An inhibitory protein allergen of mango fruit and its application

By identifying and isolating the inhibitory protein allergen subtypes in mango fruits, desensitization immune vaccines and allergen detection kits for the treatment or prevention of mango allergy are developed, which solves the problem of inefficient diagnosis of mango allergy in the prior art, improves diagnostic accuracy and sensitivity, and provides a more effective targeted immunotherapy.

CN116789776BActive Publication Date: 2025-06-27ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210255709.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-15
Publication Date
2025-06-27
Estimated Expiration
2042-03-15

AI Technical Summary

Technical Problem

In the prior art, the diagnosis efficiency of mango allergy is low, the missed diagnosis rate is high, and the lack of effective targeted immunotherapy is difficult to effectively solve the problem of food allergic diseases.

Method used

Design and construct DNA molecules encoding these allergens for the development of desensitized immune vaccines and allergen detection kits for the treatment or prevention of mango allergies by identifying and isolating inhibitor allergens in mango fruit.

Benefits of technology

It improves the diagnostic accuracy and sensitivity of mango allergy, reduces the rate of missed diagnosis, and provides a more effective targeted immunotherapy for the prevention and treatment of mango allergy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116789776B_ABST
    Figure CN116789776B_ABST
Patent Text Reader

Abstract

The present invention discloses an inhibitor protein allergen of mango fruit and its application, relating to the technical field of biotechnology. An inhibitor protein allergen of mango fruit, which is a subtype of mango inhibitor protein, has an amino acid sequence as shown in SEQ ID No.1 or SEQ ID No.2. An allergen of mango fruit in the present invention is an inhibitor protein, and this allergen can be used to prepare a desensitization vaccine for treating or preventing mango allergy, or to prepare a kit for allergen detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology, and particularly to an inhibitory protein allergen of mango fruit and its application. Background Art

[0002] Food allergic diseases are increasing worldwide, affecting 8% of adults and 6% of children. Allergen-specific immunotherapy is a treatment method developed in recent years, which induces tolerance by increasing the dose of allergen. Several clinical trials using allergen (such as peanut or hazelnut) - specific immunotherapy reported that more than 50% of the subjects responded to the treatment. However, these therapies have limitations in efficacy and are also associated with adverse reactions.

[0003] There is an increasing need to discover new food protein allergen molecules and more effective targeted immunotherapies.

[0004] Mango is one of the most important fruit crops in the world, with high yields in countries such as India, China, and Thailand. With the increase in mango consumption, the allergic problems caused by it are becoming more and more serious. Mango allergy is a rare disease, but it can cause allergic diseases, manifested as anaphylactic relaxation, angioedema, erythema, urticaria, and late - stage asthmatic dyspnea, and the late reaction is manifested as contact dermatitis and periorbital edema. Mango - induced allergies can be divided into three categories, namely, type I immediate allergic reactions mediated by IgE, type IV delayed allergic reactions mediated by immune cells, and protein contact allergies. Among them, the incidence of IgE - mediated immediate hypersensitivity reactions has been continuously increasing in recent years. At present, the efficiency of using mango extracts for in - vivo and in - vitro diagnosis of patients in clinical practice is low, the missed diagnosis rate is relatively high, and there are potential safety hazards.

[0005] The application of allergen components can greatly improve the accuracy and sensitivity of clinical diagnosis, and has become the development trend of the diagnosis of allergic diseases. However, the research on the molecular identification of mango fruit allergens lags far behind that of other fruits. So far, only two allergen molecules have been identified, namely the 14 kDa inhibitor protein and the 37 kDa glyceraldehyde-3-phosphate dehydrogenase. However, these two allergens have not been included in the International Allergen Nomenclature Committee (WHO / IUIS Allergen Nomenclature Home Page) and have not been applied to the diagnosis of mango allergy. The inhibitor protein is a highly conserved small molecule protein that is ubiquitous in plants and can cause extensive cross-reactions. So far, two subtypes of mango inhibitor protein allergens have been identified. Immunoblotting experiments show that the positive rate of this allergen in mango allergy patients is 55%, and it can cause cross-reactions between mango and birch (Song J, Zhang H, Liu Z, et al. Mango profilin: cloning, expression and cross-reactivity with birch pollen profilin Bet v2. Molecular Biology Reports, 2008, 35(2): 231-237.). There are many subtypes of inhibitor proteins, and there may be significant differences in the IgE binding ability between different subtypes. Selecting a subtype with a higher IgE binding ability for use in diagnostic reagents can improve the sensitivity and accuracy of clinical diagnosis, thereby reducing the missed diagnosis rate. Therefore, it is necessary to compare the IgE binding ability of different subtypes, screen out the allergen subtype most suitable for the development of diagnostic preparations, and explore a protein molecule with an IgE binding ability much higher than that of other mango inhibitor protein allergen subtypes. It is necessary to apply it to the development of diagnostic reagents. Summary of the Invention

[0006] To solve the deficiencies in the prior art, the present invention provides an allergen of mango fruit and its application.

[0007] The present invention provides an inhibitor protein allergen of mango fruit, which is a subtype of mango inhibitor protein, and its amino acid sequence is shown in SEQ ID No.1 or SEQ ID No.2.

[0008] The present invention also provides a DNA molecule encoding the above-mentioned inhibitor protein allergen, and its nucleotide sequence is shown in SEQ ID No.3 or SEQ ID No.4.

[0009] The present invention also provides a recombinant expression vector containing the above DNA molecule.

[0010] The present invention also provides a host organism comprising the above DNA molecule or comprising the above recombinant expression vector.

[0011] The present invention also provides the use of the above inhibitory protein allergen or the above DNA molecule in the preparation of a medicament for treating or preventing mango allergy.

[0012] The present invention also provides a medicament for treating or preventing mango allergy, comprising at least one of the above inhibitory protein allergen or the above DNA molecule.

[0013] Preferably, the medicament is a desensitization immunization vaccine.

[0014] The present invention also provides the use of the above allergen or the above DNA molecule in the preparation of a kit for allergen detection.

[0015] The present invention also provides a kit for allergen detection, comprising at least one of the above inhibitory protein allergen or the above DNA molecule.

[0016] For allergy patients, an important means is to detect the allergen causing the allergy, and the occurrence of allergy can be effectively prevented by reducing contact with the allergen in a targeted manner. The allergen or the DNA molecule of the present invention can be used alone or in combination with other allergens to prepare a kit for screening allergens of allergy patients.

[0017] An allergen of a mango fruit of the present invention is an inhibitory protein, which is two subtype proteins. This allergen can be used to prepare a desensitization vaccine for treating or preventing mango allergy, or to prepare a kit for allergen detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a sequence alignment result diagram of 4 subtypes of mango inhibitory protein allergens discovered so far.

[0019] Figure 2 It is an electrophoresis detection diagram after expression and purification of two subtypes of inhibitory proteins in mango fruits in Escherichia coli; lane 1 is Man i 4.0101, and 2 is Man i 4.0102.

[0020] Figure 3 It is a secondary mass spectrometry detection result diagram of the purified allergen, and the highlighted part represents the mass spectrometry matching peptide segments.

[0021] Figure 4 It is a comparison diagram of the binding ability of Man i 4.0101 and Man i 4.0102 with the serum IgE of 12 mango-allergic patients. DETAILED DESCRIPTION OF THE INVENTION

[0022] Mango fruit "Keitt": Collected from Zhanjiang.

[0023] Mango allergy positive serum: Derived from clinical cases of the Second Affiliated Hospital of Zhejiang University School of Medicine, the Third People's Hospital of Datong City, Shanxi Province, the First Affiliated Hospital of Shanxi Medical University, and Qujing Traditional Chinese Medicine Hospital in Yunnan Province, with which research cooperation was carried out. Ethical approval numbers: No. 2020 - 050, 2015 - 001, 2019K - K0007. All patients gave consent and signed informed consent forms.

[0024] Example 1

[0025] Extract the mRNA of the peel and pulp of "Kate" mango respectively, and perform transcriptome sequencing using Illumina HiSeqTM2000. Filter the sequencing data through SOAPnuke and trimmomatic, and then use Trinity to assemble and annotate the sequences. Sequence the total protein of mango fruits using the Triple TOF 5600 platform, and search and match the obtained spectra with the sequences in the transcriptome database using Mascot. Finally, a total of 5,354 proteins and 19,559 peptides were identified.

[0026] Search for the sequences of inhibitor proteins in the fruit transcriptome. A total of 3 inhibitor proteins with high expression in the fruit were found. By comparing the sequences with the inhibitor protein allergens in fruits such as Artemisia pollen, peach, and banana that have been identified, 2 allergens have a high degree of similarity with the sequences of their homologous allergens. According to the IUIS naming rules, the two subtypes are named Man i 4.0101 and Man i 4.0102 respectively. No subtypes exactly the same as the two identified mango inhibitor protein allergens (NCBI sequence numbers are DQ270547 and DQ400579 respectively) were found in the "Kate" mango fruit transcriptome. There are significant differences between Man i4.0101 and the two identified subtypes, while Man i 4.0102 has only one amino acid difference (33W / R) from the identified mango inhibitor protein subtype 2 (NCBI sequence number: DQ400579), as Figure 1 shown.

[0027] Example 2

[0028] Extract the mRNA of "Kate" mango fruits, reverse transcribe it into cDNA, find the full - length sequences of the two inhibitor protein subtypes encoded in the mango fruit transcriptome, and design corresponding specific primers. The upstream primer of Man i 4.0101 is cagcaa atgggtcgcggatcc ATGTCGTGGCAGACCTATGTAGATG, and the downstream primer is gtggtggtggtggtgctcgag TTACAGACCTTGGTCAATTAGATAATCA. The upstream primer of Man i4.0102 is cagcaaatgggtcgcggatccThe forward primer is ATGTCCTGGCAAGCTTACGT, and the reverse primer is gtggtggtggtggtgctcgag CTAAAGACCTTGTTCCACAAGATA (the underlines are primer adapters, containing BamHⅠ and XhoⅠ restriction sites respectively). The sequence was cloned using 2×I-5 high-fidelity enzyme. The reaction system included 12.5 μL of enzyme, 9.5 μL of water, 1 μL of template cDNA, 1 μL of each of the forward and reverse primers. The PCR program was 98°C for 2 min, 98°C for 10 s; 57°C for 10 s, 72°C for 15 s, 72°C for 5 min, for a total of 35 cycles; and stored at 4°C. After the target fragment obtained by cloning was recovered using a gel extraction kit, it was ligated to the pET28a vector digested with BamHⅠ and XhoⅠ using homologous recombinase, transformed into Escherichia coli, and single colonies were picked for sequencing. The full-length coding sequences of the inhibitory proteins Man i4.0101 and Man i 4.0102 were 396 bp respectively (the nucleotide sequences are shown in SEQ ID No.3 and SEQ ID No.4), encoding 131 amino acids respectively. The theoretical molecular weights of the two subtypes were 14017.12 Da and 14016.01 Da respectively, and the theoretical isoelectric points were 4.42 and 4.46 respectively. The amino acid sequences are shown in SEQ ID No.1 and SEQ ID No.2.

[0029] The correctly sequenced recombinant plasmid was transformed into Rosetta strain and amplified in 200 mL of LB medium containing kanamycin. It was cultured at 37°C until the OD 600 reached 0.6 - 0.8, IPTG with a final concentration of 0.5 mM was added, and induced at 16°C for 12 h. After centrifugation, the cell pellet was resuspended in PBS buffer, disrupted by an ultrasonic crusher for 20 min, centrifuged to collect the supernatant, 200 μL of Ni-NTA was added, incubated at 4°C for 1 h, eluted with a gradient of 20 - 250 mM imidazole buffer, and detected by SDS-PAGE (as Figure 2 shown). This protein was expressed as a soluble protein in Escherichia coli, with a 6×His tag. The size of the purified protein was approximately 17 kDa. The target protein was collected and dialyzed into PBS buffer. The samples on the gel strips of the two subtypes were verified by LC-MS / MS mass spectrometry and compared with the theoretical protein sequences. The coverage of Man i4.0101 reached 45.7%, and the coverage of Man i 4.0102 reached 45% (as Figure 3 shown).

[0030] Example 3

[0031] Take 0.5 μg of each of the two purified inhibitor protein subtypes from Example 2 and coat the plate overnight at 4°C. After blocking with 5% non-fat milk at 37°C for 2 h, add 100 μL of serum from mango-allergic patients and incubate at 37°C for 2 h. Then add 100 μL of HRP-labeled goat anti-human IgE secondary antibody (1:3000, Thermo Fisher, catalog number A18793) and incubate at 37°C for 2 h. After TMB color development in the dark for 15 min, terminate the reaction with 2 M HCl and measure the absorbance at 450 nm. The sera of three healthy individuals were used as negative controls. A test value greater than three times the negative control average plus the standard deviation (negative control average + 3SD, where SD represents the standard deviation) was considered positive. Among the 12 tested mango-allergic patients, the positive rates of the two subtype allergens were the same, but the IgE binding ability of Man i 4.0101 was significantly higher than that of Man i 4.0102( Figure 4 ), so component diagnosis of patients with Man i 4.0101 was more accurate. Among 61 mango-allergic patients, 24 (39.3%) were positive for this allergen (Table 1).

[0032] Table 1

[0033]

[0034]

[0035]

[0036] Note: Symptom abbreviations: U - urticaria; C - conjunctivitis; OAS - oral allergy syndrome; G - gastrointestinal symptoms; D - shortness of breath; FA - facial edema; S - sneezing. N1 - N3 are negative control sera. ImmunoCAP is a commonly used method for testing allergens, and generally a value greater than 0.35 is considered positive. Among the sIgE values measured by the ELISA method, the bolded values represent positive values. Sequence Listing <110> Zhejiang University <120> An inhibitor protein allergen from mango fruit and its application <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 131 <212> PRT <213> Mango (Mangifera indica) <400> 1 Met Ser Trp Gln Thr Tyr Val Asp Asp His Leu Met Cys Glu Ile Asp 1 5 10 15 Gly Leu His Leu Thr Ala Ala Ala Ile Ile Gly Gln Asp Gly Thr Val 20 25 30 Trp Ala Gln Ser Ala Asn Phe Pro Gln Leu Lys Pro Glu Glu Ile Thr 35 40 45 Gly Ile Met Asn Asp Phe Ala Glu Pro Gly Thr Leu Ala Pro Thr Gly 50 55 60 Leu Phe Leu Gly Gly Val Lys Tyr Met Val Ile Gln Gly Glu Pro Gly 65 70 75 80 Ala Val Ile Arg Gly Lys Lys Gly Ser Gly Gly Val Thr Val Lys Lys 85 90 95 Thr Asn Gln Ala Leu Ile Ile Gly Ile Tyr Asp Glu Pro Leu Thr Pro 100 105 110 Gly Gln Cys Asn Ile Ile Val Glu Arg Leu Gly Asp Tyr Leu Ile Asp 115 120 125 Gln Gly Leu 130 <210> 2 <211> 131 <212> PRT <213> Mango (Mangifera indica) <400> 2 Met Ser Trp Gln Ala Tyr Val Asp Asp His Leu Met Cys Asp Ile Glu 1 5 10 15 Gly Asn His Leu Ala Ala Ala Ala Ile Leu Gly Gln Asp Gly Ser Val 20 25 30 Trp Ala Gln Ser Ala Asn Phe Pro Gln Leu Lys Pro Glu Glu Val Thr 35 40 45 Gly Ile Asn Asn Asp Phe Asn Glu Pro Gly Thr Leu Ala Pro Thr Gly 50 55 60 Leu Tyr Leu Gly Gly Thr Lys Tyr Met Val Ile Gln Gly Glu Pro Gly 65 70 75 80 Ala Val Ile Arg Gly Lys Lys Gly Pro Gly Gly Val Thr Val Lys Lys 85 90 95 Thr Ser Met Ala Phe Val Ile Gly Ile Tyr Asp Glu Pro Met Thr Pro 100 105 110 Gly Gln Cys Asn Met Ile Val Glu Arg Leu Gly Asp Tyr Leu Val Glu 115 120 125 Gln Gly Leu 130 <210> 3 <211> 396 <212> DNA <213> Mango (Mangifera indica) <400> 3 atgtcgtggc agacctatgt agatgaccac ttgatgtgcg agatagacgg cctgcacctc 60 actgctgcag ctatcatcgg ccaagacggt accgtttggg cccagagcgc taacttccct 120 cagttaaagc ctgaggagat aacaggcatt atgaatgact ttgctgaacc tggaactctt 180 gcgcctactg gcttattcct tggtggtgtg aaatatatgg tgatccaagg agaaccagga 240 gccgttatac ggggaaagaa gggttctggt ggtgttactg tcaagaagac caatcaggcc 300 ttgattattg gtatatatga tgagcctcta actcctggtc agtgcaacat tattgtcgaa 360 aggctgggtg attatctaat tgaccaaggt ctgtaa 396 <210> 4 <211> 396 <212> DNA <213> Mangifera indica <400> 4 atgtcctggc aagcttacgt cgatgaccat ctgatgtgcg atattgaggg caaccacctc 60 gctgctgctg ccatcctcgg ccaggacggc agcgtttggg cccagagcgc caacttccct 120 cagttgaagc ctgaagaagt tactggcatc aataatgact tcaatgaacc tggtacactt 180 gcaccaactg gactatatct tggtggtacg aagtatatgg tgatccaagg ggagccagga 240 gctgtcattc gaggaaagaa gggacctggt ggtgttactg tcaaaaagac cagcatggcc 300 tttgtcattg gtatctatga tgagccaatg actcctggac agtgcaacat gattgtcgaa 360 aggcttggtg attatcttgt ggaacaaggt ctttag 396 <210> 5 <211> 46 <212> DNA <213> Artificial Sequence <400> 5 cagcaaatgg gtcgcggatc catgtcgtgg cagacctatg tagatg 46 <210> 6 <211> 49 <212> DNA <213> Artificial Sequence <400> 6 gtggtggtgg tggtgctcga gttacagacc ttggtcaatt agataatca 49 <210> 7 <211> 41 <212> DNA <213> Artificial Sequence <400> 7 cagcaaatgg gtcgcggatc catgtcctgg caagcttacg t 41 <210> 8 <211> 45 <212> DNA <213> Artificial Sequence <400> 8 gtggtggtgg tggtgctcga gctaaagacc ttgttccaca agata 45

Claims

1. Use of a suppressor protein allergen or a DNA molecule encoding the suppressor protein allergen in the preparation of a desensitization vaccine for treating or preventing mango allergy; The suppressor protein allergen is a subtype of mango suppressor protein, and its amino acid sequence is as shown in SEQ ID No.1 or SEQ ID No.2; The nucleotide sequence of the DNA molecule encoding the suppressor protein allergen is as shown in SEQ ID No.3 or SEQ ID No.

4.

2. A drug for treating or preventing mango allergy, characterized in that, Comprising at least one of a suppressor protein allergen or a DNA molecule encoding the suppressor protein allergen; The suppressor protein allergen is a subtype of mango suppressor protein, and its amino acid sequence is as shown in SEQ ID No.1 or SEQ ID No.2; The nucleotide sequence of the DNA molecule encoding the suppressor protein allergen is as shown in SEQ ID No.3 or SEQ ID No.4; The drug is a desensitization immunization vaccine.

3. Use of a suppressor protein allergen or a DNA molecule encoding the suppressor protein allergen in the preparation of a kit for detecting mango allergens; The suppressor protein allergen is a subtype of mango suppressor protein, and its amino acid sequence is as shown in SEQ ID No.1 or SEQ ID No.2; The nucleotide sequence of the DNA molecule encoding the suppressor protein allergen is as shown in SEQ ID No.3 or SEQ ID No.

4.

4. A kit for detecting mango allergens, characterized in that, Comprising at least one of a suppressor protein allergen or a DNA molecule encoding the suppressor protein allergen; The suppressor protein allergen is a subtype of mango suppressor protein, and its amino acid sequence is as shown in SEQ ID No.1 or SEQ ID No.2; The nucleotide sequence of the DNA molecule encoding the suppressor protein allergen is as shown in SEQ ID No.3 or SEQ ID No.4.