An electrochemical aptamer sensor for high-sensitivity detection of alpha-amanitin and a preparation method and application thereof
A C-Au electrochemical aptamer sensor was prepared by modifying a glassy carbon electrode with gold nanocrystals and connecting it with an aptamer. This method solves the problems of high cost and low sensitivity in the existing technology and achieves high sensitivity and specificity in the detection of α-amanita peptide.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGNAN UNIV
- Filing Date
- 2023-06-07
- Publication Date
- 2026-05-29
Smart Images

Figure CN116794145B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of electrochemical detection technology, specifically relating to a highly sensitive electrochemical aptamer sensor for detecting α-amanita peptides, its preparation method, and its application. Background Technology
[0002] Alpha-amatoxin is an octapeptide toxin with a bicyclic structure. It is the most common toxin found in poisonous mushrooms, which can be fatal to humans and animals. Alpha-amatoxin inhibits transcription by binding to RNA polymerase II, leading to early morphological and functional changes in hepatocytes. Without timely and proper diagnosis and treatment, patients poisoned by alpha-amatoxin can die from acute liver failure within 2-8 days.
[0003] Currently, numerous techniques have been developed for the detection of α-amanita peptide, including liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS / MS), RNA polymerase inhibition assay, enzyme-linked immunosorbent assay (ELISA), and lateral flow immunoassay (LFIA). Among these methods, LC-MS / MS offers high sensitivity, selectivity, and reproducibility for the detection of α-amanita peptide. However, it requires complex sample pretreatment, expensive equipment, and skilled technicians. ELISA offers high sensitivity and selectivity but requires the use of high-purity antibodies and enzymes. However, the preparation of high-quality antibodies is complex, time-consuming, and expensive. To overcome these problems, aptamers have been screened using the exponentially enriched ligand systematic evolution technique (SELEX) and used as alternatives to antibodies for detecting α-amanita peptide. To date, aptamers have been widely used in the preparation of biosensors targeting various targets. Electrochemical aptamer sensors have attracted attention due to their high sensitivity, selectivity, speed, and low cost. Therefore, using an electrochemical aptamer sensor to detect α-amanita peptide is a very suitable method, but existing electrochemical aptamer sensors suffer from high cost and low sensitivity. Summary of the Invention
[0004] To address the problems existing in the prior art, one technical problem this invention aims to solve is to provide a highly sensitive electrochemical aptamer sensor for detecting α-amanita peptides. The C-Au electrochemical aptamer sensor possesses advantages in sensitivity, specificity, and repeatability. Another technical problem this invention aims to solve is to provide a method for preparing a highly sensitive electrochemical aptamer sensor for detecting α-amanita peptides. This method has the advantages of low cost and high sensitivity of the resulting sensor. A further technical problem this invention aims to solve is to provide an application of the above-mentioned electrochemical aptamer sensor in detecting the concentration of α-amanita peptides. This application method possesses advantages in sensitivity, specificity, and repeatability.
[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0006] An electrochemical aptamer sensor for high-sensitivity detection of α-amanitin includes a working electrode, a reference electrode, and a counter electrode. The working electrode is a glassy carbon electrode. The electrode is first modified with gold nanocrystals, and then the aptamer is linked to the gold nanocrystals by gold-sulfur bonds. Finally, the remaining active sites are blocked with mercaptohexanol.
[0007] The high-sensitivity electrochemical aptamer sensor for detecting α-amanita peptide has an α-amanita peptide aptamer of 5'-GACATATTCAGTCTGACAGCGGAAGCGGGTCAGTCCAACTCACGGTCTCGGATGCACGGGAGATGGACGAATATCGTCTAGC-3'.
[0008] The specific steps for preparing the above-mentioned high-sensitivity electrochemical aptamer sensor for detecting α-amanita peptide are as follows:
[0009] (1) Preparation of C-Au / GCE: C-Au stock solution was mixed with chitosan solution and dropped onto the pretreated GCE surface to obtain C-Au / GCE;
[0010] (2) Aptamer (Apt) activation and preparation of Apt / C-Au / GCE: Take Apt solution and tris(2-carboxyethyl)phosphine (TCEP) solution, mix them, activate the thiol group of Apt, and drop it onto the modified electrode C-Au / GCE surface to obtain Apt / C-Au / GCE;
[0011] (3) Preparation of MCH / Apt / C-Au / GCE: A mercaptohexanol (MCH) solution was dropped onto the surface of the modified electrode Apt / C-Au / GCE to obtain MCH / Apt / C-Au / GCE.
[0012] The method for preparing the high-sensitivity electrochemical aptamer sensor for detecting α-amanita peptide involves mixing 50 μL of C-Au stock solution with 10-50 μL of 1.0% chitosan solution, and dropping 3-10 μL onto the pretreated GCE surface; mixing 10 μL of 10 mM Apt solution and an equal volume of 10 mM TCEP solution, and dropping 3-10 μL onto the modified electrode C-Au / GCE surface; and dropping 3-10 μL of 1 mM MCH solution onto the modified electrode Apt / C-Au / GCE surface.
[0013] The preparation method of the high-sensitivity electrochemical aptamer sensor for detecting α-amanita peptides, including the preparation of the C-Au stock solution, comprises the following steps:
[0014] (a) 0.5 mL of 50 mM ascorbic acid solution was injected into 10 mL of growth solution I under vigorous stirring; incubated at 30 °C, centrifuged for 15 minutes, centrifuged at 6000 rpm for 2 minutes, and washed three times with ultrapure water; the collected gold seeds were redispersed in 3 mL of ultrapure water to obtain gold seed solution.
[0015] (b) Under vigorous stirring, 0.1-10 mL of 10-100 mM ascorbic acid solution, 0.2-0.4 mL of gold seed solution and 0.1-10 mL of 1-50 mM glutamic acid cysteine glycine glutamic acid cysteine glycine hexapeptide (ECGECE) solution were added sequentially to 5 mL of growth solution II; the mixture was incubated at 30 °C for 20 minutes, centrifuged at 5000 rpm for 2 minutes, and washed three times with ultrapure water; the collected C-Au was redispersed in 0.5 mL of ultrapure water to obtain a C-Au stock solution.
[0016] The method for preparing the high-sensitivity electrochemical aptamer sensor for detecting α-amanita peptide involves mixing HAuCl4 solution with CTAC, KBr, and KI to prepare growth solution I, where the concentration of HAuCl4 is 0.7 mM, the concentration of CTAC is 15 mM, the concentration of KBr is 5 μM, and the concentration of KI is 0.5 μM; and mixing HAuCl4 solution with CTAC, KBr, and KI to prepare growth solution II, where the concentration of HAuCl4 is 0.4 mM, the concentration of CTAC is 15 mM, the concentration of KBr is 10 μM, and the concentration of KI is 1 μM.
[0017] The application of the above-mentioned electrochemical aptamer sensor in detecting the concentration of α-amanita peptide is as follows: Take the α-amanita peptide solution to be detected, drop it onto the electrode surface, dry it, and then detect it in a PBS solution containing 5.0 mM K4Fe(CN)6 at pH 7.0. Measure the current value, and the logarithm of the α-amanita peptide concentration has a linear relationship with the current value.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] 1. This invention uses ECGECE as a shape inducer to synthesize coral-like gold nanocrystals (C-Au). The synthesized C-Au is composed of super-gold nanocrystals. All the ultra-small gold nanocrystals are connected together to form a clear three-dimensional structure. Its unique structure enables ultrafast electron / electrolyte transfer, large surface area, more exposed high refractive index surfaces, and high stability. Due to the high catalytic activity of C-Au, the C-Au electrochemical aptamer sensor has the advantages of high sensitivity, specificity, and repeatability.
[0020] 2. This invention combines C-Au with an aptamer to specifically detect α-amanita peptides. An electrochemical workstation converts the sensor signal into an electrochemical signal, and the linear relationship between the two signals enables the detection of α-amanita peptide content. The differential pulse voltammetric peak current is between 40 and 1.0 × 10⁻⁶. 6 The detection limit linearly decreases with increasing α-amanita peptide levels within the fM range, with a detection limit of 12 fM (S / N = 3). This method has advantages such as high sensitivity, specificity, and repeatability. Attached Figure Description
[0021] Figure 1 Scanning electron microscope image of C-Au ( Figure 1 A, Figure 1 B) and transmission electron microscope images ( Figure 1 C Figure 1 D);
[0022] Figure 2 Cyclic voltammograms of bare electrodes (a), C-Au / GCE (b), Apt / C-Au / GCE (c), MCH / Apt / C-Au / GCE (d), and α-amanitin / MCH / Apt / C-Au / GCE (e) in PBS solution containing 5.0 mM K₄Fe(CN)₆ at pH 7.0 are shown. Figure 2 A) and impedance spectrum ( Figure 2 B);
[0023] Figure 3 The graphs (3A) show the DPV curves (3A) and the relationship between the peak DPV current (Ip) and the logarithm of the α-amanita peptide concentration in PBS solution containing 5.0 mM K4Fe(CN)6 at pH 7.0, in the presence of 40, 100, 400, 1000, 4000, 10000, 40000, 100000, and 1000000 fM α-amanita peptide (from bottom to top). Figure 3 B);
[0024] Figure 4 4×10 -12 Mα-Amanita peptide, β-Amanita peptide, and γ-Amanita peptide, 1×10 -9 Peak current diagram of DPV in the presence of M glucose, urea and uric acid. Detailed Implementation
[0025] The present invention will be further described below with reference to specific embodiments. The α-amanita peptide aptamer used in the following embodiments is 5'-GACATATTCAGTCTGACAGCGGAAGCGGGTCAGTCCAACTCACGGTCTCGGATGCACG GGAGATGGACGAATATCGTCTAGC-3'.
[0026] The pretreated glassy carbon electrode (GCE) was polished on a polishing cloth with alumina powder of 0.05 mm particle size, rinsed with double-distilled water, and then ultrasonically treated in double-distilled water and ethanol (1:1, V / V) for 10 minutes. Next, the GCE was subjected to cyclic voltammetry in 0.5 M H₂SO₄ at a potential range of -0.5–1.4 V until its CV curve remained constant. Finally, it was washed with deionized water and dried. In the following examples, comparative examples, and experimental cases, the PBS buffer solution used was a pH 7.0 PBS solution containing 5.0 mM K₄Fe(CN)₆.
[0027] Example 1
[0028] A method for preparing an α-amanitin aptamer electrochemical sensor, the specific construction steps of which are as follows:
[0029] (1) Preparation of C-Au / GCE: Mix 50 μL of C-Au stock solution with 10 μL of 1.0% chitosan solution, and drop 5 μL onto the pretreated GCE surface to obtain C-Au / GCE. Dry at room temperature and rinse three times with ultrapure water.
[0030] The preparation of C-Au stock solution includes the following steps:
[0031] (a) 0.5 mL of 50 mM ascorbic acid solution was injected into 10 mL of growth solution I under vigorous stirring; incubated at 30 °C, centrifuged for 15 minutes, centrifuged at 6000 rpm for 2 minutes, and washed three times with ultrapure water; the collected gold seeds were redispersed in 3 mL of ultrapure water to obtain a gold seed solution; HAuCl4 solution was mixed with CTAC (hexadecyltrimethylammonium chloride), KBr and KI to form growth solution I composed of HAuCl4, CTAC, KBr and KI, with the concentration of HAuCl4 being 0.7 mM, the concentration of CTAC being 15 mM, the concentration of KBr being 5 μM and the concentration of KI being 0.5 μM;
[0032] (b) Under vigorous stirring, 0.5 mL of 50 mM ascorbic acid solution, 0.25 mL of gold seed solution, and 1 mL of 2.5 mM MECGECE solution were added sequentially to 5 mL of growth solution II; the mixture was incubated at 30 °C for 20 minutes, centrifuged at 5000 rpm for 2 minutes, and washed three times with ultrapure water; the collected C-Au was redispersed in 0.5 mL of ultrapure water to obtain a C-Au stock solution; HAuCl4 solution was mixed with CTAC, KBr, and KI to form growth solution II, which consisted of HAuCl4, CTAC, KBr, and KI, with a concentration of 0.4 mM for HAuCl4, 15 mM for CTAC, 10 μM for KBr, and 1 μM for KI;
[0033] (2) Apt activation and preparation of Apt / C-Au / GCE: Take 10 μL of 10 mM Apt solution and 10 μL of 10 mM TCEP solution, mix them, activate the thiol group of Apt, take 5 μL and drop it on the modified electrode surface (C-Au / GCE) to obtain Apt / C-Au / GCE, dry at room temperature and rinse three times with ultrapure water;
[0034] (3) Preparation of MCH / Apt / C-Au / GCE: Take 5 μL of 1mM MCH (mercaptohexanol) solution and drop it onto the modified electrode surface (Apt / C-Au / GCE) to obtain MCH / Apt / C-Au / GCE. Dry it at room temperature and rinse it three times with ultrapure water.
[0035] Figure 1 Scanning electron microscope image of C-Au ( Figure 1 A, Figure 1 B) and transmission electron microscope images ( Figure 1 C Figure 1 D). By Figure 2 It is known that C-Au possesses a coral-like three-dimensional structure composed of numerous ultra-micro gold nanocrystals with dimensions of several nanometers. This ultra-micro size allows the gold nanocrystals to fully expose their active sites. All the ultra-small gold nanocrystals are interconnected into a micrometer-sized whole. This micro / nanostructure provides a high-speed electron / electrolyte transfer channel. Furthermore, the integrated structure significantly enhances stability. Magnified TEM images show numerous sharp edges on the surface of the gold nanocrystals. This confirms the presence of more exposed high-index crystal planes. A 0.32 nm spacing is observed in the HRTEM image, corresponding to the (111) crystal plane of the gold nanocrystal.
[0036] To better understand the preparation process of the α-amanitin aptamer electrochemical sensor provided by this invention, cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) were used for characterization.
[0037] Figure 2 A is the CV characterization diagram of the α-amanitin aptamer sensor construction process, (bare electrode (a), C-Au / GCE (b), Apt / C-Au / GCE (c), MCH / Apt / C-Au / GCE (d), α-amanitin (α-amanitin) / MCH / Apt / C-Au / GCE (e).
[0038] All CV curves included a pair of redox peaks, confirming the presence of Fe(CN)6. 4- Oxidation and reduction can be performed on all electrode surfaces. Compared to bare GCE, C-Au / GCE exhibits increased CV current and decreased peak potential, due to the high catalytic activity of C-Au. Catalysis accelerates the electrode reaction and leads to an increase in CV current. The CV current of Apt / C-Au / GCE is significantly lower than that of C-Au / GCE, indicating that aptamer immobilization reduces CV current because the immobilized portion of the aptamer blocks the electron transfer channel between the electrode and the electrolyte, thus reducing CV current. Similar to the aptamer, MCH immobilization also reduces CV current. In the presence of α-amanita peptide, α-amanita peptide can firmly bind to the aptamer on the electrode surface, forming an aptamer / α-amanita peptide complex. Since the composite material is insulating, its introduction into the modified layer on the electrode surface leads to a decrease in CV current. The above results verify the high feasibility of this sensing platform for the electrochemical detection of α-amanita peptide.
[0039] Figure 2 B shows the EIS characterization of the α-amanitin aptamer sensor construction process (bare electrode (a), C-Au / GCE (b), Apt / C-Au / GCE (c), MCH / Apt / C-Au / GCE (d), α-amanitin / MCH / Apt / C-Au / GCE (e)). The electrode impedances were compared by observing the diameter of the semicircles in the spectra; the smaller the diameter, the lower the electrode impedance. The order of impedance from the graph is: e>d>a>c>b. Compared to bare GCE, the high catalytic activity of C-Au accelerates the electrode reaction, resulting in a lower charge transfer impedance (Rct). Aptamer immobilization increases the Rct value because the immobilized portion of the aptamer blocks the electron transfer channel between the electrode and the electrolyte. Similar to the aptamer, MCH immobilization also increases the Rct value. In the presence of α-amanita peptide, it can firmly bind to the aptamer on the electrode surface, forming an aptamer / α-amanita peptide complex. Since the composite material is insulating, the modified layer introduced onto the electrode surface will increase the Rct value. As shown in the figure, the change in EIS during the construction of the aptamer electrochemical sensor is consistent with the CV response. These results demonstrate the successful construction of the α-amanita peptide aptamer electrochemical sensor.
[0040] Example 2
[0041] The performance of the α-amanita peptide aptamer electrochemical sensor constructed in this invention was tested, including the establishment of the α-amanita peptide detection standard curve, and the sensor's selectivity, repeatability, reproducibility, and stability.
[0042] Establishment of a standard curve for the detection of α-amanita peptides. (e.g.) Figure 3 The constructed aptamer electrochemical sensor was used to detect different concentrations of α-amanita peptide (in the presence of 40, 100, 400, 1000, 4000, 10000, 40000, 100000, and 1000000 fM α-amanita peptide (from bottom to top)). As the concentration of α-amanita peptide gradually increased, the amount of α-amanita peptide recognized at the sensing interface continuously increased, hindering the [Fe(CN)6]... 3- / 4- Electron transfer at the electrode surface causes a continuous decrease in peak current. The logarithm of the α-amanita peptide concentration has a linear relationship with the current response value, and the standard curve equation is: Ip(μA)=-4.1152×Lg[C α-amanitin ,fM]+35.933(R 2 =0.995).
[0043] The selectivity performance of the aptamer electrochemical sensor constructed in this study was evaluated. The constructed aptamer electrochemical sensor was used to detect 4 × 10⁻⁶ cells / day. -12 Mα-Amanita peptide, β-Amanita peptide, and γ-Amanita peptide, 1×10 -9 M glucose, urea, and uric acid. The peak current response results of DPV are as follows: Figure 4 As shown, the peak current value of the constructed aptamer electrochemical sensor did not change significantly in the presence of interfering substances, indicating that the constructed aptamer electrochemical sensor has good selectivity for α-amanita peptide.
[0044] The reproducibility of the constructed aptamer electrochemical sensor was studied. Sensors prepared using the same modification method detected 2 × 10⁻⁶ cells / day. -12 Mα-Amanita peptide was measured using DPV, and the RSD value for 30 tests was 1.4%, indicating that the sensor has good repeatability.
[0045] The reproducibility of the aptamer electrochemical sensors constructed in this study was evaluated. Twenty-five aptamer sensors were constructed, and measurements were performed using the same method at a rate of 2 × 10⁻⁶. -12 The peak current of the DPV of Mα-amanita peptide was measured. The relative standard deviation (RSD) of the peak current response of the DPV among these aptamer sensors was 2.2%, indicating that the constructed electrochemical aptamer sensor has good reproducibility.
[0046] The stability of the electrochemical aptamer sensor constructed in this study was investigated. The prepared aptamer sensor was stored in a refrigerator at 4°C and removed once a week for detection at 2 × 10⁻⁶. -12 Mα-Amanita peptide, after six weeks of storage, only resulted in a 2.4% change in the peak current of the DPV, and the experimental results show that the constructed electrochemical aptamer sensor has good stability.
[0047] Example 3
[0048] Detection in real samples. To further investigate the application performance of the constructed aptamer electrochemical sensor in the determination of α-amanita peptide in real samples, urine samples were collected from healthy volunteers, and different concentrations of α-amanita peptide were added to the samples, resulting in concentrations of 10 ng / mL, 20 ng / mL, 25 ng / mL, and 50 ng / mL. After sample processing, the dilution voltammetry (DPV) was measured using the aptamer electrochemical sensor. The recovery rates are shown in Table 1, indicating that the sensor has good accuracy and can be used for the detection of α-amanita peptide in real samples.
[0049] Table 1. Detection results in actual samples
[0050]
Claims
1. An electrochemical aptamer sensor for detecting α-amanitin, comprising a working electrode, a reference electrode, and a counter electrode, characterized in that, The working electrode is a glassy carbon electrode. First, the electrode is modified with gold nanocrystals. Then, the aptamer is connected to the gold nanocrystals with gold-sulfur bonds. Finally, the remaining active sites are blocked with mercaptohexanol. The α-amanita peptide aptamer is 5'-GACATATTCAGTCTGACAGCGGAAGCGGGTCAGTCCAACTCACGGTCTCGGATGCACGGGAGATGGACGAATATCGTCTAGC-3'; The specific steps for preparing the electrochemical aptamer sensor for detecting α-amanita peptide are as follows: (1) Preparation of C-Au / GCE: C-Au stock solution was mixed with chitosan solution and dropped onto the pretreated GCE surface to obtain C-Au / GCE; (2) Apt activation and preparation of Apt / C-Au / GCE: Take Apt solution and TCEP solution, mix them, activate the thiol group of Apt, and drop it onto the modified electrode C-Au / GCE surface to obtain Apt / C-Au / GCE; (3) Preparation of MCH / Apt / C-Au / GCE: MCH solution was dropped onto the surface of the modified electrode Apt / C-Au / GCE to obtain MCH / Apt / C-Au / GCE.
2. The electrochemical aptamer sensor for detecting α-amanita peptide according to claim 1, characterized in that, Mix 50 μL of C-Au stock solution with 10-50 μL of 1.0% chitosan solution, and drop 3-10 μL onto the pretreated GCE surface; take 10 μL of 10 mM Apt solution and 10 μL of 10 mM TCEP solution, and drop 3-10 μL onto the modified electrode C-Au / GCE surface; take 3-10 μL of 1 mM MCH solution and drop it onto the modified electrode Apt / C-Au / GCE surface.
3. The electrochemical aptamer sensor for detecting α-amanita peptide according to claim 1, characterized in that, The preparation of C-Au stock solution includes the following steps: (a) Add 0.5 mL of 50 mM ascorbic acid solution to 10 mL of growth solution I under vigorous stirring; incubate at 30 °C, centrifuge for 15 minutes, centrifuge at 6000 rpm for 2 minutes, and wash three times with ultrapure water; redisperse the collected gold seeds in 3 mL of ultrapure water to obtain gold seed solution. (b) Under vigorous stirring, 0.1-10 mL of 10-100 mM ascorbic acid solution, 0.2-0.4 mL of gold seed solution and 0.1-10 mL of 1-50 mM ECGECE solution were added sequentially to 5 mL of growth solution II; the mixture was incubated at 30 °C for 20 minutes, centrifuged at 5000 rpm for 2 minutes, and washed three times with ultrapure water; the collected C-Au was redispersed in 0.5 mL of ultrapure water to obtain a C-Au stock solution.
4. The electrochemical aptamer sensor for detecting α-amanita peptide according to claim 3, characterized in that, Growth solution I was prepared by mixing HAuCl4 solution with CTAC, KBr and KI, with HAuCl4 concentration of 0.7 mM, CTAC concentration of 15 mM, KBr concentration of 5 μM and KI concentration of 0.5 μM. Growth solution II was prepared by mixing HAuCl4 solution with CTAC, KBr and KI, with HAuCl4 concentration of 0.4 mM, CTAC concentration of 15 mM, KBr concentration of 10 μM and KI concentration of 1 μM.
5. The application of the electrochemical aptamer sensor according to claim 1 in detecting the concentration of α-amanita peptide.
6. The application of the electrochemical aptamer sensor according to claim 5 in detecting the concentration of α-amanita peptide, characterized in that, Specifically, the α-amanita peptide solution to be detected was dropped onto the electrode surface, dried, and then detected in a PBS solution containing 5.0 mM K4Fe(CN)6 at pH 7.
0. The current value was measured, and the logarithm of the α-amanita peptide concentration showed a linear relationship with the current value.