A field effect transistor biosensor and its application in mci detection

Abstract

The application provides a field effect transistor sensor and a preparation method and application in MCI thereof, and the application uses silver nanoclusters with active sites as a biological detection area, improves the number, stability and anti-interference ability of aptamer binding sites, and realizes accurate detection of MCI. The chemical formula of the silver nanoclusters is [Ag4SiW 12 O 40 (dppm)2(CH3CN)6], the weakly coordinated acetonitrile molecules in the silver nanoclusters fall off under the condition that the overall structure is not destroyed, bare Ag atoms are exposed, and the nucleic acid aptamer is connected, and the [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] does not have redundant sites.

Description

Technical Field

[0001] The present invention belongs to the technical field of semiconductor biodetectors, and in particular relates to a field effect transistor sensor, a preparation method thereof, and an application in MCI. Background Art

[0002] Field-effect transistor (FET) biosensors convert biological signals into easily processible, quantifiable signals, such as electricity or light, enabling the detection of proteins, pathogens, viruses, and other analytes. They have attracted widespread attention due to their potential advantages in early disease warning and genetic analysis. As a medical diagnostic tool, FET biosensors can reduce the burden on centralized diagnostic facilities and are a promising type of biosensor.

[0003] Currently, there are reports of detecting a Chagas disease marker (IBMP 8-1) using an InP channel field-effect transistor; ultrasensitive detection of hepatitis B surface antigen using a zinc oxide nanorod field-effect biosensor; and rapid screening for Alzheimer's disease (AD) using a gold nanoparticle field-effect biosensor (CN115343481A). Mild cognitive impairment (MCI) refers to the early stages of AD, characterized by mild decline in memory or other cognitive functions, but without affecting daily living abilities. Early intervention for individuals at this stage can effectively slow disease progression. Patients in the MCI stage typically have minimal pathological features, with relatively good memory and cognitive function, and perform well on cognitive assessment scales. However, invasive cerebrospinal fluid testing often places a high burden on patients in the early stages of the disease. Most subjects, before significant pathological findings, choose invasive testing, making it difficult to detect and assess early MCI.

[0004] Aβ protein aggregates (Aβ) are serum protein markers of AD. 42 or Aβ 40 ) levels can serve as an ideal, highly sensitive, and low-invasive marker for early detection of AD, including MCI. However, compared to AD patients, MCI patients have lower levels of Aβ protein aggregates, a marker of AD, in their serum, which is easily interfered with by large amounts of background proteins such as serum albumin and antibodies.

[0005] In existing gold nanoparticle field-effect transistors, nucleic acid aptamers are fixed to the gold nanoparticle functional layer above the dielectric layer through gold-thiol bonds, or nucleic acid aptamers are fixed to the dielectric layer modified with APTES through amide bond linkage. The fixed amount and stability of nucleic acid aptamers in gold nanoparticle field-effect transistors are severely restricted by gold-thiol bonds or amide bonds. The lack of nucleic acid aptamer binding points restricts the improvement of sensitivity. In addition, high sensitivity is always accompanied by poor anti-interference ability. Existing biological detection areas such as gold nanoparticle functional layers expose nucleic acid aptamers to the outside and are easily interfered with by the test environment. Therefore, it is necessary to increase the number, stability and anti-interference ability of nucleic acid aptamer binding points to achieve accurate detection of MCI. Summary of the Invention

[0006] The present invention aims to provide a field-effect transistor that uses silver nanoclusters with active sites as biological detection areas to improve the number, stability and anti-interference ability of nucleic acid aptamer binding sites, thereby achieving accurate detection of MCI.

[0007] A first aspect of the present invention provides a field effect transistor comprising:

[0008] substrate;

[0009] a silicon dioxide dielectric layer prepared on a substrate;

[0010] The source electrode and the drain electrode are located on the silicon dioxide dielectric layer, and the source electrode and the drain electrode are arranged opposite to each other and spaced apart;

[0011] A carbon nanotube (CNT) channel layer is located on the upper surface of the silicon dioxide dielectric layer, wherein the CNT channel layer is located between the source electrode and the drain electrode;

[0012] a dielectric layer, located on the upper surface of the CNT channel layer and away from the substrate;

[0013] A functionalized molecular connection layer formed on the dielectric layer, the functionalized molecular connection layer is used to provide functional group sites for connecting nucleic acid aptamers, wherein the nucleic acid aptamers correspond to Alzheimer's disease serum protein markers;

[0014] The passivation layer formed on the source and drain ensures that when the field-effect transistor measures target biological molecules, only the dielectric layer and the functionalized molecular connection layer located on the upper surface of the CNT channel layer are exposed to the liquid environment, and the liquid does not contact the source, drain and CNT channel layer.

[0015] The solution gate is arranged on the functionalized molecular connection layer, and the solution is phosphate buffer solution (PBS).

[0016] The functionalized molecular connection layer is a silver nanocluster layer with active sites, and the chemical formula of the silver nanocluster layer is [Ag4SiW 12 O 40 (dppm)2(CH3CN)6], referred to as Ag4SiW 12 ;

[0017] The [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] has two [Ag2(dppm)(CH3CN)3] 2+ The unit is connected to SiW through Ag-O bond 12 O 40 2- The bond length of Ag-O is

[0018] [Ag2(dppm)(CH3CN)3] 2+ The strong coordination ability of dppm in the unit forms Ag-P bonds with surface silver atoms, and the bond length range is

[0019] [Ag2(dppm)(CH3CN)3] 2+ Three weakly coordinated acetonitrile molecules in the unit coordinate with the surface silver atoms;

[0020] [Ag2(dppm)(CH3CN)3] 2+ The unit is [SiW12O40] 4- The center is arranged in a centrosymmetric manner, and one or more of the six weakly coordinated acetonitrile molecules can be further replaced by functional organic ligands or dropped without destroying the overall structure, exposing the naked Ag atoms to connect with the nucleic acid aptamer. 12 O 40 (dppm)2(CH3CN)6] does not contain any redundant sites.

[0021] The dielectric layer is a high-κ dielectric layer, preferably hafnium oxide, yttrium oxide or aluminum oxide;

[0022] The thickness of the functionalized molecular connection layer is 1 nm to 8 nm.

[0023] The nucleic acid aptamer comprises:

[0024] Aβ42 aggregate probe nucleic acid sequence:

[0025] 5'-AGTCTAGGATTCGGCGTGGGTTAATTTTTTGCTGCCTGTGGTGTTGGGGCGGGTGCG-3'; Aβ40 aggregate probe nucleic acid sequence:

[0026] 5'-GCTGCCTGTGGTGTTGGGGCGGGTGCG-3'.

[0027] The source and drain are Ti / Pd / Au stacked metals.

[0028] Preferably, the field effect transistor of the present invention is specifically used for detecting early MCI.

[0029] According to a second aspect of the present invention, a method for preparing a field effect transistor is provided, comprising the following steps:

[0030] Step 1: depositing a silicon dioxide dielectric layer on a substrate;

[0031] Step 2: Depositing a CNT thin film as a channel layer between the source and drain electrodes using a silicon dioxide dielectric layer as a CNT growth surface;

[0032] Step 3: forming a source electrode and a drain electrode;

[0033] Step 4: preparing a dielectric layer on the channel layer;

[0034] Step 5: Spin coating to form a passivation layer on the source and drain electrodes;

[0035] Step 6: Prepare a functionalized molecular connection layer on the dielectric layer, and expose the dielectric layer to [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] growth solution, reacted at 20-70℃ to generate [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanocluster layer;

[0036] Step 7: Immobilizing a nucleic acid aptamer on the functionalized molecular connection layer, wherein the nucleic acid aptamer corresponds to an Alzheimer's disease serum protein marker;

[0037] Specifically, the nucleic acid aptamer is fixed on the functional molecular connection layer, which includes: 12 O 40 (dppm)2(CH3CN)6] silver nanocluster layer, only the nucleic acid aptamer solution needs to be dropped onto the [Ag4SiW 12 O 40(dppm)2(CH3CN)6] silver nanocluster layer for 5-6 hours, so that the [Ag4SiW 12 O 40 The weakly coordinated acetonitrile molecules in the (dppm)2(CH3CN)6] silver nanoclusters fall off, exposing bare Ag atoms that connect to the nucleic acid aptamers, thereby fixing the nucleic acid aptamers on the functionalized molecular connection layer above the dielectric layer. Specifically, the solution environment of the nucleic acid aptamer solution is pure water, and the solution pH range is 7-8. The nucleic acid aptamers include: Aβ42 aggregation probe nucleic acid sequence: 5'-AGTCTAGGATTCGGCGTGGGTTAATTTTTTGCTGCCTGTGGTGTTGGGGCGGGTGCG-3', Aβ40 aggregation probe nucleic acid sequence: 5'-GCTGCCTGTGGTGTTGGGGCGGGTGCG-3'.

[0038] Specifically, [Ag4SiW 12 O 40 The preparation method of the [(dppm)2(CH3CN)6] growth solution is:

[0039] Step (1): dissolving an appropriate amount of AgNO3 in a CH3CN solution to obtain solution A; dissolving an appropriate amount of CyhSH and Et3N in a C2H5OH solution to obtain solution B; slowly dripping solution B into solution A, shielding from light and stirring, and washing after precipitation to obtain (CyhSAg) n Precursor;

[0040] Step (2), a certain amount of the (CyhSAg) n The precursor and excess silver toluenesulfonate were dissolved in CH3CN solution, mixed thoroughly, and then an appropriate amount of H4[SiW 12 O 40 ]·xH2O, then add a certain concentration of dppm solution and stir thoroughly.

[0041] According to a third aspect of the present invention, a field effect transistor is provided for use in the detection of serum markers for early MCI screening.

[0042] The field effect transistor provided by the present invention adopts [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanoclusters immobilized nucleic acid aptamers as probe molecules for functionalized carbon nanotube transistor sensors can help achieve high-sensitivity detection of target biomolecules in high ionic strength solution environments such as serum.

[0043] The field effect transistor provided by the present invention adopts [Ag4SiW 12 O40 (dppm)2(CH3CN)6] silver nanoclusters immobilized nucleic acid aptamers as probe molecules for functionalized carbon nanotube transistor sensors, [Ag4SiW 12 O 40 The strongly coordinated dppm in the silver nanoclusters (dppm)2(CH3CN)6) forms Ag-P bonds with the surface silver atoms, and the weakly coordinated acetonitrile molecules fall off without destroying the overall structure, exposing the bare Ag atoms that are easy to connect with the nucleic acid aptamer. 12 O 40 (dppm)2(CH3CN)6] does not have any redundant sites, and there is no need to seal the sites in the silver nanocluster needles.

[0044] The field effect transistor provided by the present invention [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanoclusters not only make [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] exposes Ag atoms with active sites, and makes [Ag4SiW 12 O 40 The (dppm)2(CH3CN)6] silver nanoclusters became metallic silver nanoclusters with micropores. The micropores of the metallic silver nanoclusters not only facilitate the adsorption of nucleic acid aptamers by the silver nanoclusters but also accommodate the nucleic acid aptamers within the metallic silver nanoclusters, preventing exposure of the nucleic acid aptamers and improving the anti-interference ability of the detection.

[0045] The [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanocluster field effect crystals can be used in early MCI screening serum marker detection. After the antigen and nucleic acid aptamer bind, different conductance values ​​are formed, thereby realizing the detection of target biological molecules. Compared with the existing technology using electrochemiluminescence analyzer detection method, the existing technology detection process requires pretreatment of the liquid to be tested, and the operating instrument is large and expensive. It takes several hours to get the results, and the low sensitivity of the instrument may lead to misdiagnosis. The transistor-type biosensor designed by the present invention can be integrated and can be made by micro-nano processing. 12 O 40 (dppm)2(CH3CN)6] silver nanoclusters make the capture and detection of antigens more sensitive, and the microporous structure can also avoid interference from the external environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The present invention is further described with reference to the accompanying drawings. However, the embodiments in the accompanying drawings do not constitute any limitation to the present invention. A person skilled in the art can obtain other drawings based on the following drawings without inventive effort.

[0047] Figure 1 A schematic structural diagram of a field effect transistor in an embodiment of the present invention;

[0048] Figure 2 In the embodiment of the present invention, the functional molecular connecting layer [Ag4SiW 12 O 40 Schematic diagram of the structure of (dppm)2(CH3CN)6];

[0049] Figure 3 The preparation process of the field effect transistor in the embodiment of the present invention;

[0050] Figure 4 Transfer characteristic curve test results at different MCI serum marker concentrations in the examples of the present invention. DETAILED DESCRIPTION

[0051] In order to better understand the technical content of the present invention, specific embodiments are given and described below with reference to the accompanying drawings.

[0052] Various aspects of the present invention are described in this disclosure with reference to the accompanying drawings, in which a number of illustrative embodiments are shown. The embodiments of the present disclosure are not necessarily intended to include all aspects of the present invention. It should be understood that the various concepts and embodiments introduced above, as well as those described in more detail below, can be implemented in any of many ways, because the concepts and embodiments disclosed herein are not limited to any embodiment. In addition, some aspects of the present disclosure may be used alone or in any appropriate combination with other aspects disclosed herein.

[0053] A field-effect transistor

[0054] Combine Figure 1 The exemplary embodiment shown, a field effect transistor, comprises:

[0055] A silicon-based substrate 10, a silicon dioxide dielectric layer 20 disposed on the silicon-based substrate 10, a source electrode 31 and a drain electrode 32 spaced apart from each other on the silicon dioxide dielectric layer 20, a carbon nanotube (CNT) channel layer 40 disposed on the silicon dioxide dielectric layer 20 between the source electrode 31 and the drain electrode 32; a dielectric layer 50 disposed on the upper surface of the CNT channel layer away from the substrate; a functionalized molecular connection layer 60 formed on the dielectric layer, and a passivation layer 33 covering the source electrode 31 and the drain electrode 32; a solution gate disposed on the functionalized molecular connection layer, wherein the solution is a phosphate buffer solution (PBS); the functionalized molecular connection layer 60 is [Ag4SiW 12 O 40 The (dppm)2(CH3CN)6] silver nanocluster layer is used to provide functional group sites for connecting nucleic acid aptamers, and the nucleic acid aptamers correspond to Alzheimer's disease serum protein markers.

[0056] Preferably, the silicon-based substrate 10 may be made of highly doped P-type silicon.

[0057] Preferably, the CNT channel layer 40 has a certain size and is randomly spread on the upper surface of the silicon dioxide dielectric layer 20 , and the diameter of a single carbon nanotube is controlled to be 1-3 nm.

[0058] Preferably, the dielectric layer 50 completely covers the entire region of the CNT channel layer 40 , and the entire region between the drain electrode 31 and the drain electrode 32 is covered by the dielectric layer 50 .

[0059] Preferably, the source electrode 31 and the drain electrode 32 are a stacked metal structure, specifically Pd / Ti / Au or Ti / Pd / Au.

[0060] Preferably, the source electrode 31 and the drain electrode 41 are formed by methods such as electron beam evaporation.

[0061] Preferably, the dielectric layer 50 is a high-κ dielectric layer with a κ value greater than 10 to improve the efficiency of gate channel control and enhance sensor sensitivity. For example, the material of the dielectric layer 150 can be, but is not limited to, yttrium oxide (Y2O3), hafnium oxide, aluminum oxide, or other oxides.

[0062] Preferably, the thickness of the dielectric layer 50 is less than 15 nm and greater than 3 nm to ensure sufficient gate control capability while preventing gate dielectric leakage.

[0063] Preferably, the passivation layer 33 is made of an inorganic material, which is used to protect the source 31 and the drain 32 and prevent leakage when the field effect transistor is prepared and operated in a liquid environment, and is preferably made of silicon nitride (SiNx) or silicon oxide.

[0064] Preferably, the inner side surfaces of the source 31 and the drain 32 are in contact with the side surfaces of the dielectric layer 50 and the side surfaces of the CNT channel layer 40, and the passivation layer 33 covers the source 31 and the drain 32, and can cover the area near the contact side surfaces of the source 31 and the drain 32 on the dielectric layer 50. The passivation layer 60 can isolate the source 31 and the drain 32 from the liquid environment during testing, i.e., the solution gate, and open a window in the device channel, so that the functionalized molecular connection layer 60 on the dielectric layer 50 above the channel can adsorb the solution gate and the charged biological molecules to regulate the channel, and perform electrical detection and sensing tests.

[0065] Preferably, a functionalized molecular connection layer 60 is formed on the dielectric layer 50 exposed by the passivation layer. The functionalized molecular connection layer 60 is used to provide functional group sites for connecting nucleic acid aptamers. When the field effect transistor measures the target biological molecules, only the dielectric layer and the functionalized molecular connection layer located on the upper surface of the CNT channel layer are exposed to the liquid environment, and the liquid is not in contact with the source, drain and CNT channel layer.

[0066] The [Ag4SiW 12 O 40 (dppm)2(CH3CN)6], such as Figure 2 As shown, it belongs to the C2 / c space group, and its structure is two [Ag2(dppm)(CH3CN)3] 2+ The unit is connected to SiW through Ag-O bond 12 O 40 2- The connection is formed, the [Ag2(dppm)(CH3CN)3] 2+ The strong coordination ability of dppm in the unit forms Ag-P bonds with the surface silver atoms; the [Ag2(dppm)(CH3CN)3] 2+ Three weakly coordinated acetonitrile molecules in the unit coordinate with the surface silver atoms; the weakly coordinated acetonitrile molecules fall off without destroying the overall structure, exposing the naked Ag atoms to connect with the nucleic acid aptamer. 12 O 40 (dppm)2(CH3CN)6] does not have any extra sites. 12 O 40 The drop of acetonitrile molecules not only exposes Ag atoms with active sites, but also makes [Ag4SiW 12 O 40The (dppm)2(CH3CN)6] silver nanoclusters become metallic silver nanoclusters with micropores, which not only promote the adsorption of nucleic acid aptamers by the silver nanoclusters, but also accommodate the nucleic acid aptamers inside the metallic silver nanoclusters, avoiding the exposure of the nucleic acid aptamers and improving the anti-interference ability of the detection.

[0067] Preferably, the thickness of the functionalized molecular connecting layer is 1 nm to 8 nm.

[0068] Preferably, the nucleic acid aptamer comprises:

[0069] Aβ42 aggregate probe nucleic acid sequence:

[0070] 5'-AGTCTAGGATTCGGCGTGGGTTAATTTTTTGCTGCCTGTGGTGTTGGGGCGGGTGCG-3';

[0071] Aβ40 aggregate probe nucleic acid sequence:

[0072] 5'-GCTGCCTGTGGTGTTGGGGCGGGTGCG-3'.

[0073] Preparation method

[0074] Combine Figure 3 The exemplary embodiment shown is a method for preparing a field effect transistor, comprising the following steps:

[0075] Step 1: depositing a certain thickness of SiO2 on a silicon-based substrate as a dielectric layer;

[0076] Step 2: Deposit a CNT film on the upper surface of the SiO2 dielectric layer, with the diameter of a single carbon tube controlled at 1-3 nm; use a spin coater to coat the surface of the Si / SiO2 structure with the CNT film deposited thereon, expose the corresponding pattern using a photolithography process, and etch the CNT film to obtain a CNT channel layer;

[0077] Step 3: Use a photolithography machine to expose the source and drain electrodes, and use electron beam evaporation to deposit a certain thickness of metal to form source and drain electrodes;

[0078] Step 4: Performing coating and exposure again, using electron beam evaporation to deposit metal yttrium on the upper surface of the CNT channel layer, and oxidizing it to form an yttrium oxide layer;

[0079] Step 5: Use a first photoresist layer to protect the yttrium oxide layer on the CNT channel layer, and use MOVCD to prepare a SiNx passivation layer on the sidewalls and top of the source and drain electrodes.

[0080] Step 6: After spin coating the second photoresist on the area not covered by the photoresist, remove the first photoresist layer and immerse the device coated with the second photoresist in [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] growth solution, react at 20-70℃, and generate [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanocluster layer.

[0081] Step 7: Immobilizing a nucleic acid aptamer on the functionalized molecular connection layer, wherein the nucleic acid aptamer corresponds to an Alzheimer's disease serum protein marker;

[0082] Specifically, step 2 is to deposit a CNT film on the upper surface of the SiO2 dielectric layer, and the diameter of a single carbon tube is controlled at 1-3nm; the surface of the Si / SiO2 structure deposited with the CNT film is spread by a spreader, and the etching layer pattern is transferred to the substrate by ultraviolet lithography, electron beam exposure, etc., and then the excess carbon nanotubes in the pattern are removed by reactive ion etching, etc., so that the remaining carbon tubes form a channel layer.

[0083] Specifically, step 3 is to form a source electrode pattern and a drain electrode pattern on the channel layer by photolithography, then deposit a metal film on the source electrode pattern and the drain electrode pattern by electron beam evaporation, and finally form the source and drain by lift-off.

[0084] Specifically, step 4 may also directly form the oxide high-κ dielectric layer by atomic layer deposition (ALD) or magnetron sputtering.

[0085] Specifically, step 5 is to perform coating and exposure again to protect the yttrium oxide layer on the CNT channel layer, and use MOVCD to prepare a SiNx passivation layer on the sidewalls and top of the source and drain. Before preparing the SiNx passivation layer, it also includes the preparation step of the lead-out electrode.

[0086] Specifically, in step 6, [Ag4SiW 12 O 40 The growth solution (dppm)2(CH3CN)6] was prepared by dissolving an appropriate amount of AgNO3 in a CH3CN solution to obtain solution A; dissolving an appropriate amount of CyhSH and Et3N in a C2H5OH solution to obtain solution B; slowly dripping solution B into solution A, shielding from light and stirring, and washing after precipitation to obtain (CyhSAg). n Precursor; add appropriate amount of (CyhSAg) n The precursor and excess silver p-toluenesulfonate were fully dissolved in CH3CN solution and stirred until the solution became colorless and transparent. Then, an appropriate amount of H4[SiW 12 O 40]·xH2O, and then add a certain concentration of dppm solution to obtain [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] growth solution.

[0087] Preferably, in step 6, 3g to 10g of AgNO3 is dissolved in 50-100ml of CH3CN solution to obtain solution A; 1-10ml of CyhSH and 1-10ml of Et3N are dissolved in 50-200ml of C2H5OH solution to obtain solution B; solution B is slowly dripped into solution A, shielded from light and stirred for 3 hours, and washed after precipitation to obtain (CyhSAg). n Precursor. Weigh using a four-position balance (CyhSAg) n (0.0085 g, 0.0381 mmol) was placed in a 10 mL brown vial and added i PrOH:CH2Cl2:DMF (4.5 mL in total, 4:4:1 ratio) was stirred for 10 min, ultrasonicated for 5 min to make it uniformly dispersed, and then an excess of silver p-toluenesulfonate (0.0385 g, 0.1380 mmol) was added. Then 400 μL CH3CN was added and stirred until a colorless and transparent clear solution was formed. Then H4[SiW 12 O 40 ]·xH2O

[0088] (0.0059 g, 0.0018 mmol), recorded as A. dppm (0.0145 g, 0.0377 mmol) was dissolved in 400 μL CH3CN, recorded as B. B was added to A and stirred for more than 12 h to obtain [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] growth solution.

[0089] Preferably, in step 6, the temperature is maintained at 65°C for 33.34 hours, then the temperature is lowered to and maintained at 30°C, and after one week, [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanocluster layer.

[0090] The [Ag4SiW 12 O 40 The simplest formula of [(dppm)2(CH3CN)6] is: C 62 H 62 Ag4N6O 40 P4SiW 12 Elemental analysis (%): Theoretical value: C 17.23, H 1.45, N 1.95; Found: C 17.03, H 1.35, N 2.07.12 O 40 The (dppm)2(CH3CN)6] silver nanoclusters were measured using a Mo target on a Bruker D8 SMART APEXIICCD X-ray single crystal diffractometer. The crystal structure was elucidated using a direct method. The crystallographic data are shown in Table 1.

[0091] Table 1. [Ag4SiW 12 O 40 Crystallographic data of [(dppm)2(CH3CN)6] silver nanoclusters

[0092]

[0093]

[0094] a R1=∑||F o |-|F c || / ∑|F o |. b wR2={∑[w(F o 2 -F c 2 ) 2 ] / ∑[w(F o 2 ) 2 ]} 1 / 2 .

[0095] Specifically, step 7 is to remove the [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanocluster layer, only the nucleic acid aptamer solution needs to be dropped onto the [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanocluster layer for 5-6 hours, so that the [Ag4SiW 12 O 40 The weakly coordinated acetonitrile molecules in the (dppm)2(CH3CN)6] silver nanoclusters fall off, exposing bare Ag atoms that connect to the aptamer, thereby fixing the aptamer on the functionalized molecular connection layer above the dielectric layer. Specifically, the aptamer solution is in pure water with a pH range of 7-8.

[0096] The nucleic acid aptamer comprises:

[0097] Aβ42 aggregate probe nucleic acid sequence:

[0098] 5'-AGTCTAGGATTCGGCGTGGGTTAATTTTTTGCTGCCTGTGGTGTTGGGGCGGGTGCG-3',

[0099] Aβ40 aggregate probe nucleic acid sequence:

[0100] 5'-GCTGCCTGTGGTGTTGGGGCGGGTGCG-3'.

[0101] MCI serum marker detection

[0102] Step 1: Wash the field effect transistor with deionized water.

[0103] Step 2: Add the aptamer solution to the [Ag4SiW 12 O 40 The chip was incubated at room temperature for 5-6 hours on the silver nanocluster layer of [(dppm)2(CH3CN)6]. The chip was rinsed with deionized water to remove unreacted antibodies.

[0104] Step 3: During the test, drop the plasma to be tested onto the [Ag4SiW 12 O 40 The silver nanocluster layer was then exposed to the presence of (dppm)2(CH3CN)6] to allow for full binding of the probe. Unbound targets were then washed away, and 0.01× PBS was added dropwise as a gate for applying voltage.

[0105] Take a P-type field-effect transistor as an example. When the isoelectric point of the target molecule is lower than the pH of PBS, the target molecule becomes negatively charged. As the concentration of the biomolecule in the test solution increases or decreases, the number of carrier holes in the semiconductor carbon nanotubes in the channel region increases or decreases, affecting the sensor's current. Therefore, as the concentration of the target molecule gradually increases, the sensor's current gradually increases.

[0106] When using the field effect transistor of the embodiment of the present invention to test MCI serum markers, a certain voltage Vds is applied between the source electrode and the drain electrode of the sensor, and a certain range of scanning voltage is applied to the gate. 12 O 40 The amount of silver nanoclusters combined is different, and the current flowing between the source electrode and the drain electrode is different.

[0107] When testing serum markers using a field-effect transistor (FET), performance is measured by the change in the FET output relative to the change in the transistor input. The ratio of these changes is the test sensitivity, or the slope of the response curve. In practical applications, within the detection range, the output current is affected by the noise and accuracy of the data acquisition system. Higher sensitivity results in higher resolution data for the analyte.

[0108] Current-voltage (IV) characteristics were measured using a Keithley 4200 semiconductor parameter analyzer. A four-electrode system was used, with a reference electrode (Ag / AgCl electrode) detecting the solution potential and a working electrode (Pt electrode) providing the bias voltage. The transfer characteristic curves were measured at a source-drain voltage of 10 V.

[0109] When testing a specific concentration, the -2.5V to -1.5V region with good linearity was selected for testing. At the same time, a lower test voltage is beneficial to the stability of the film. The test solution is an MCI serum protein marker solution with different concentrations from 0.3mg / L to 4.6mg / L. Each concentration tested corresponds to a new field effect transistor. The test used a transfer characteristic curve to calibrate the sensitivity. The transfer characteristic curve test results of the transistor at different MCI serum + marker concentrations are as follows Figure 4 As shown in Figure 2, with the increase of MCI serum marker concentration, the overall curve shows a trend of moving to the negative direction. 12 O 40 (dppm)2(CH3CN)6] silver nanocluster layer, some MCI serum markers will be embedded in [Ag4SiW 12 O 40 The micropores of the [(dppm)2(CH3CN)6] nanoclusters result in a negative shift in the threshold voltage. That is, under the influence of the same applied voltage, the output current shows an upward trend. The sensitivity of the transistor detection can be calibrated by the change in output current. The current at VREF = -2.0V was selected for calculation. The calculated results show that the transistor exhibits good linearity during the detection process. The output current increases with increasing concentration. Within the small range of 0.3mg / L to 4.6mg / L required for detection, the difference in current sensitivity is calculated to be 2.97μA / mg·L-1. This result demonstrates the advantages of the field-effect transistor of the present invention in the application of testing serum markers for MCI.

Claims

1. A field effect transistor comprising: a substrate, a silicon dioxide dielectric layer, a source electrode and a drain electrode, a carbon nanotube (CNT) channel layer, a dielectric layer, a functionalized molecular connection layer, a passivation layer, and a solution gate. It is characterized by: The functionalized molecular connection layer is a silver nanocluster layer with active sites, and the chemical formula of the silver nanocluster is [Ag4SiW 12 O 40 (dppm)2(CH3CN)6], the [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] belongs to the C2 / c space group, The [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] structure is two [Ag2(dppm)(CH3CN)3] 2+ The unit is connected to SiW through Ag-O bond 12 O 40 2- Connection formation; [Ag2(dppm)(CH3CN)3] 2+ The dppm with strong coordination ability in the unit forms an Ag-P bond with the surface silver atoms; [Ag2(dppm)(CH3CN)3] 2+ Three weakly coordinated acetonitrile molecules in the unit coordinate with the surface silver atoms; the weakly coordinated acetonitrile molecules can fall without destroying the overall structure, exposing the exposed Ag atoms to connect with the nucleic acid aptamer; the [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] does not contain any redundant sites.

2. The field effect transistor according to claim 1, wherein: The functionalized molecular connection layer is formed on the dielectric layer and is used to provide functional group sites for connecting nucleic acid aptamers, wherein the nucleic acid aptamers correspond to Alzheimer's disease serum protein markers.

3. A field effect transistor according to claim 2, characterized in that: The nucleic acid aptamer comprises: Aβ42 aggregate probe nucleic acid sequence: 5'-GTCTAGGATTCGGCGTGGGTTAATTTTTTGCTGCCTGTGGTGTTGGGGCGGG TGCG-'; Aβ40 aggregate probe nucleic acid sequence: 5'-CTGCCTGTGGTGTTGGGGCGGGTGCG-'.

4. The field effect transistor according to claim 3, characterized in that: The passivation layer is formed on the side walls and top of the source and drain, so that when the field-effect transistor measures the target biological molecules, only the dielectric layer and the functionalized molecular connection layer located on the upper surface of the CNT channel layer are exposed to the liquid environment, and the liquid does not contact the source, the drain and the CNT channel layer.

5. The field effect transistor according to claim 4, characterized in that: The silicon dioxide dielectric layer is prepared on the substrate; the source electrode and the drain electrode are located on the silicon dioxide dielectric layer, and the source electrode and the drain electrode are arranged opposite to each other and spaced apart; a carbon nanotube (CNT) channel layer is located on the upper surface of the silicon dioxide dielectric layer, and the CNT channel layer is located between the source electrode and the drain electrode; The dielectric layer is located on the upper surface of the CNT channel layer and away from the substrate.

6. The field effect transistor according to claim 5, characterized in that: The solution gate is arranged on the functionalized molecular connection layer.

7. The field effect transistor according to claim 6, characterized in that: The dielectric layer is a high-κ dielectric layer.

8. The field effect transistor according to claim 7, characterized in that: The source and drain are Ti / Pd / Au stacked metals.

9. A method for preparing a field effect transistor, comprising the following steps: Step 1: depositing a silicon dioxide dielectric layer on a substrate; Step 2: Depositing a CNT thin film as a channel layer between the source and drain electrodes using a silicon dioxide dielectric layer as a CNT growth surface; Step 3: forming a source electrode and a drain electrode; Step 4: preparing a dielectric layer on the channel layer; Step 5: Spin coating to form a passivation layer on the source and drain electrodes; Step 6: Prepare a functionalized molecular connection layer on the dielectric layer and expose the dielectric layer to [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] growth solution, reacted at 20-70℃ to generate [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] silver nanocluster layer; the [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] belongs to the C2 / c space group, [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] structure is two [Ag2(dppm)(CH3CN)3] 2+ The unit is connected to SiW through Ag-O bond 12 O 40 2- Connection formed; the [Ag2(dppm)(CH3CN)3] 2+ The strong coordination ability of dppm in the unit forms Ag-P bonds with the surface silver atoms; the [Ag2(dppm)(CH3CN)3] 2+ Three weakly coordinated acetonitrile molecules in the unit coordinate with the surface silver atoms; the weakly coordinated acetonitrile molecules can fall without destroying the overall structure, exposing the exposed Ag atoms to connect with the nucleic acid aptamer; the [Ag4SiW 12 O 40 (dppm)2(CH3CN)6] does not contain redundant sites; Step 7: Immobilize the nucleic acid aptamer on the functionalized molecular connection layer, wherein the nucleic acid aptamer corresponds to an Alzheimer's disease serum protein marker.

Images