A method for preparing a multi-channel paper-based microfluidic chip and its use for detecting food hazards

By fabricating a multi-channel paper-based microfluidic chip and utilizing the specific recognition of upconversion nanomaterials and fluorescent probes, the problems of high cost and cumbersome procedures in the detection of food hazards in existing technologies have been solved, achieving highly sensitive, rapid, and real-time detection of food hazards.

CN116764704BActive Publication Date: 2025-12-12JIANGSU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310696801.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-13
Publication Date
2025-12-12
Estimated Expiration
2043-06-13

AI Technical Summary

Technical Problem

Existing methods for detecting hazardous substances in food are costly, cumbersome, and unsuitable for on-site testing, making it difficult to achieve rapid quantitative detection.

Method used

A multi-channel paper-based microfluidic chip was fabricated on a paper substrate by preparing oil-soluble and water-soluble upconversion nanomaterials and combining laser printing and thermosetting technologies. Upconversion fluorescent probes were then used for specific identification, enabling the quantitative detection of food hazards.

Benefits of technology

It achieves highly sensitive, rapid, and real-time detection of food hazards, and can simultaneously detect multiple food hazards, reducing detection costs and improving detection accuracy and portability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116764704B_ABST
    Figure CN116764704B_ABST
Patent Text Reader

Abstract

The application belongs to the field of food safety detection, and particularly relates to a preparation method of a multi-channel paper-based microfluidic chip and application thereof to detection of food hazards; the steps are as follows: step one, preparation of oil-soluble upconversion nanomaterial; step two, preparation of water-soluble upconversion nanomaterial; step three, preparation of upconversion fluorescent probe; step four, preparation of multi-channel paper-based microfluidic chip; step five, detection of hazard content in food; the application prepares a multi-channel paper-based microfluidic chip on a paper base through laser printing combined with heat curing technology, has independent detection zones, and can realize simultaneous quantitative detection of multiple hazards, such as enrofloxacin, ciprofloxacin, diarrheogenic Escherichia coli and Staphylococcus aureus. Therefore, the application has the ability of on-site simultaneous detection of multiple hazards based on the designed multi-channel paper-based microfluidic chip and portable detection device, and is fast and accurate in detection, and has a good practical prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of food safety testing, specifically relating to a method for preparing a multi-channel paper-based microfluidic chip and its application in detecting hazardous substances in food. Background Technology

[0002] Foodborne diseases are usually infectious or toxic, and are caused by food or water contaminated with foodborne pathogens, viruses, parasites, or pesticides and veterinary drugs after entering the human body.

[0003] The long-term accumulation of food hazards in the human body can lead to a series of health risks, including damage to the reproductive and nervous systems, and even induce cancer. Therefore, developing rapid and sensitive detection methods for food hazards is of great significance for food safety and human health.

[0004] Currently, conventional methods for detecting hazardous substances in food, such as high-performance liquid chromatography and enzyme-linked immunosorbent assay (ELISA), often face difficulties such as expensive testing instruments and equipment, high costs, and cumbersome procedures, making it difficult to achieve rapid quantitative detection. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a method for preparing a multi-channel paper-based microfluidic chip and its application in detecting hazardous substances in food, thereby solving the technical problems of high detection costs, cumbersome detection steps, and unsuitability for on-site detection in the aforementioned existing technologies.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] Step 1: Preparation of oil-soluble upconversion nanomaterials: Yttrium chloride hexahydrate, ytterbium chloride hexahydrate, and erbium chloride hexahydrate were added to a certain volume of methanol A and dissolved by ultrasonication. Then, oleic acid and 1-octadecene were added and thoroughly mixed. The mixture was heated and stirred for the first time under closed conditions, and then cooled to room temperature. The closed conditions were then removed, and methanol B containing sodium hydroxide and ammonium fluoride was added dropwise. The mixture was heated and stirred for the second time under closed conditions, and then cooled to room temperature. The precipitate was obtained by centrifugation, washed with a mixture of ultrapure water and ethanol, and dried to obtain oleic acid-coated upconversion nanomaterials for later use.

[0008] Preferably, the amount of yttrium chloride hexahydrate, ytterbium chloride hexahydrate, erbium chloride hexahydrate, methanol A, oleic acid, 1-octadecene, sodium hydroxide, ammonium fluoride and methanol B in step one is 236.6 mg: 77.6 mg: 7.6 mg: 10 mL: 4.0 mL: 9.0 mL: 50.0 mg: 74.1 mg: 10 mL; the mixture of ultrapure water and ethanol is used for cleaning, wherein the volume ratio of ultrapure water to ethanol is 1:3; wherein methanol A and methanol B are both methanol, and different letters are only distinguished in name.

[0009] The first heating and stirring time is 20-30 min, and the heating temperature is 160℃; the second heating and stirring temperature is 295-305℃, and the stirring time is 1.0-1.5 h; the centrifugal separation condition is: the rotation speed is 6000-8000 rpm / min, and the time is 5-8 min.

[0010] Step two, preparation of water-soluble upconversion nanomaterial: the oleic acid-coated upconversion nanoparticles prepared in step one are weighed and dispersed in a hydrochloric acid solution for ultrasonic treatment; after the treatment, ethanol is added and ultrasonically dispersed uniformly, then ultrapure water and ammonia water are added and stirred uniformly under a certain temperature condition, after stirring, tetraethyl orthosilicate is added for the first reaction, and 3-aminopropyl triethoxysilane is added for the second reaction; after the reaction, centrifugal separation is performed, the obtained product is washed with ultrapure water, and after washing, it is dispersed in ultrapure water to obtain a water-soluble upconversion nanomaterial solution;

[0011] Preferably, in step two, the ratio of the upconversion nanomaterial, the hydrochloric acid solution, the ethanol, the ultrapure water, the ammonia water, the tetraethyl orthosilicate and the 3-aminopropyl triethoxysilane is 20 mg: 0.5 mL: 60 mL: 10 mL: 2.5 mL: 20 uL: 50 uL; the first reaction time is 4-6 h, and the second reaction time is 1-2 h; the concentration of the hydrochloric acid solution is 0.1 mol / L; the certain temperature condition is 65℃; the centrifugal separation condition is: the rotation speed is 6000-8000 rpm / min, and the time is 5-8 min; the concentration of the water-soluble upconversion nanomaterial solution is 2 mg / mL.

[0012] Step three, preparation of an upconversion fluorescent probe:

[0013] (1) mixing the upconversion nanomaterial solution prepared in step two with glutaraldehyde aqueous solution to activate the amino group; separating the activated upconversion nanomaterial and dispersing it in a phosphate buffer solution, then adding a food hazard A aptamer solution to perform a first constant temperature incubation, after the incubation, centrifuging, washing the obtained precipitate with ultrapure water, and then centrifuging again, drying to obtain the upconversion nanomaterial modified with the food hazard A aptamer, and finally adding a graphene oxide-containing phosphate buffer solution to perform a second constant temperature incubation to obtain a mixed solution, denoted as upconversion fluorescent probe solution A;

[0014] (2) synchronizing the operation of step (1), the only difference is that the food hazard A aptamer solution is replaced by a food hazard B aptamer solution, and the rest of the operations are the same, finally obtaining upconversion fluorescent probe solution B;

[0015] Preferably, in (1) of step three, the amount of the water-soluble upconversion nanomaterial solution, the glutaraldehyde aqueous solution, the phosphate buffer solution, the food hazard A aptamer solution, the upconversion nanomaterial, and the graphene oxide-containing phosphate buffer solution is 1.0 mL: 1.0 mL: 5.0 mL: 50 uL: 1.0 mg: 2.0 mL; the concentration of the graphene oxide-containing phosphate buffer solution is 0.2 mg / mL; the concentration of the target A aptamer solution is 0.1 mmol / L; the concentration of the upconversion fluorescent probe solution A is 0.5 mg / mL; and the concentration of the upconversion fluorescent probe solution B is 0.5 mg / mL.

[0016] The reaction time of the mixing reaction to activate the amino group is 2 h, the first incubation is performed on a shaking bed at a temperature of 37℃ for 2 h, and the shaking bed has a rotation speed of 180-200 rpm / min; the second incubation is performed on a shaking bed at a temperature of 37℃ for 0.5 h, and the shaking bed has a rotation speed of 180-200 rpm / min; and the centrifugal separation conditions are as follows: a rotation speed of 6000-8000 rpm / min and a time of 5-10 min;

[0017] The aptamer solution is not limited to the sequence of a certain food hazard, and the sequence of the corresponding aptamer is matched according to the type of the target food hazard to be detected; wherein the food hazards include enrofloxacin, ciprofloxacin, enterotoxigenic Escherichia coli, and Staphylococcus aureus.

[0018] Step four, preparation of a multi-channel paper-based microfluidic chip:

[0019] Cutting filter paper, using a laser printer to print patterns on the filter paper, after printing, the filter paper is heat cured, the printer ink is solidified into the chromatography paper fiber pores, forming a hydrophobic barrier zone where the solution cannot flow; In the hydrophobic barrier zone, a microfluidic detection area is surrounded by ink; The microfluidic detection area is composed of detection area one, detection area two, sample addition area and flow channel, the detection area one and the detection area two are respectively arranged on both sides of the sample addition area and are connected through the flow channel; The microfluidic detection area is inside the hydrophobic barrier zone, which is a hydrophilic flow area; Both of them form a multi-channel paper-based microfluidic chip;

[0020] Preferably, in step four, the filter paper is Whatman No. 1 chromatography filter paper, with a size of 20*30mm;

[0021] The detection area one, the detection area two and the sample addition area are all circular areas with a diameter of 3mm; The flow channel is divided into flow channel one and flow channel two, both with a length of 3mm and a width of 1mm;

[0022] The temperature of the heat curing treatment is 200℃, and the curing time is 3h.

[0023] Step five, the use of the multi-channel paper-based microfluidic chip for food hazard detection;

[0024] (1) First, the upconversion fluorescent probe solution A and the upconversion fluorescent probe solution B prepared in step three are added dropwise to the detection area one and the detection area two of the microfluidic paper substrate respectively;

[0025] The amount of the upconversion fluorescent probe solution A and the upconversion fluorescent probe solution B is 5uL:5uL.

[0026] (2) Establishment of standard curve:

[0027] (2.1) First, a mixed solution containing a certain concentration of food hazard A and food hazard B is prepared, and is added dropwise to the sample addition area of the multi-channel paper-based microfluidic chip obtained in step four, and under the action of capillary driving force, reaches the detection area one and the detection area two through the flow channel, incubates at room temperature, so that the food hazard A and the food hazard B react with the corresponding upconversion fluorescent probe solution, and then the fluorescence intensity of the detection area one and the detection area two is detected;

[0028] Preferably, in step (2.1), the amount of the mixed standard solution of food hazard A and food hazard B is 20uL; The incubation time at room temperature is 15min;

[0029] (2.2) synchronizing the operation of step (2.1), the difference is that the concentration of the mixed solution containing food hazard A and food hazard B is gradiently changed, and the rest of the operations are the same, finally the corresponding fluorescence intensity under different concentration conditions is obtained; the concentration of food hazard A and the fluorescence intensity of detection area one are linearly fitted to establish the standard curve for detecting the content of food hazard A; the concentration of food hazard B and the fluorescence intensity of detection area two are linearly fitted to establish the standard curve for detecting the content of food hazard B;

[0030] (3) detection of actual samples: the actual sample is pretreated to obtain a solution to be tested containing food hazards; the solution to be tested is added to the sample adding area of the multi-channel paper-based microfluidic chip, and after incubation at room temperature, the fluorescence intensity of detection area one is measured, the standard curve for detecting the content of food hazard A obtained in step five is brought in, and the content of food hazard A in the actual sample is calculated; the fluorescence intensity of detection area two is measured, and the standard curve for detecting the content of food hazard B obtained in step five is brought in, and the content of food hazard B in the actual sample is calculated.

[0031] Preferably, in step (3), the dropwise addition amount of the solution to be tested is 20 uL; and the incubation time is 15 min.

[0032] Preferably, in steps (2)-(3), the detection of fluorescence intensity is based on a portable food hazard detection device of a multi-channel paper-based microfluidic chip;

[0033] The detection device is composed of a base module, an axial displacement fixing module, a laser emitter clamping module and a paper-based bearing platform module;

[0034] The base module is horizontally installed; the two ends of the base module are marked as A and B ends, and an axial displacement fixing module is arranged at each of the A and B ends; a clamping module is arranged above the axial displacement fixing module at the A end, and a paper-based bearing platform module is arranged above the axial displacement fixing module at the B end;

[0035] The axial displacement fixing module comprises a base clamping knob, a quick mounting plate clamping knob and a quick mounting plate; the base clamping knob is arranged above the base module, the quick mounting plate clamping knob is arranged above the base clamping knob, and the quick mounting plate clamping knob clamps the quick mounting plate;

[0036] The clamping module comprises a heading shaft damping adjustment knob, a pitch shaft damping adjustment knob and a crab clamp holder; the heading shaft damping adjustment knob is arranged above the axial displacement fixing module, the pitch shaft damping adjustment knob is arranged above the heading shaft damping adjustment knob, and the pitch shaft damping adjustment knob is connected to the crab clamp holder;

[0037] The paper-based carrying platform module comprises a fixed base and a precision moving platform; wherein, a Y-axis stepping knob, an X-axis stepping knob and a paper-based chip fixing clamp are arranged on the precision moving platform.

[0038] Parameter limits:

[0039] The size of the base module is 230mm in length and 38mm in width; the X-axis direction of the base module is the long side of the base module, and the Y-axis direction of the base module is the width side of the base module; the X-axis displacement stroke range of the base module is 0-200mm;

[0040] The heading axis damping adjustment knob can be adjusted in the heading angle of 0-360°; the pitch axis damping adjustment knob can be adjusted in the pitch angle of 0-180°; the clamping range of the crab clamp holder is 5-57mm;

[0041] The precision moving platform is displaced in the Y-axis direction and the X-axis direction through the Y-axis stepping knob and the X-axis stepping knob, and the displacement precision is 1mm, and the displacement stroke is 40mm; the Y-axis direction of the precision moving platform is the Y-axis direction of the base module; the X-axis direction of the precision moving platform is the X-axis direction of the base module;

[0042] The operation method for detecting the fluorescence intensity by the portable detection device comprises the following steps:

[0043] The multi-channel paper-based microfluidic chip to be detected is placed on the precision moving platform of the detection device, and is fixed by using the paper-based chip fixing clamp; the X-axis distance of the two-axis displacement fixing modules on the base module is adjusted to be 100mm, the pitch angle of the clamping module is adjusted to be 45°, so that the laser of the laser emitter is aligned with the center of the detection area one and the fluorescence intensity is measured; then, the X-axis stepping knob of the precision moving platform is adjusted to displace the paper-based chip in the X-axis direction by 12mm, so that the laser of the laser emitter is aligned with the center of the detection area two and the fluorescence intensity is measured.

[0044] The following technical effects are disclosed in the application:

[0045] 1. The application discloses a preparation method of a multi-channel paper-based microfluidic chip and application thereof in detection of food hazards, adopts up-conversion nanoparticles as a luminescent material, deposits the prepared up-conversion fluorescent probe in a microfluidic paper-based detection area, realizes accurate quantitative detection of a target based on specific recognition of the target by an aptamer to cause change of a characteristic fluorescent signal, and only needs a very small amount of sample liquid (20 muL) to realize high-sensitivity real-time detection of food hazards.

[0046] 2.The application discloses a food hazard detection method, which can realize simultaneous detection of multiple food hazards based on a prepared multi-channel paper-based microfluidic chip, and specifically comprises the following steps: two independent detection zones are prepared on a paper base through laser printing combined with heat curing technology, up-conversion nanomaterials connected with graphene oxide and aptamers in each detection zone are used as fluorescent acceptors and fluorescent donors, respectively, so that quantitative detection of multiple hazards is realized simultaneously, the shortcomings of traditional methods are overcome, and the health and safety of the public in diet are ensured.

[0047] 3.The modular food hazard detection device constructed in the application is characterized in that when the components are assembled, the shaft displacement fixing module, the clamping module of the laser emitter and the paper base bearing platform module are axially aligned on the base module, so that the optical path and the double detection zones are on the same axis.

[0048] 4.The paper-based sensing detection method for food hazards established in the application has a linear concentration range of 1.0*10 ng / mL-1*10 5 ng / mL for enrofloxacin, 1.0*10 ng / mL-1*10 5 ng / mL for ciprofloxacin, 1.0*10 CFU / mL-1.0*10 7 CFU / mL for diarrheal E. coli, and 4.5*10 CFU / mL-4.5*10 7 CFU / mL for Staphylococcus aureus, and a detection limit of 1.84 ng / mL for enrofloxacin, 2.22 ng / mL for ciprofloxacin, 3.80 CFU / mL for diarrheal E. coli and 4.90 CFU / mL for Staphylococcus aureus. The designed paper-based sensing method can meet the requirements of high-sensitivity simultaneous detection of food hazards, has good universality, and can provide a theoretical basis for real-time monitoring of food hazards in actual detection processes. BRIEF DESCRIPTION OF DRAWINGS

[0049] Figure 1 It is a schematic diagram of the multi-channel paper-based microfluidic chip for food hazard detection.

[0050] Figure 2 It is a characterization diagram of the nanomaterial prepared in Example 1; wherein A is a transmission electron microscope diagram of oil-soluble up-conversion nanoparticles; and B is a transmission electron microscope diagram of water-soluble up-conversion nanoparticles.

[0051] Figure 3 It is characterization data of the aptamer sequence modified by the nanomaterial in Example 1; wherein A is the change of Zeta potential before and after the aptamer sequence is modified by the nanomaterial; and B is an ultraviolet absorption spectrum before and after the aptamer sequence is modified by the nanomaterial.

[0052] Figure 4 It is a structural schematic diagram of a multi-channel paper-based microfluidic chip; wherein, A is a structural diagram of the chip; B is a size distribution diagram of the chip; the reference signs: hydrophobic barrier region-4.1, detection region one-4.2, flow channel one-4.3, sample addition region-4.4, flow channel two-4.5, detection region two-4.6.

[0053] Figure 5 It is a structural diagram of a portable device for food hazard detection based on a multi-channel paper-based microfluidic chip; wherein, A is a structural diagram of the device; B is a front view of the device; C is a left view of the device; D is a top view of the device; the reference signs: base module-5.1, shaft displacement fixing module-5.2, clamping knob of clamping seat-5.2.1, quick mounting plate clamping knob-5.2.2, clamping module of laser emitter-5.3, heading shaft damping adjustment knob-5.3.1, pitch shaft damping adjustment knob-5.3.2, crab clamp holder-5.3.3, paper-based bearing platform module-5.4, fixed base-5.4.1, precision moving platform-5.4.2, Y-axis stepping knob-5.4.2.1, X-axis stepping knob-5.4.2.2, paper-based chip fixing clamp-5.4.2.3.

[0054] Figure 6 It is a fluorescence standard curve established for detecting different concentrations of enrofloxacin and ciprofloxacin in Example 1; wherein, A is a sensor fluorescence signal diagram for detecting different concentrations of enrofloxacin; B is a standard curve established with the concentration of enrofloxacin and the fluorescence intensity signal characteristic value of the sensor at 654 nm; C is a sensor fluorescence signal diagram for detecting different concentrations of ciprofloxacin; D is a standard curve established with the concentration of ciprofloxacin and the fluorescence intensity signal characteristic value of the sensor at 654 nm.

[0055] Figure 7 It is a fluorescence standard curve established for detecting different concentrations of diarrheal Escherichia coli and Staphylococcus aureus in Example 2; wherein, A is a sensor fluorescence signal diagram for detecting different concentrations of diarrheal Escherichia coli; B is a standard curve established with the concentration of diarrheal Escherichia coli and the fluorescence intensity signal characteristic value of the sensor at 654 nm; C is a sensor fluorescence signal diagram for detecting different concentrations of Staphylococcus aureus; D is a standard curve established with the concentration of Staphylococcus aureus and the fluorescence intensity signal characteristic value of the sensor at 654 nm.

[0056] Figure 8 It is a specificity analysis of a multi-channel paper-based microfluidic chip. DETAILED DESCRIPTION

[0057] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be illustrative of the application and not as limiting the application. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments of the application only and is not intended to limit the scope of the application.

[0058] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments of the application only and is not intended to limit the scope of the application. Additionally, where a range of values is provided, it is understood that each intervening value, to the upper and lower limit of the ranges is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also encompassed by the application, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of the limits are also included.

[0059] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials which are described herein. In case of conflict, the present specification will control.

[0060] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The specification and examples given should be considered exemplary only, with the true scope and spirit of the application indicated by the following claims.

[0061] Figure 1 To construct the multi-channel paper-based microfluidic chip for food hazard detection schematic diagram; Figure 5 For the detection of the food hazard portable detection device based on the multi-channel paper-based microfluidic chip, the detection device is composed of a base module 5.1, an axial displacement fixing module 5.2, a clamping module 5.3 of a laser emitter, and a paper-based bearing platform module 5.4.

[0062] The base module 5.1 is horizontally installed; the two ends of the base module 5.1 are marked as A and B ends, and an axial displacement fixing module 5.2 is arranged at each of the A and B ends; a clamping module 5.3 is arranged above the axial displacement fixing module 5.2 at the A end, and a bearing platform module 5.4 is arranged above the axial displacement fixing module 5.2 at the B end.

[0063] The shaft displacement fixing module 5.2 comprises a base clamping knob 5.2.1, a quick mounting plate clamping knob 5.2.2 and a quick mounting plate 5.2.3; wherein the base clamping knob 5.2.1 is arranged above the base module 5.1, the quick mounting plate clamping knob 5.2.2 is arranged above the base clamping knob 5.2.1, and the quick mounting plate clamping knob 5.2.2 clamps the quick mounting plate 5.2.3;

[0064] The clamping module 5.3 comprises a heading shaft damping adjusting knob 5.3.1, a pitching shaft damping adjusting knob 5.3.2 and a crab clamp holder 5.3.3; wherein the heading shaft damping adjusting knob 5.3.1 is arranged above the shaft displacement fixing module 5.2, the pitching shaft damping adjusting knob 5.3.2 is arranged above the heading shaft damping adjusting knob 5.3.1, and the pitching shaft damping adjusting knob 5.3.2 is connected with the crab clamp holder 5.3.3;

[0065] The paper-based bearing platform module 5.4 comprises a fixed base 5.4.1 and a precision moving platform 5.4.2; wherein the precision moving platform comprises a Y-axis stepping knob 5.4.2.1, an X-axis stepping knob 5.4.2.2 and a paper-based chip fixing clamp 5.4.2.3;

[0066] The size of the base module 5.1 is 230mm in length and 38mm in width; the X-axis direction of the base module 5.1 is the long side of the base module 5.1, and the Y-axis direction of the base module 5.1 is the width side of the base module 5.1; the X-axis displacement stroke range of the base module 5.1 is 0-200mm;

[0067] The heading shaft damping adjusting knob 5.3.1 can be adjusted in a 0-360° heading angle; the pitching shaft damping adjusting knob 5.3.2 can be adjusted in a 0-180° pitching angle; and the crab clamp holder 5.3.3 can be clamped in a range of 5-57mm;

[0068] The precision moving platform 5.4.2 can be moved in Y-axis and X-axis directions through the Y-axis stepping knob 5.4.2.1 and the X-axis stepping knob 5.4.2.2, and the displacement accuracy and stroke range of the precision moving platform are both 1mm; the Y-axis direction of the precision moving platform is the Y-axis direction of the base module, and the X-axis direction of the precision moving platform is the X-axis direction of the base module;

[0069] The aptamer solution used in the application is commercially available, and is purchased from Shengong Bioengineering (Shanghai) Co., Ltd.; the specific steps are shown in the examples;

[0070] Example 1:

[0071] Step one, preparation of oil-soluble upconversion nanomaterials: 236.6 mg of yttrium chloride hexahydrate, 77.6 mg of ytterbium chloride hexahydrate, and 7.6 mg of erbium chloride hexahydrate were accurately weighed and ultrasonically dispersed in 10 mL of methanol solvent. After adding 4.0 mL of oleic acid and 9.0 mL of 1-octadecene, the mixture was magnetically stirred at 160°C for 30 min under an argon atmosphere to obtain a transparent solution. After cooling to room temperature, a mixed solution containing 50 mg of sodium hydroxide and 74.1 mg of ammonium fluoride dissolved in 10 mL of methanol was added dropwise. Then, the mixture was magnetically stirred at 300°C for 1 h. After cooling to room temperature, the upconversion nanoparticles were separated by centrifugation at 6000 rpm for 5 min. The nanoparticles were washed three times with a mixture of ultrapure water and ethanol (1:3 by volume), and dried to obtain pure oleic acid-coated upconversion nanoparticles.

[0072] Figure 2 A is a transmission electron micrograph of oil-soluble upconversion nanoparticles. It can be seen that the prepared oil-soluble upconversion nanoparticles have good crystalline form and dispersibility.

[0073] Step two, preparation of water-soluble upconversion nanomaterials: 20 mg of the oleic acid-coated upconversion nanoparticles were dispersed in 0.5 mL of hydrochloric acid solution (concentration of 0.1 mol / L) and ultrasonically treated. After the treatment, 60 mL of ethanol was added and ultrasonically dispersed. Then, 10 mL of ultrapure water and 2.5 mL of ammonia water were added and stirred uniformly at 65°C. After stirring uniformly, 20 uL of tetraethyl orthosilicate was added and reacted for 4 h. Then, 50 uL of 3-aminopropyltriethoxysilane was added and reacted for 1 h. After the reaction, the obtained solution was centrifuged at 6000 rpm / min for 5 min. The obtained product was washed with ultrapure water, and then dispersed in ultrapure water to obtain a water-soluble upconversion nanomaterial solution with a concentration of 2 mg / mL.

[0074] Figure 2 B is a transmission electron micrograph of water-soluble upconversion nanoparticles. It can be seen that the prepared water-soluble upconversion nanoparticles have a silica shell modified with amino groups, indicating that the nanoparticles have been successfully surface-modified for water solubility.

[0075] Step three, preparation of upconversion fluorescent probes:

[0076] (1) The upconversion nanomaterial solution prepared in step two (volume 1.0 mL) was mixed with a glutaraldehyde aqueous solution (volume 1.0 mL) to activate the amino group; the activated upconversion nanomaterial was separated and dispersed in 5.0 mL of a phosphate buffer, and then 50 uL of an enrofloxacin aptamer solution (concentration 0.1 mmol / L, sequence: 5'-CCCATCAGGGGGCTAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTCAGGGG GA-3') was added, and incubation was carried out at 37°C for 2 h, the incubation being carried out on a shaking bed at a rotation speed of 180 rpm / min; after incubation, centrifugation was carried out at 6000 rpm for 5 min, and the obtained precipitate was washed with ultrapure water and then centrifuged again (rotation speed 6000 rpm, time 5 min), and after drying, 1.0 mg of the upconversion nanomaterial modified with the enrofloxacin aptamer was obtained, which was finally added to a phosphate buffer containing graphene oxide (volume 5 mL, concentration 0.2 mg / mL), and incubation was carried out at 37°C for 0.5 h, the incubation being carried out on a shaking bed at a rotation speed of 180 rpm / min, to obtain the upconversion fluorescent probe A solution, the concentration being 0.5 mg / mL;

[0077] (2) The operation of step (1) was repeated, except that the enrofloxacin aptamer solution was replaced by a ciprofloxacin aptamer solution (concentration 0.1 mmol / L, sequence: 5'-ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTAC TAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG-3'), and the remaining operations were the same, and finally the upconversion fluorescent probe solution B was obtained.

[0078] Figure 3 A is the Zeta potential change before and after the sequence of the aptamer modified on the nanomaterial, and it can be seen that after the sequence of the aptamer with negative potential is connected, the Zeta potential of the upconversion nanoparticle with positive potential changes to negative potential, and there is a large decrease, indicating the successful connection of the sequence of the aptamer.

[0079] Figure 3 B is the ultraviolet absorption spectrum before and after the sequence of the aptamer modified on the nanomaterial, and it can be seen that after the sequence of the aptamer is connected, the upconversion nanoparticle appears a strong ultraviolet absorption peak at 270 nm, corresponding to the ultraviolet absorption of the sequence of the aptamer, further indicating the successful connection of the sequence of the aptamer.

[0080] Step four, preparation of a multi-channel paper-based microfluidic chip:

[0081] Cut Whatman No. 1 chromatography filter paper (20 mm x 30 mm), use a laser printer to print patterns on the filter paper, after printing, place the filter paper in a forced air drying oven for heat curing treatment at 200°C for 3h, the printer ink is cured into the chromatography paper fiber pores, forming a solution that cannot flow hydrophobic barrier zone 4.1; In the hydrophobic barrier zone 4.1 area, a microfluidic detection area is surrounded by ink; The microfluidic detection area is composed of detection area one 4.2, detection area two 4.6, sample addition area 4.4, flow channel one 4.3 and flow channel two 4.5, the detection area one 4.2 and the detection area two 4.6 are respectively arranged on both sides of the sample addition area 4.4 and are connected through the flow channel one 4.3 and the flow channel two 4.5; The microfluidic detection area is inside the hydrophobic barrier zone 4.1, which is a hydrophilic flow area; Both of them constitute a multi-channel paper-based microfluidic chip;

[0082] Figure 4 It is a structural schematic diagram of a multi-channel paper-based microfluidic chip, wherein A is a structural diagram of the chip; B is a size distribution diagram of the chip; the reference signs: hydrophobic barrier zone 4.1, detection area one 4.2, flow channel one 4.3, sample addition area 4.4, flow channel two 4.5, detection area two 4.6.

[0083] Step five, detection of enrofloxacin and ciprofloxacin content in food:

[0084] (1) First, the upconversion fluorescent probe solution A and the upconversion fluorescent probe solution B prepared in step three are respectively added to the detection area one 4.2 and the detection area two 4.6 of the multi-channel paper-based microfluidic chip; The amount of the upconversion fluorescent probe solution A and the upconversion fluorescent probe solution B is 5uL;

[0085] (2.1) First, prepare a mixed solution containing enrofloxacin and ciprofloxacin, wherein the concentrations of enrofloxacin and ciprofloxacin are 1.0x10 ng / mL and 1.0x10 ng / mL respectively; The mixed solution is added to the sample addition area 4.4 of the multi-channel paper-based microfluidic chip obtained in step four, under the action of capillary driving force, it reaches the detection area one 4.2 and the detection area two 4.6 through the flow channel one 4.3 and the flow channel two 4.5, incubate at room temperature for 15min, so that enrofloxacin and ciprofloxacin fully react with the upconversion fluorescent probe, to obtain a multi-channel paper-based microfluidic chip with a first detection concentration;

[0086] (2.2) The operation is the same as step (2.1), except that the concentrations of enrofloxacin and ciprofloxacin are adjusted to 1.0x10 2 ng / mL and 1.0x10 2 ng / mL respectively, and the rest of the operations are the same, finally obtaining a multi-channel paper-based microfluidic chip with a second detection concentration;

[0087] (2.3) The operation of step (2.1) is synchronized, and the only difference is that the concentration of enrofloxacin and ciprofloxacin is adjusted to 1.0 x 10 3 ng / mL, 1.0 x 10 3 ng / mL, and the rest of the operations are the same, and finally the multi-channel paper-based microfluidic chip to be detected at concentration three is obtained;

[0088] (2.4) The operation of step (2.1) is synchronized, and the only difference is that the concentration of enrofloxacin and ciprofloxacin is adjusted to 1.0 x 10 4 ng / mL, 1.0 x 10 4 ng / mL, and the rest of the operations are the same, and finally the multi-channel paper-based microfluidic chip to be detected at concentration four is obtained;

[0089] (2.5) The operation of step (2.1) is synchronized, and the only difference is that the concentration of enrofloxacin and ciprofloxacin is adjusted to 1.0 x 10 5 ng / mL, 1.0 x 10 5 ng / mL, and the rest of the operations are the same, and finally the multi-channel paper-based microfluidic chip to be detected at concentration five is obtained;

[0090] (2.6) The operation of step (2.1) is synchronized, and the only difference is that the concentration of enrofloxacin and ciprofloxacin is adjusted to 1.0 x 10 6 ng / mL, 1.0 x 10 6 ng / mL, and the rest of the operations are the same, and finally the multi-channel paper-based microfluidic chip to be detected at concentration six is obtained;

[0091] (2.7) The operation of step (2.1) is synchronized, and the only difference is that the concentration of enrofloxacin and ciprofloxacin is adjusted to 1.0 x 10 7 ng / mL, 1.0 x 10 7 ng / mL, and the rest of the operations are the same, and finally the multi-channel paper-based microfluidic chip to be detected at concentration seven is obtained;

[0092] (2.8) Linear fitting is performed with the enrofloxacin concentration and the fluorescence intensity of detection area one 4.2 to establish a standard curve for the detection of enrofloxacin content; linear fitting is performed with the ciprofloxacin concentration and the fluorescence intensity of detection area two 4.6 to establish a standard curve for the detection of ciprofloxacin content;

[0093] Wherein, the step of determining the fluorescence intensity signal characteristic value of the detection solution is: the fluorescence intensity value at 654 nm under 980 nm excitation light excitation is the fluorescence intensity signal characteristic value of the detection solution; the determination method is as follows:

[0094] Place the multi-channel paper-based microfluidic chip to be detected on the precision moving platform 5.4.2 of the detection device, fix it using the paper-based chip fixing clamp 5.4.2.3, adjust the X-axis distance of the two-axis displacement fixing module 5.2 on the base module 5.1 to 100 mm, adjust the pitch angle of the clamping module 5.3 to 45°, so that the laser of the laser emitter is aligned with the center of the detection area one 4.2 and the fluorescence intensity is measured; then, adjust the X-axis step knob 5.4.2.2 of the precision moving platform 5.4.2 to make the paper-based chip displace in the X-axis direction by 12 mm, so that the laser of the laser emitter is aligned with the center of the detection area two 4.6 and the fluorescence intensity is measured.

[0095] Figure 6 The standard curve for fluorescence detection of different concentrations of enrofloxacin and ciprofloxacin is established; from Figure 6 A and Figure 6 B can be seen that, with the increase of enrofloxacin concentration, the fluorescence intensity at 654 nm gradually increases, which shows a positive correlation between enrofloxacin concentration and increased fluorescence intensity; a good linear regression equation y=1128.30x+1127.78 is obtained by linear fitting, the correlation coefficient R 2 is 0.9930, the range is 1.0×10 ng / mL-1.0×10 5 ng / mL, the detection limit is 1.84 ng / mL, which can meet the requirements of enrofloxacin detection. Wherein, y represents the up-conversion fluorescence intensity at 654 nm and x represents the logarithmic concentration of enrofloxacin. From Figure 6 C and Figure 6 D can be seen that, with the increase of ciprofloxacin concentration, the fluorescence intensity at 654 nm gradually increases, which shows a positive correlation between ciprofloxacin concentration and increased fluorescence intensity; a good linear regression equation y=1089.64x+964.66 is obtained by linear fitting, the correlation coefficient R 2 is 0.9955, the range is 1.0×10 ng / mL-1.0×10 5 ng / mL, the detection limit is 2.22 ng / mL, which can meet the requirements of ciprofloxacin detection. Wherein, y represents the up-conversion fluorescence intensity at 654 nm and x represents the logarithmic concentration of ciprofloxacin.

[0096] (3) Detection of actual samples:

[0097] First, the prawns are pretreated: weigh 2 g of prawn sample, then add 2 mL of enrofloxacin solution with a concentration of 5×10 2 , 1×10 3The enrofloxacin and ciprofloxacin standard solution of 10 ng / mL was added to the shrimp sample. After homogenization, 6 mL of acetonitrile-acetone mixed solution was added, and centrifuged at 4000 rpm for 10 min; 3 mL of supernatant was heated in a rotary evaporator at 80°C to evaporate acetonitrile. Finally, the dried residue was dissolved in 2 mL of phosphate buffer to prepare the test solution. 20 uL of the test solution was added to the sample addition area 4.4, and after incubation at room temperature for 15 min, the fluorescence intensity signal values of detection area 4.2 and detection area 4.6 on the multi-channel paper-based microfluidic chip were detected, and the standard curve obtained in step five (2) was brought in to calculate the recovery result. The specific results are shown in Table 1:

[0098] Table 1: Standard addition detection results of enrofloxacin and ciprofloxacin hazards in shrimp samples

[0099]

[0100] RSD: relative standard deviation

[0101] Detection amount of hazards in shrimp: X = (c x V x 1000) / (m x 1000)

[0102] In the formula:

[0103] X: detection amount of hazards in shrimp, unit: micrograms per kilogram (μg / kg)

[0104] c: detection concentration of hazards, unit: nanograms per milliliter (ng / mL)

[0105] V: sample constant volume, unit: milliliter (mL)

[0106] m: mass of shrimp weighed, unit: grams (g)

[0107] Example 2:

[0108] Step one, preparation of oil-soluble upconversion nanomaterial: accurately weigh 236.6 mg of yttrium chloride hexahydrate, 77.6 mg of ytterbium chloride hexahydrate, and 7.6 mg of erbium chloride hexahydrate, and ultrasonically disperse them in 10 mL of methanol solvent. After adding 4.0 mL of oleic acid and 9.0 mL of 1-octadecene, a transparent solution was obtained under magnetic stirring at 160°C for 25 min in an argon environment. After cooling to room temperature, a mixed solution containing 50 mg of sodium hydroxide and 74.1 mg of ammonium fluoride dissolved in 10 mL of methanol was added dropwise. Then, magnetic stirring was carried out at 300°C for 1.5 h. After cooling to room temperature, the upconversion nanoparticle precipitate was separated by centrifugation at 8000 rpm for 8 min, and then washed three times with a mixed solution of ultrapure water and ethanol in a volume ratio of 1:3. After drying, pure oleic acid-coated upconversion nanoparticles were obtained.

[0109] Step two, preparation of water-soluble upconversion nanomaterials: 20 mg of oleic acid-coated upconversion nanoparticles were dispersed in 0.5 mL of hydrochloric acid solution (concentration of 0.1 mol / L) and ultrasonically treated; after the treatment, 60 mL of ethanol was added and ultrasonically dispersed, followed by the addition of 10 mL of ultrapure water and 2.5 mL of ammonia water, and stirring was uniformly carried out at 65°C; after uniform stirring, 20 uL of tetraethyl orthosilicate was added and reacted for 4 h, and then 50 uL of 3-aminopropyltriethoxysilane was added and reacted for 1 h; after the reaction was completed, the obtained solution was centrifuged at 8000 rpm / min for 8 min, and the obtained product was washed with ultrapure water, dispersed in ultrapure water after washing, and a water-soluble upconversion nanomaterial solution with a concentration of 2 mg / mL was obtained.

[0110] Step three, preparation of upconversion fluorescent probes:

[0111] (1) The upconversion nanomaterial solution prepared in step two (volume 1.0 mL) was mixed with a glutaraldehyde aqueous solution (volume 1.0 mL) to activate the amino group; the activated upconversion nanomaterial was separated and dispersed in 5.0 mL of a phosphate buffer, and then 50 uL of a diarrheal Escherichia coli aptamer solution (concentration of 0.1 mmol / L, sequence: 5'-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG-3') was added, and incubation was carried out at 37°C for 2 h, the incubation was carried out on a shaking bed, the rotation speed of the shaking bed was 180 rpm / min, after the incubation, centrifugation was carried out at 6000 rpm for 5 min, the obtained precipitate was washed with ultrapure water and then centrifuged again (rotation speed of 6000 rpm, time of 5 min), after drying, 1.0 mg of upconversion nanomaterials modified with enrofloxacin aptamer was obtained, and finally, a phosphate buffer containing graphene oxide was added (volume of 5 mL, concentration of 0.2 mg / mL), and incubation was carried out at 37°C for 0.5 h, the incubation was carried out on a shaking bed, the rotation speed of the shaking bed was 180 rpm / min, and an upconversion fluorescent probe A solution with a concentration of 0.5 mg / mL was obtained;

[0112] (2) The operation in step (1) was synchronously carried out, and the only difference was that the diarrheal Escherichia coli was replaced by a Staphylococcus aureus aptamer solution (concentration of 0.1 mmol / L, sequence: 5'-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-3'), and the remaining operations were the same, and finally, an upconversion fluorescent probe solution B was obtained;

[0113] Step four, preparation of multi-channel paper-based microfluidic chip: cut Whatman No. 1 chromatographic filter paper (20 mm x 30 mm), use a laser printer to perform pattern printing on the filter paper, after printing, place the filter paper in a forced air drying oven for heat curing treatment at 200°C for 3h, the printer ink is cured into the chromatographic paper fiber pores to form a solution that cannot flow hydrophobic barrier zone 4.1; within the hydrophobic barrier zone 4.1, a microfluidic detection area is surrounded by ink; the microfluidic detection area is composed of detection area one 4.2, detection area two 4.6, sample addition area 4.4, flow channel one 4.3 and flow channel two 4.5; the detection area one 4.2 and the detection area two 4.6 are respectively arranged on both sides of the sample addition area 4.4 and are connected through the flow channel one 4.3 and the flow channel two 4.5; the microfluidic detection area is inside the hydrophobic barrier zone 4.1 and is a hydrophilic flow area; the two constitute a multi-channel paper-based microfluidic chip;

[0114] Step five, detection of the content of diarrheal Escherichia coli and Staphylococcus aureus in food:

[0115] (1) First, the upconversion fluorescent probe solution A and the upconversion fluorescent probe solution B prepared in step three are respectively added to the detection area one and the detection area two of the microfluidic paper substrate; the amount of the upconversion fluorescent probe solution A and the upconversion fluorescent probe solution B is 5uL.

[0116] (2) Establishment of standard curve:

[0117] (2.1) First, a mixed solution containing diarrheal Escherichia coli and Staphylococcus aureus is prepared, wherein the concentrations of the diarrheal Escherichia coli and the Staphylococcus aureus are 1.0x10 CFU / mL and 4.5x10 CFU / mL respectively, and the mixed solution is added to the sample addition area 4.4 of the multi-channel paper-based microfluidic chip obtained in step four, and under the action of capillary driving force, the mixed solution reaches the detection area one 4.2 and the detection area two 4.6 through the flow channel one 4.3 and the flow channel two 4.5, and incubation is carried out at room temperature for 15min, so that the diarrheal Escherichia coli and the Staphylococcus aureus fully react with the upconversion fluorescent probe, and a multi-channel paper-based microfluidic chip with a first detection concentration is obtained;

[0118] (2.2) The operation is the same as step (2.1), except that the concentrations of the diarrheal Escherichia coli and the Staphylococcus aureus are adjusted to 1.0x10 2 CFU / mL and 4.5x10 2 CFU / mL respectively, and the rest of the operations are the same, finally obtaining a multi-channel paper-based microfluidic chip with a second detection concentration;

[0119] (2.3) The operation is the same as step (2.1), except that the concentrations of the diarrheal Escherichia coli and the Staphylococcus aureus are adjusted to 1.0x10 3CFU / mL, 4.5 x 10 3 CFU / mL, the rest of the operation is the same, ultimately get the concentration of three to be tested multichannel paper-based microfluidic chip;

[0120] (2.4) the operation of step (2.1), the difference is only the concentration of diarrheal Escherichia coli, Staphylococcus aureus adjusted to 1.0 x 10 4 CFU / mL, 4.5 x 10 4 CFU / mL, the rest of the operation is the same, ultimately get the concentration of four to be tested multichannel paper-based microfluidic chip;

[0121] (2.5) the operation of step (2.1), the difference is only the concentration of diarrheal Escherichia coli, Staphylococcus aureus adjusted to 1.0 x 10 5 CFU / mL, 4.5 x 10 5 CFU / mL, the rest of the operation is the same, ultimately get the concentration of five to be tested multichannel paper-based microfluidic chip;

[0122] (2.6) the operation of step (2.1), the difference is only the concentration of diarrheal Escherichia coli, Staphylococcus aureus adjusted to 1.0 x 10 6 CFU / mL, 4.5 x 10 6 CFU / mL, the rest of the operation is the same, ultimately get the concentration of six to be tested multichannel paper-based microfluidic chip;

[0123] (2.7) the operation of step (2.1), the difference is only the concentration of diarrheal Escherichia coli, Staphylococcus aureus adjusted to 1.0 x 10 7 CFU / mL, 4.5 x 10 7 CFU / mL, the rest of the operation is the same, ultimately get the concentration of seven to be tested multichannel paper-based microfluidic chip;

[0124] (2.8) with the concentration of diarrheal Escherichia coli and detection area 4.2 fluorescence intensity linear fitting, the establishment of diarrheal Escherichia coli content detection standard curve; with the concentration of Staphylococcus aureus and detection area 4.6 fluorescence intensity linear fitting, the establishment of Staphylococcus aureus content detection standard curve;

[0125] Wherein, the step of determining the fluorescence intensity signal characteristic value of the detection solution is: under the excitation of 980nm excitation light, the fluorescence intensity value at 654nm is the fluorescence intensity signal characteristic value of the detection solution; The determination method is as follows:

[0126] Place the multi-channel paper-based microfluidic chip to be detected on the precision moving platform 5.4.2 of the detection device, fix it using the paper-based chip fixing clamp 5.4.2.3, adjust the X-axis distance of the two-axis displacement fixing module 5.2 on the base module 5.1 to 100 mm, adjust the pitch angle of the clamping module 5.3 to 45°, so that the laser of the laser emitter is aligned with the center of the detection area one 4.2 and the fluorescence intensity is measured; then, adjust the X-axis step knob 5.4.2.2 of the precision moving platform 5.4.2 to make the paper-based chip displace 12 mm in the X-axis direction, so that the laser of the laser emitter is aligned with the center of the detection area two 4.6 and the fluorescence intensity is measured.

[0127] Figure 7 The standard curve is established for fluorescence detection of different concentrations of diarrheal E. coli and Staphylococcus aureus; from Figure 7 A and Figure 7 B can be seen, with the increase of the concentration of diarrheal E. coli, the fluorescence intensity at 654 nm gradually increases, which shows a positive correlation between the concentration of diarrheal E. coli and the increased fluorescence intensity; a good linear regression equation y = 734.0x + 1677.4 is obtained by linear fitting, the correlation coefficient R 2 is 0.9904, the range is 1.0x10 CFU / mL-1.0x10 7 CFU / mL, the detection limit is 3.80 CFU / mL, which can meet the requirements of detection of diarrheal E. coli. Wherein, y represents the upconversion fluorescence intensity at 654 nm and x represents the logarithmic concentration of diarrheal E. coli. From Figure 7 C and Figure 7 D can be seen, with the increase of the concentration of Staphylococcus aureus, the fluorescence intensity at 654 nm gradually increases, which shows a positive correlation between the concentration of Staphylococcus aureus and the increased fluorescence intensity; a good linear regression equation y = 890.6x + 572.8 is obtained by linear fitting, the correlation coefficient R 2 is 0.9894, the range is 4.5x10 CFU / mL-4.5x10 7 CFU / mL, the detection limit is 4.90 CFU / mL, which can meet the requirements of detection of Staphylococcus aureus. Wherein, y represents the upconversion fluorescence intensity at 654 nm and x represents the logarithmic concentration of Staphylococcus aureus.

[0128] (3) Detection of actual samples:

[0129] Firstly, the pork was pretreated: 25 g of fresh pork sample was washed with sterile normal saline for three times, and then placed in a biological safety cabinet, and irradiated with a 30 W ultraviolet lamp for 15 min to eliminate the potential interference of the sample itself on the detection of diarrheal E. coli and S. aureus. Then 1 mL of standard solution of diarrheal E. coli and S. aureus with concentrations of 1.25 x 10 4 , 2.50 x 10 4 and 2.50 x 10 5 CFU / mL was added to the pork sample, and incubated for 10 min to simulate the natural growth state of diarrheal E. coli and S. aureus in the sample. Then, the above pork sample after spiking was added to 225 mL of sterile normal saline, and homogenized for 3 min to prepare the test solution. 20 uL of the test solution was added to the sample addition area 4.4, and after incubation at room temperature for 15 min, the fluorescence intensity signal values of detection area one 4.2 and detection area two 4.6 on the multi-channel paper-based microfluidic chip were detected, and the standard curve obtained in step five (2) was brought in to calculate the spiking recovery result. The specific results are shown in Table 2:

[0130] Table 2: Spiking detection results of diarrheal E. coli and S. aureus hazards in pork samples

[0131]

[0132] RSD: relative standard deviation

[0133] Detection amount of hazards in pork: X = (c x V) / m

[0134] In the formula:

[0135] X: detection amount of hazards in pork, unit: colony forming units per gram (CFU / g)

[0136] c: detection concentration of hazards, unit: colony forming units per milliliter (CFU / mL)

[0137] V: sample constant volume, unit: milliliter (mL)

[0138] m: mass of pork, unit: gram (g)

[0139] Specificity of detection method:

[0140] In order to evaluate the specificity of the constructed multi-channel paper-based microfluidic chip for detecting diarrheal E. coli and S. aureus, the present application selected some other common foodborne pathogenic bacteria, including Bacillus cereus, Salmonella and Pseudomonas aeruginosa as interference pathogenic bacteria, and further studied the fluorescence characteristics of the multi-channel paper-based microfluidic chip.

[0141] Comparative Example 2:

[0142] The method is the same as that in Example 2; except that the sample solution to be tested in step (3) is replaced with blank solution, B. cereus (1.0 x 10 7 CFU / mL), Salmonella (1.0 x 10 7 CFU / mL), P. aeruginosa (1.0 x 10 7 CFU / mL), diarrheal E. coli (1.0 x 10 7 CFU / mL), and S. aureus (1.0 x 10 7 CFU / mL) in turn, and detected respectively. Among them, the fluorescence response of blank solution, B. cereus, Salmonella, and P. aeruginosa is the average of the fluorescence intensity of two detection zones, the fluorescence response of diarrheal E. coli is the fluorescence intensity of detection zone 4.2, and the fluorescence response of S. aureus is the fluorescence intensity of detection zone 2 4.6.

[0143] The results are shown in Table 1. Figure 8 As shown in Table 1, the fluorescence response efficiency of the prepared sensor to diarrheal E. coli and S. aureus is obviously higher than that of other common foodborne pathogens, and the results show that the constructed multi-channel paper-based microfluidic chip has good specificity.

[0144] Description: The above examples are only used to illustrate the present application and not to limit the technical solutions described in the present application; therefore, although the present application has been described in detail with reference to the above-mentioned embodiments, those of ordinary skill in the art should understand that the present application can still be modified or replaced equivalently; and all technical solutions and improvements that do not deviate from the spirit and scope of the present application should be covered within the scope of the claims of the present application.

Claims

1. A method for preparing a multi-channel paper-based microfluidic chip, characterized in that, Comprising the following steps: Step one, preparation of oil-soluble upconversion nanomaterial: YCl3·6H2O, YbCl3·6H2O and ErCl3·6H2O are added to a certain volume of methanol A and ultrasonically dissolved, then oleic acid and 1-octadecene are added and mixed thoroughly, and first heating and stirring is carried out under closed conditions, and after stirring, it is cooled to room temperature; the closed condition is removed, then methanol B containing NaOH and NH4F is added dropwise, and second heating and stirring is carried out under closed conditions, and after stirring, it is cooled to room temperature, and the precipitate is separated by centrifugation, and a mixture of ultrapure water and ethanol is used for cleaning, and after drying, the oleic acid-coated upconversion nanomaterial is obtained and reserved for use; Step two, preparation of water-soluble upconversion nanomaterial: the oleic acid-coated upconversion nanoparticles prepared in step one are weighed and dispersed in a hydrochloric acid solution and ultrasonically treated; after the treatment is completed, ethanol is added and ultrasonically dispersed uniformly, then ultrapure water and ammonia water are added and stirred uniformly under certain temperature conditions; after uniform stirring, tetraethyl orthosilicate is added for first reaction, and 3-aminopropyltriethoxysilane is added for second reaction; after the reaction is completed, centrifugal separation is carried out, and the obtained product is cleaned with ultrapure water, dispersed in ultrapure water after cleaning, and the water-soluble upconversion nanomaterial is obtained; Step three, preparation of upconversion fluorescent probe: (1) The water-soluble upconversion nanomaterial prepared in step two is mixed with glutaraldehyde aqueous solution for reaction to activate the amino group; the activated upconversion nanomaterial is separated and dispersed in a phosphate buffer solution, then a food hazard A aptamer solution is added, first constant-temperature incubation is carried out, after incubation, centrifugal separation is carried out, the obtained precipitate is cleaned with ultrapure water and then centrifuged again, dried, and the upconversion nanomaterial modified with food hazard A aptamer is obtained, finally a phosphate buffer solution containing graphene oxide is added, second constant-temperature incubation is carried out, and a mixed solution is obtained, which is denoted as upconversion fluorescent probe solution A; The amount ratio of the water-soluble upconversion nanomaterial, glutaraldehyde aqueous solution, phosphate buffer solution, food hazard A aptamer solution, upconversion nanomaterial modified with food hazard A aptamer, and phosphate buffer solution containing graphene oxide is 1.0 mL:1.0 mL:5.0 mL:50 uL:1.0 mg:2.0 mL; the concentration of the phosphate buffer solution containing graphene oxide is 0.2 mg / mL; The concentration of the food hazard A aptamer solution is 0.1 mmol / L; the concentration of the upconversion fluorescent probe solution A is 0.5 mg / mL; (2) The operation in step (1) is repeated, except that the food hazard A aptamer solution is replaced by a food hazard B aptamer solution, and the rest of the operations are the same, and finally the upconversion fluorescent probe solution B is obtained; the concentration of the upconversion fluorescent probe solution B is 0.5 mg / mL; Step four, preparation of multi-channel paper-based microfluidic chip: Cut filter paper, use laser printer to print patterns on the filter paper, after printing, heat the filter paper for curing, the printer ink is cured into the pores of the chromatography paper fibers, forming a hydrophobic barrier area where the solution cannot flow; in the hydrophobic barrier area, a microfluidic detection area is formed by the ink; the microfluidic detection area is composed of a detection area one, a detection area two, a sample addition area and a flow channel; the detection area one and the detection area two are respectively arranged on the two sides of the sample addition area and are connected through the flow channel; the microfluidic detection area is inside the hydrophobic barrier area and is a hydrophilic flow area; the two form a multi-channel paper-based microfluidic chip.

2. The method according to claim 1, wherein The amount of yttrium chloride hexahydrate, ytterbium chloride hexahydrate, erbium chloride hexahydrate, methanol A, oleic acid, 1-octadecene, sodium hydroxide, ammonium fluoride and methanol B in step one is in the ratio of 236.6 mg:77.6 mg:7.6 mg:10 mL:4.0 mL:9.0 mL:50.0 mg:74.1 mg:10 mL; a mixture of cyclohexane and ethanol is used for cleaning, and the volume ratio of cyclohexane to ethanol is 1:3; The first heating and stirring time is 20-30 min, and the heating temperature is 160 DEG C; the second heating and stirring temperature is 295-305 DEG C, and the stirring time is 1.0-1.5 h; the centrifugal separation condition is: the rotation speed is 6000-8000 rpm / min, and the time is 5-8 min.

3. The method according to claim 1, wherein In step two, the ratio of the oleic acid coated upconversion nanoparticles, hydrochloric acid solution, ethanol, ultrapure water, ammonia water, tetraethyl orthosilicate and 3-aminopropyl triethoxysilane is 20 mg:0.5 mL:60 mL:10 mL:2.5 mL:20 uL:50 uL; the first reaction time is 4-6 h, and the second reaction time is 1-2 h; the concentration of the hydrochloric acid solution is 0.1 mol / L; the certain temperature condition is 65 DEG C; the centrifugal separation condition is: the rotation speed is 6000-8000 rpm / min, and the time is 5-8 min; the concentration of the water-soluble upconversion nanomaterial is 2 mg / mL.

4. The method according to claim 1, wherein, In step three, the reaction time of the amino group activation reaction is 2 h; the first constant temperature incubation is carried out on a shaking bed, the temperature is 37 DEG C, the time is 2 h, and the rotation speed of the shaking bed is 180-200 rpm / min; the second constant temperature incubation is carried out on a shaking bed, the temperature is 37 DEG C, the time is 0.5 h, and the rotation speed of the shaking bed is 180-200 rpm / min; the centrifugal separation conditions are: the rotation speed is 6000-8000 rpm / min, and the time is 5-10 min; The aptamer in the food hazard A aptamer solution or the food hazard B aptamer solution is not limited to a certain food hazard corresponding sequence, and the corresponding aptamer sequence is matched according to the detection target food hazard, wherein the food hazard A or the food hazard B includes enrofloxacin, ciprofloxacin, enterotoxigenic escherichia coli or staphylococcus aureus.

5. The method according to claim 1, wherein In step four, the filter paper is Whatman No. 1 chromatographic filter, with a size of 20*30 mm; the detection area one, the detection area two and the sample adding area are all circular areas with a diameter of 3 mm; the flow channel is divided into flow channel one and flow channel two, both with a length of 3 mm and a width of 1 mm; The temperature of the heat curing treatment is 200 ℃, and the curing time is 3 h.

6. Use of the multi-channel paper-based microfluidic chip prepared according to the method of any one of claims 1-5 for food hazard detection, characterized in that, The steps are as follows: (1) Firstly, the upconversion fluorescent probe solution A and the upconversion fluorescent probe solution B prepared in step three are respectively added dropwise to the detection area one and the detection area two of the multi-channel paper-based microfluidic chip; (2) Establishment of standard curve: (2.1) Firstly, a mixed solution containing a certain concentration of food hazards A and food hazards B is prepared, and is added dropwise to the sample adding area of the multi-channel paper-based microfluidic chip obtained in step four, and under the action of capillary driving force, reaches the detection area one and the detection area two through the flow channel, and incubates at room temperature, so that the food hazards A and the food hazards B react with the corresponding upconversion fluorescent probe solution, and then the fluorescence intensity of the detection area one and the detection area two is detected; (2.2) The operation of step (2.1) is repeated, except that the concentration of the mixed solution containing food hazards A and food hazards B is changed in gradient, and the rest of the operation is the same, and finally the corresponding fluorescence intensity under different concentration conditions is obtained; the concentration of food hazards A and the fluorescence intensity of detection area one are linearly fitted to establish the standard curve for detecting the content of food hazards A; the concentration of food hazards B and the fluorescence intensity of detection area two are linearly fitted to establish the standard curve for detecting the content of food hazards B; (3) Detection of actual sample: the actual sample is pretreated to obtain a test solution containing food hazards; after incubation at room temperature, the fluorescence intensity of the detection area one is measured, and the content of food hazards A in the actual sample is calculated by using the standard curve for detecting the content of food hazards A obtained in step five; the fluorescence intensity of the detection area two is measured, and the content of food hazards B in the actual sample is calculated by using the standard curve for detecting the content of food hazards B obtained in step five.

7. Use according to claim 6, characterized in that, The dosage relationship of the upconversion fluorescent probe solution A and the upconversion fluorescent probe solution B in step (1) is 5 uL:5 uL; In step (2.1), the dosage of the mixed standard solution of food hazards A and food hazards B is 20 uL; the incubation time at room temperature is 15 min; in step (3), the dosage of the test solution is 20 uL; the incubation time is 15 min.

8. Use according to claim 6, characterized in that, The detection of fluorescence intensity in steps (2)-(3) is based on a portable food hazards detection device of the multi-channel paper-based microfluidic chip, which is composed of a base module (5.1), an axial displacement fixing module (5.2), a laser emitter clamping module (5.3), and a paper-based bearing platform module (5.4); The base module (5.1) is horizontally installed; two ends of the base module (5.1) are marked as A and B ends, and an axis displacement fixing module (5.2) is arranged at each of the A and B ends; a clamping module (5.3) of a laser emitter is arranged above the axis displacement fixing module (5.2) at the A end, and a bearing platform module (5.4) is arranged above the axis displacement fixing module (5.2) at the B end; The axis displacement fixing module (5.2) comprises a base clamping knob (5.2.1), a quick mounting plate clamping knob (5.2.2) and a quick mounting plate (5.2.3); the base clamping knob (5.2.1) is arranged above the base module (5.1), the quick mounting plate clamping knob (5.2.2) is arranged above the base clamping knob (5.2.1), and the quick mounting plate clamping knob (5.2.2) clamps the quick mounting plate (5.2.3); The clamping module (5.3) comprises a heading axis damping adjusting knob (5.3.1), a pitching axis damping adjusting knob (5.3.2) and a crab clamp holder (5.3.3); the heading axis damping adjusting knob (5.3.1) is arranged above the axis displacement fixing module (5.2), the pitching axis damping adjusting knob (5.3.2) is arranged above the heading axis damping adjusting knob (5.3.1), and the pitching axis damping adjusting knob (5.3.2) is connected to the crab clamp holder (5.3.3); The paper-based bearing platform module (5.4) comprises a fixed base (5.4.1) and a precision moving platform (5.4.2); the precision moving platform (5.4.2) is provided with a Y-axis stepping knob (5.4.2.1), an X-axis stepping knob (5.4.2.2) and a paper-based chip fixing clamp (5.4.2.3).

9. Use according to claim 8, characterized in that, The size of the base module (5.1) is 230 mm in length and 38 mm in width; the X-axis direction of the base module (5.1) is the long side of the base module (5.1), and the Y-axis direction of the base module (5.1) is the width side of the base module (5.1); the X-axis displacement stroke range of the base module (5.1) is 0-200 mm; The heading axis damping adjusting knob (5.3.1) can be adjusted in a 0-360° heading angle; the pitching axis damping adjusting knob (5.3.2) can be adjusted in a 0-180° pitching angle; and the crab clamp holder (5.3.3) can be clamped in a range of 5-57 mm; The precision moving platform (5.4.2) can be displaced in the Y-axis direction and the X-axis direction through the Y-axis stepping knob (5.4.2.1) and the X-axis stepping knob (5.4.2.2), and the displacement accuracy and the displacement stroke are both 1 mm; the Y-axis direction of the precision moving platform is the Y-axis direction of the base module, and the X-axis direction of the precision moving platform is the X-axis direction of the base module.

10. Use according to claim 8, characterized in that, The method for detecting the fluorescence intensity by the portable food hazard detection device based on the multi-channel paper-based microfluidic chip is as follows: Place the multi-channel paper-based microfluidic chip to be detected on the precision moving platform (5.4.2) of the detection device, fix it using the paper-based chip fixing clamp (5.4.2.3), adjust the X-axis distance of the two-axis displacement fixing module (5.2) on the base module (5.1) to be 100 mm, adjust the pitch angle of the clamping module (5.3) to be 45°, so that the laser of the laser emitter is aligned with the center of the detection area one and the fluorescence intensity is measured; then, adjust the X-axis stepping knob (5.4.2.2) of the precision moving platform (5.4.2) to make the paper-based chip displace 12 mm in the X-axis direction, so that the laser of the laser emitter is aligned with the center of the detection area two and the fluorescence intensity is measured.

Citation Information

Patent Citations

  • Double-signal detection method for staphylococcus aureus in food

    CN113176243A

  • Up-conversion paper-based aptamer sensor for simultaneously detecting two mycotoxins

    CN115561214A