small RNAs in Pien Tze Huang that are beneficial in preventing and treating alcoholic liver injury is of significant importance for the further research and development and quality control of Pien Tze Huang. Based on the screened small RNA molecular pointers, product quality control can be performed on each batch of Pien Tze Huang.
Claims
1. A small RNA composition for the prevention and / or treatment of alcoholic liver injury, characterized in that: The small RNA composition is composed of 33 small RNAs with nucleotide sequences as shown in SEQ ID NO.1~33.
2. The small RNA composition according to claim 1, characterized in that: The small RNA with the nucleotide sequence shown in SEQ ID NO.1 has a molar percentage of 7-10%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.2 has a molar percentage of 6-10%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.3 has a molar percentage of 4-10%. The small RNA with nucleotide sequences as shown in SEQ ID NO.4 has a molar percentage of 3-9%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.5 has a molar percentage of 3-9%. The small RNA nucleotide sequence, as shown in SEQ ID NO. 6, has a molar percentage of 3-9%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.7 has a molar percentage of 3-9%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.8 has a molar percentage of 2-8%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.9 has a molar percentage of 2-8%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.10 has a molar percentage of 2-8%. The small RNA with the nucleotide sequence shown in SEQ ID NO.11 has a molar percentage of 2-8%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.12 has a molar percentage of 2-8%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.13 has a molar percentage of 2-8%. The small RNA with nucleotide sequences as shown in SEQ ID NO.14 has a molar percentage of 1-7%. The small RNA with nucleotide sequences as shown in SEQ ID NO.15 has a molar percentage of 1-7%. The small RNA with nucleotide sequences as shown in SEQ ID NO.16 has a molar percentage of 1-7%. The small RNA with nucleotide sequences as shown in SEQ ID NO.17 has a molar percentage of 1-7%. The small RNA with nucleotide sequences as shown in SEQ ID NO.18 has a molar percentage of 1-7%. The small RNA with nucleotide sequences as shown in SEQ ID NO.19 has a molar percentage of 1-7%. The small RNA with nucleotide sequences as shown in SEQ ID NO.20 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.21 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.22 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.23 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.24 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.25 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.26 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.27 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.28 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.29 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.30 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.31 has a molar percentage of 0.5-6%. The small RNA with nucleotide sequences as shown in SEQ ID NO.32 has a molar percentage of 0.5-6%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.33 has a molar percentage of 0.5-6%.
3. The small RNA composition according to claim 2, characterized in that: The small RNA with the nucleotide sequence shown in SEQ ID NO.1 has a molar percentage of 9-10%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.2 has a molar percentage of 8-9%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.3 has a molar percentage of 5-6%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.5 has a molar percentage of 4-5%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.6 has a molar percentage of 4-5%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.7 has a molar percentage of 4-5%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.8 has a molar percentage of 3-4%; The small RNA with the nucleotide sequence shown in SEQ ID NO.9 has a molar percentage of 3-4%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.10 has a molar percentage of 3-4%. The small RNA with the nucleotide sequence shown in SEQ ID NO.11 has a molar percentage of 3-4%. The small RNA with the nucleotide sequence shown in SEQ ID NO.12 has a molar percentage of 3-4%. The small RNA with the nucleotide sequence shown in SEQ ID NO.13 has a molar percentage of 3-4%. The small RNA with the nucleotide sequence shown in SEQ ID NO.14 has a molar percentage of 2-3%. The small RNA with the nucleotide sequence shown in SEQ ID NO.15 has a molar percentage of 2-3%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.16 has a molar percentage of 2-3%. The small RNA with the nucleotide sequence shown in SEQ ID NO.17 has a molar percentage of 2-3%. The small RNA with the nucleotide sequence shown in SEQ ID NO.18 has a molar percentage of 2-3%. The small RNA with the nucleotide sequence shown in SEQ ID NO.19 has a molar percentage of 2-3%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.20 has a molar percentage of 2-3%. The small RNA with the nucleotide sequence shown in SEQ ID NO.21 has a molar percentage of 1-2%. The small RNA with the nucleotide sequence shown in SEQ ID NO.22 has a molar percentage of 1-2%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.23 has a molar percentage of 1-2%. The small RNA with nucleotide sequences as shown in SEQ ID NO.24 has a molar percentage of 1-2%. The small RNA with the nucleotide sequence shown in SEQ ID NO.25 has a molar percentage of 1-2%. The small RNA with the nucleotide sequence shown in SEQ ID NO.26 has a molar percentage of 1-2%. The small RNA with the nucleotide sequence shown in SEQ ID NO.27 has a molar percentage of 1-2%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.28 has a molar percentage of 1-2%. The small RNA with the nucleotide sequence shown in SEQ ID NO.29 has a molar percentage of 1-2%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.30 has a molar percentage of 1-2%. The small RNA with the nucleotide sequence shown in SEQ ID NO.31 has a molar percentage of 1-2%. The small RNA with the nucleotide sequence shown in SEQ ID NO.32 has a molar percentage of 1-2%. The small RNA with a nucleotide sequence as shown in SEQ ID NO.33 has a molar percentage of 1-2%.
4. The small RNA composition according to any one of claims 1 to 3, characterized in that: The molar ratios of the 33 small RNAs with nucleotide sequences as shown in SEQ ID NO. 1~33 are 1:0.93:0.53:0.51:0.50:0.45:0.44:0.41:0.36:0.35:0.33:0.33:0.32:0.28:0.24:0.24:0.23:0.23:0.22:0.21:0.20:0.20:0.20:0.19:0.19:0.19:0.18:0.18:0.17:0.17:0.17:0.17:0.17:0.
17.
5. A method for preparing the small RNA composition according to any one of claims 1 to 4, characterized in that: Includes the following steps: The 33 small RNAs with nucleotide sequences as shown in SEQ ID NO.1~33 are mixed to obtain the product.
6. Use of the small RNA composition according to any one of claims 1 to 4 in the preparation of a medicament for the prevention and / or treatment of alcoholic liver injury.
7. The use according to claim 6, characterized in that: The drug is a drug that inhibits the expression of the CYP2E1 gene.
8. The use according to claim 6, characterized in that: The drug is a drug that increases the content of superoxide dismutase; and / or, the drug is a drug that decreases the content of malondialdehyde; and / or, the drug is a drug that decreases the content of ALT, AST, TBIL and LDH in serum.
9. A medicament for the prevention and / or treatment of alcoholic liver injury, characterized in that: The drug is a formulation prepared by using the small RNA composition according to any one of claims 1 to 4 as the active ingredient, plus pharmaceutically acceptable excipients.
Citation Information
Patent Citations
Application of Pien Tze Huang and preparation thereof in preparing medicines for treating alcoholic liver injury
CN104042656A
shRNA lentiviral expression vector for specifically inhibiting hepatic cell CYP2E1 gene expression, constructing method and application thereof
CN102703507A
Composition comprising microRNA for diagnosing liver disease
KR1020180046889A