Molecular marker primers, kit and application for identifying rubber tree Yunyan 801983

Abstract

The present invention discloses a molecular marker primer, a kit, and applications for identifying the rubber tree Yunyan 801983. The molecular marker primer comprises an upstream primer and a downstream primer, the upstream primer being shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer being shown as SEQ ID NO: 2 in the sequence listing. The kit comprises the molecular marker primer. Applications include using the molecular marker primer to identify the rubber tree Yunyan 801983. The sequencing results of the marker are used to distinguish varieties, such as differences in one or more bases, substitutions, insertions, deletions, or duplications between different sequences, thereby enabling the identification of Yunyan 801983. Furthermore, the rubber trees Reken 525, Yunyan 3089, RRII105, Yunyan 2775, Reken 628, PR107, RRIC52, Yunyan 3117, and Reken 516 can be distinguished, allowing accurate identification of rubber tree varieties.

Description

Technical Field

[0001] The present disclosure relates to the fields of molecular biology and genetic breeding, and in particular to a molecular marker primer, a kit and applications for identifying rubber tree Yunyan 801983. Background Art

[0002] The rubber tree is a typical perennial tropical rainforest tree native to the Amazon River basin in South America, including Brazil, Venezuela, and Guyana. It was later introduced to my country and is now primarily cultivated in Hainan, Yunnan, and Guangdong. Natural rubber is produced from the coagulated and dried latex exuded during tapping. In recent years, my country's demand for natural rubber has continued to grow, widening the gap between supply and demand. According to data from the Industrial Information Network, my country's natural rubber production in 2021 was 85.1 tons, while demand was 594.9 tons, resulting in a self-sufficiency rate of only 14.30%.

[0003] Under the current international situation, supply security faces numerous challenges, and domestic production needs to play a long-term role as a "ballast." Natural rubber has unique and excellent properties in areas such as weaponry, aircraft tires, high-elasticity shock absorption, and high-altitude exploration. The natural rubber tree industry has broad prospects for future development.

[0004] Currently, traits are the primary focus of rubber tree variety identification, licensing, and breeding, and trait testing remains the industry standard for many plant variety-specific tests. However, trait expression is susceptible to environmental and human influences, and accurate identification requires several years. Rubber tree germplasm resources, important breeding materials, and varieties promoted and applied in production often exhibit the phenomenon of "same name, different species" and "same species, different names." This hinders rubber tree variety selection, licensing, rapid promotion, and intellectual property protection. In particular, uncertainty regarding rubber tree varieties in actual production severely restricts the healthy and sustainable development of the rubber industry. Impure or even incorrect rubber tree seedling varieties can severely impact the economic interests of rubber farmers. Summary of the Invention

[0005] To address the issue of inaccurate identification of the rubber tree Yunyan 801983 variety, the present disclosure provides a molecular marker primer, kit, and application for identifying the rubber tree Yunyan 801983 variety. The technical solution is as follows:

[0006] On the one hand, the present disclosure provides molecular marker primers for identifying rubber tree Yunyan 801983, wherein the molecular marker primers include an upstream primer and a downstream primer, wherein the upstream primer is shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer is shown as SEQ ID NO: 2 in the sequence listing.

[0007] On the other hand, the present disclosure provides a kit for identifying rubber tree Yunyan 801983, which includes the above-mentioned molecular marker primers.

[0008] On the other hand, the present disclosure provides an application of molecular marker primers for identifying the rubber tree Yunyan 801983 variety, the application comprising: using the molecular marker primers to identify the rubber tree Yunyan 801983, the molecular marker primers comprising an upstream primer and a downstream primer, the upstream primer being shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer being shown as SEQ ID NO: 2 in the sequence listing.

[0009] Furthermore, the application also includes: the molecular marker primers can distinguish rubber trees Reken 525, Yunyan 3089, RRII105, Yunyan 2775, Reken 628, PR107, RRIC52, Yunyan 3117 and Reken 516.

[0010] The beneficial effects of the technical solution provided by the embodiments of the present disclosure are as follows: the embodiments of the present invention provide molecular marker primers, kits and applications for identifying rubber tree Yunyan 801983. The molecular marker primers distinguish varieties through the sequencing results of amplified products, such as the presence of one or more base differences, or substitutions, or insertions, or deletions, or duplications between different sequences, thereby achieving the identification of rubber tree Yunyan 801983, and can distinguish rubber trees Reken 525, Yunyan 3089, RRII105, Yunyan 2775, Reken 628, PR107, RRIC52, Yunyan 3117 and Reken 516, and the identification results are not affected by the environment and other human factors, thereby accurately identifying rubber tree varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0012] Figure 1 This is a sequence comparison diagram named a to h provided in Example 3 of the present disclosure. DETAILED DESCRIPTION

[0013] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be described in further detail below.

[0014] Example 1

[0015] The present disclosure provides molecular marker primers for identifying rubber tree Yunyan 801983, comprising an upstream primer and a downstream primer, the upstream primer being shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer being shown in SEQ ID NO: 2 in the sequence listing. Specifically, the sequence of the upstream primer is: AATAGAGTCACTGGAGCAAGGGC, and the sequence of the downstream primer is: GGTCTCCATAATGTGTACCTCCTTT.

[0016] Example 2

[0017] The present disclosure provides a kit for identifying rubber tree Yunyan 801983, which includes the molecular marker primers provided in Example 1.

[0018] Example 3

[0019] The present disclosure provides an application of molecular marker primers for identifying the rubber tree Yunyan 801983. The application comprises: using the molecular marker primers provided in Example 1 to identify the rubber tree Yunyan 801983.

[0020] Furthermore, the application also includes: this molecular marker primer can distinguish rubber trees Reken 525, Yunyan 3089, RRII105, Yunyan 2775, Reken 628, PR107, RRIC52, Yunyan 3117 and Reken 516.

[0021] Specifically, 42 rubber tree varieties were used as samples to be tested, and the variety names are shown in Table 1.

[0022] Table 1 shows the names of the samples to be tested.

[0023]

[0024]

[0025] The DNA of the 42 test samples was extracted. In this implementation, a new plant genomic DNA extraction kit produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract the DNA of the test samples. The specific operation was carried out according to the instructions of the new plant genomic DNA extraction kit.

[0026] 42 samples to be tested were amplified using the labeled primers provided in Example 1 of the present invention. Specifically, the amplification system includes: 50ng of DNA fragments of the sample to be tested, 0.5μL 10mM dNTP (deoxy-ribonucleoside triphosphate), 0.5μL upstream primer, 0.5μL downstream primer, 2.5μL Tap Buffer, 0.2μL Taq enzyme, and ddH2O was added to make up the amplification system to 20μL. The amplification program includes: 95℃ 3min; (95℃ 30sec, 60℃ 30sec) × 30 cycles; 72℃ 6min. The amplified products were sequenced by second-generation high-throughput sequencing, and the sequencing data were aligned to the rubber tree reference genome (NCBI: PRJNA587314) using Bowtie2 software to obtain the sequencing results of each sample to be tested.

[0027] The sequencing results were analyzed using Microsoft Office Excel software, and a total of 8 different sequence types were identified. The 8 different sequence types were named a, b, c, d, e, f, g, and h, as shown in Table 2.

[0028] Table 2 shows the different sequences obtained by sequencing after amplification of 42 samples by molecular marker primers.

[0029]

[0030]

[0031] The software DNASTAR lasergene 11 was used to align 8 different sequence types. The alignment results are shown in the following table. Figure 1 As shown, in Figure 1 There are differences in 13 base positions among the 8 different sequences. Specifically, the sequence differences include: G / A at the 35th base position, T / C at the 39th base position, T / C at the 44th base position, C / T at the 72nd base position, T / C at the 86th base position, A / G at the 88th base position, A / T at the 99th base position, C / T at the 111th base position, G / A at the 128th base position, C / T at the 143rd base position, G / A at the 171st base position, C / T at the 180th base position, and A / G at the 181st base position.

[0032] Among the 42 test samples provided in this example, 10 test samples can be effectively distinguished using the primer pairs provided in this example. The different sequence combinations of the 10 test samples are shown in Table 3.

[0033] Table 3 shows the different sequence combinations of the 10 samples to be tested.

[0034] Serial number Name of the sample to be tested Sequence Combination 1 Reken 525 a 2 Yunyan 3089 abg 3 RRII105 ad 4 Yunyan 801983 ah 5 Yunyan 2775 ag 6 Reken 628 be 7 PR107 cf 8 RRIC52 e.g. 9 Yunyan 3117 fh 10 Reken 516 g

[0035] As can be seen from Table 3, the above 10 samples to be tested have different sequence combinations. It can be seen that the primers provided in Example 1 of the present invention can amplify the sequence of Yunyan 801983, and the sequence combination is ah. It can also achieve the distinction between Reken 525, Yunyan 3089, RRII105, Yunyan 2775, Reken 628, PR107, RRIC52, Yunyan 3117 and Reken 516 according to different sequence combinations.

[0036] Accuracy Analysis of Molecular Marker Primers for Identification of Rubber Trees

[0037] Three reproducibility experiments were used to perform accuracy analysis. In this embodiment, three independent experiments were performed using different personnel, different batches of reagents, and different laboratories, thereby simulating the identification of different batches of rubber trees. A high reproducibility rate means that the identification results of different laboratories can be accurately compared with each other.

[0038] A reproducibility experiment was conducted on 10 rubber tree samples: Yunyan 801983, Reken 525, Yunyan 3089, RRII105, Yunyan 2775, Reken 628, PR107, RRIC52, Yunyan 3117, and Reken 516. Each sample was repeated three times, and the sequence combination of each result was recorded. The specific results are shown in Table 4.

[0039] Table 4 shows the results of three repeated experiments.

[0040]

[0041] As shown in Table 4, the sequence combinations of 3 repeated experiments are all the same.It can be seen from this that the accuracy rate of the molecular marker primer identification provided by the embodiment of the present invention is 100%.As can be seen, the embodiment of the present invention adopts the variety identification conclusion between different batches of different laboratories or same laboratory to have higher consistency, thereby need not adopt parallel experiment to reduce experimental error, and this provides great convenience for rubber tree variety identification.

[0042] The embodiments of the present invention provide molecular marker primers, a kit, and applications for identifying the rubber tree Yunyan 801983. The molecular marker primers, a kit, and applications are used to distinguish varieties by using the sequencing results of the markers. For example, if there are differences in one or more bases, or substitutions, insertions, deletions, or duplications between different sequences, the Yunyan 801983 variety can be identified. The rubber tree Yunyan 801983 is an important variety in Yunnan Province. At the same time, the rubber trees Reken 525, Yunyan 3089, RRII105, Yunyan 2775, Reken 628, PR107, RRIC52, Yunyan 3117, and Reken 516 can be distinguished. The identification results are not affected by the environment and other human factors, thereby accurately identifying the rubber tree varieties.

[0043] The above description is merely an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the scope of protection of the present disclosure.

Claims

1. A molecular marker primer for identifying rubber tree Yunyan 801983, characterized in that, The molecular marker primers include an upstream primer and a downstream primer. The upstream primer is shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer is shown as SEQ ID NO: 2 in the sequence listing.

2. A kit for identifying rubber tree Yunyan 801983, characterized in that, The kit comprises the molecular marker primer according to claim 1.

3. An application of molecular marker primers for rubber tree Yunyan 801983 identification, characterized in that, The application includes: using molecular marker primers to identify rubber tree Yunyan 801983, the molecular marker primers include an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO: 1 in the sequence list, and the downstream primer is shown as SEQ ID NO: 2 in the sequence list.

4. The use according to claim 3, characterized in that The application also includes: the molecular marker primers can distinguish: rubber trees Reken 525, Yunyan 3089, RRII105, Yunyan 2775, Reken 628, PR107, RRIC52, Yunyan 3117 and Reken 516.

Images