A ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction and its application

Abstract

The present invention discloses a ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction and its application. 2+ Using the DNA / TPrA system as a dual-anode signal source, a novel ratiometric bipolar electrode electrochemiluminescence biosensor for miRNA detection and analysis was constructed. By combining the ligase chain reaction with CRISPR / Cas technology and integrating gold nanoparticle-modified Fe3O4 magnetic nanoparticles enriched with ferrocene nucleic acid signal probes (DNA-Fc / Au@Fe3O4 NPs) as a multifunctional reaction interface, the sensor effectively modulates the signal changes of the two ECL reaction systems. Ultrasensitive detection of miRNA-222 is achieved through the ratio of the two signals. The constructed sensor exhibits exceptional performance for miRNA-222 detection and is expected to be applied as a novel detection method in early clinical diagnosis and single-cell analysis.

Description

Technical Field

[0001] The present invention relates to a quasi-homogeneous reaction ratiometric bipolar electrode electrochemiluminescence biosensor for miRNA-222 detection, belonging to the field of biosensor technology. The biosensor is based on the change of dual-anode ECL signal intensity and realizes ultra-high sensitivity detection and analysis of miRNA in serum through signal ratio. Background Art

[0002] Micro-ribonucleic acid (miRNA) is a non-coding endogenous RNA, typically 18 to 23 nucleotides in length, that plays a crucial regulatory role within various intergenic regions. Currently, miRNAs are commonly used as biomarkers for cancer diagnosis, and studying their in vivo expression levels can be used to assess cancer development and progression. Elevated expression of miRNA-222 is a risk factor for numerous cancers, including thyroid, breast, and prostate cancers. Furthermore, miRNA-222 can regulate target proteins and enhance tumor drug resistance. This is primarily due to miRNAs in exosomes participating in the regulation of drug target protein expression, contributing to cancer cell resistance and resulting in elevated plasma drug concentrations, which can compromise clinical therapeutic efficacy. Therefore, accurate analysis of miRNA-222 expression levels not only aids in the early diagnosis and prognosis of cancer but also provides reliable guidance for clinical drug use during cancer treatment and prognosis, thereby improving clinical drug efficacy and ensuring patient safety. However, miRNAs in exosomes are of low abundance and difficult to detect, so there is an urgent need to develop miRNA detection methods with ultra-high sensitivity.

[0003] Electrochemiluminescence (ECL) technology has the advantages of low cost, simple operation, and the absence of expensive instruments and equipment, and can be used to construct instant detection devices. At the same time, the use of a ratiometric ECL strategy can effectively avoid interference from the external environment through self-calibration between the two ECL signals, thereby improving the accuracy of the results. The closed bipolar electrode (BPE) can effectively isolate the exchange between the two electrolytic cell solutions in space, avoiding a complex analytical environment. At the same time, based on the principle of electrical neutrality, the entire closed BPE follows the law of conservation of electrons, and the redox reactions occurring in the two electrolytic cells are interrelated. Therefore, biosensors constructed based on bipolar electrodes combined with ratiometric electrochemiluminescence technology (ratiometric BPE-ECL biosensors) have unique advantages in the field of bioanalysis.

[0004] Currently, most developed BPE-ECL-based biosensors require solid-phase modification of nucleic acid recognition probes onto the chip surface. This solid-phase modification step alters the conformation of the recognition probes. Furthermore, the entire biorecognition process occurs at a heterogeneous interface, resulting in steric hindrance that reduces the hybridization efficiency between the target and the nucleic acid recognition probe, limiting the sensor's sensitivity for miRNA detection. Several homogeneous ECL methods that do not require immobilization of nucleic acids have garnered significant attention. Magnetic nanomaterials, such as Fe₃O₄ magnetic nanoparticles (Fe₃O₄NPs), demonstrate promising applications in bioanalysis and disease diagnosis due to their unique magnetic separation properties, enabling efficient and residue-free separation of targets from homogeneous or quasi-homogeneous reaction systems. Therefore, combining BPE-ECL biosensors with magnetic nanomaterials is expected to further enhance sensor sensitivity. Furthermore, the magnetic separation capability of magnetic materials allows for the reuse of constructed BPE chips, reducing costs, minimizing experimental errors, and improving reproducibility.

[0005] Detecting low-abundance miRNAs in complex biological samples places higher demands on sensor performance, and signal amplification strategies are often employed to further enhance sensor sensitivity. In recent years, the CRISPR / Cas system, comprised of clustered regularly interspaced short palindromic repeats (CRISPR) and the CRISPR-associated protein Cas, has garnered significant attention in the life sciences as a novel technology. Simultaneously, nucleic acid amplification technologies, including loop-mediated isothermal amplification (LIA), rolling circle amplification (RCA), and polymerase chain reaction (PCR), have become increasingly widely used in clinical testing. However, these methods, based on polymerization reactions, are prone to nonspecific amplification, posing a risk of false-positive results in practical applications. The ligase chain reaction (LCR), on the other hand, utilizes two sets of DNA probes (four DNA probes) to identify the target, offering excellent specificity, low background, and high sensitivity. Based on the LCR amplification principle, two probes initially bind to the target miRNA through complementary base pairing. Upon achieving perfect complementarity, the ligase enzyme specifically ligates the DNA probes, indirectly reverse-transcribed into a long DNA template. Afterwards, thermal cycling amplification is performed based on the complementarity between the DNA template and the probe, where only completely complementary structures can be ligated by the enzyme. Therefore, LCR technology can detect single-base differences and achieve exponential amplification of nucleic acids.

[0006] The present invention discloses a ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction for detecting miRNA-222. 2+ / TPrA system and HNCQDs / H2O2 system are used as dual-anode ECL signal sources. LCR and CRISPR / Cas12a technology are introduced as nucleic acid amplification technology and signal amplification strategy. Combined with Fe3O4NPs as the signal probe reaction interface, a new ratiometric BPE-ECL detection method for miRNA-222 is constructed. Gold nanoparticles are generated by in situ reduction on the surface of Fe3O4NPs to obtain Au@Fe3O4NPs. The signal probe DNA-Fc labeled with ferrocene (Fc) is enriched on the surface of Au@Fe3O4NPs through Au-S bonds as a signal unit. As in Chapter 1, Ru(bpy)3 2+ / TPrA system in the driving electrode anode luminescence (ECL Ru ), HNCQDs / H2O2 system emits light at the BPE anode (ECL HNCQDs ). DNA-Fc / Au@Fe3O4NPs were enriched on the driving electrode anode by magnetic adsorption, and the modified Fc had an obvious effect on ECL. Ru The signal is quenched. Then, through magnetic attraction, DNA-Fc / Au@Fe3O4NPs are transferred to the cathode area of ​​BPE. Fc, as an electrochemically active substance, also has excellent conductive properties, which can accelerate the electron transfer rate of the BPE chip and enhance ECL. HNCQDs The LCR reaction was designed to amplify the target miRNA-222. The amplified product can be recognized by crRNA, activating the nonspecific cleavage activity of the CRISPR / Cas12a system, cleaving the DNA-Fc signal probe, reducing the amount of Fc, weakening the quenching effect, and ECL Ru Signal recovery. At the same time, the electron transfer rate of the BPE chip decreases, resulting in ECL HNCQDs Signal weakening. Detection and analysis of miRNA-222 is achieved based on changes in the signal ratio of the two ECL systems. Both LCR amplification and the CRISPR / Cas12a system occur in a homogeneous solution, enabling efficient identification of target molecules. The constructed ratiometric BPE-ECL sensor exhibits ultra-high sensitivity, excellent stability, and reproducibility. It performs well in detecting miRNA-222 in human serum samples and has great potential for application in in vitro analysis and clinical medicine. Summary of the Invention

[0007] 1. The purpose of the present invention is to provide a ratiometric bipolar electrode electrochemiluminescence biosensor based on a quasi-homogeneous reaction and its application in ultra-high-sensitivity detection of miRNA-222.

[0008] 2. The present invention discloses a ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction and its application, using Ru(bpy)3 2+ The / TPrA system and HNCQDs / H2O2 system were used as dual-anode ECL signal sources. The ligase chain reaction was combined with CRISPR / Cas technology, and gold nanoparticle-modified Fe3O4 magnetic nanoparticles enriched with ferrocene nucleic acid signal probes (DNA-Fc / Au@Fe3O4NPs) were combined to form a multifunctional reaction interface. This effectively regulated the signal changes of the two ECL reaction systems and achieved ultra-sensitive detection of miRNA-222 through the ratio of the two signals.

[0009] 3. The present invention provides a ratiometric bipolar electrode electrochemiluminescence biosensor based on a quasi-homogeneous reaction and its application, wherein the preparation method comprises the following steps in sequence:

[0010] (1) Synthesis of HNCQDs

[0011] 2.1 g of citric acid was dissolved in 15 mL of DMF, and 1.25 mL of hydrazine hydrate was then added dropwise to the resulting colloidal precursor mixture. The colloidal precursor was placed in a microwave reactor (800 W) and reacted for 300 s. A large, porous solid was obtained. 15 mL of water was added to dissolve the reaction product, and the large black precipitate was removed by centrifugation (10,000 rpm, 10 min). After settling, the supernatant was filtered through 0.45 μm and 0.22 μm filters and dialyzed against deionized water for 24 h using a dialysis bag with a molecular weight cutoff (MWCO) of 100-500 Dalton. The resulting HNCQD solid was then dried at 60°C and stored sealed in the dark.

[0012] (2) Preparation of DNA-Fc / Au@Fe3O4 NPs

[0013] Preparation of Au@Fe3O4NPs: 500 μL of Fe3O4NPs (5 mg / mL) was added to a slightly boiling HAuCl4 solution (0.04%, 5 mL). After the solution was boiled again, 100 μL of 5% sodium citrate solution was added for in situ reduction to generate gold nanoparticles. When the color of the solution changed from brown to purple and finally to red, it indicated that gold nanoparticles were generated. After continuing to heat for 15 minutes, it was magnetically separated, washed three times with ultrapure water, and redispersed in 500 μL of ultrapure water to obtain Au@Fe3O4NPs.

[0014] Preparation of DNA-Fc / Au@Fe3O4NPs: 200 μL of DNA-Fc was mixed with 200 μL of Au@Fe3O4NPs. The DNA-Fc was linked to the Au@Fe3O4NPs via Au-S bonds. The mixture was shaken overnight at pH 7.4. Subsequently, 200 μL of 2% BSA solution was added and shaken for 1 hour to block nonspecific sites. The remaining DNA-Fc was separated by magnetic washing, washed three times, and then redispersed in 200 μL of ultrapure water to obtain DNA-Fc / Au@Fe3O4NPs.

[0015] (3) Ligase chain reaction

[0016] In stage A of the ligase chain reaction, miRNA-222 was first used as a template. Probes X1 and Y1 recognized the target, and a ligation reaction occurred under the action of SplintR Ligase, generating single-stranded DNA. The reaction system consisted of 100 μL of 1X ligation buffer (pH 7.5, 50 mM Tris-HCl, 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP), 200 U of recombinant ribonuclease inhibitor, 50 U of SplintR ligase, 100 nM probe X1, 100 nM probe X2, and varying concentrations of miRNA-222. The reaction system was placed in a thermomixer. The first stage was programmed at 25°C for 20 minutes, and the second stage was programmed at 80°C for 20 minutes. The resulting product was stored at 4°C.

[0017] In stage B of the ligase chain reaction (LCR), 40 μL of ligation probes (including Probe X1, Probe Y1, Probe X2, and Probe Y2, with concentrations ranging from 50 to 300 nM) and 5 μL of HiFi Taq DNA Ligase Reaction Buffer were added sequentially. 1 μL of HiFi Taq DNA Ligase was then added to DEPC water to make the final volume of 50 μL. This was prepared as the LCR stage B system. The system was aliquoted into 9 μL tubes, and 1 μL of the stage A product at varying concentrations of miRNA-222 was then added. The reaction system was placed in a PCR instrument. The first stage was programmed to: 95°C for 3 minutes; the second stage was programmed to: 55–65°C for 1 minute; and the third stage was programmed to: 95°C for 1 minute. Stages 2 and 3 comprised one thermal cycle, and 35–50 cycles were performed. The resulting LCR product was stored at 4°C.

[0018] (4) Ligase chain reaction combined with CRISPR / Cas12a

[0019] Add 48 μL of DEPC water, 10 μL of 10X NEBuffer 2.1 Reaction Buffer, 10 μL of crRNA (2 μM), 10 μL of DNA-Fc / Au@Fe3O4NPs, and 2 μL of EnGen Lba Cas12a (1 μM) in sequence. Reaction conditions: in a constant temperature mixer, the temperature is 37 ° C, the reaction time is 30 ~ 120 min, and the vibration frequency is 600 bpm.

[0020] (5) Signal detection of ratiometric BPE-ECL biosensor based on quasi-homogeneous reaction

[0021] HNCQDs / H2O2 system was added to the anode tank; Ru(bpy)3 was added to the cathode tank. 2+ / TPrA system. Then, 20 μL of LCR products amplified by miRNA-222 at different concentrations were added to the prepared 80 μL CRISPR / Cas12a reaction system (containing DNA-Fc / Au@Fe3O4NPs). After reacting at 37 °C for 2 h, the reacted DNA-Fc / Au@Fe3O4NPs were extracted by magnetic separation and added dropwise to the BPE cathode pool. DNA-Fc / Au@Fe3O4NPs were aggregated on the anode area of ​​the driving electrode by magnetic attraction. Cyclic voltammetry was used with a scanning voltage of 0 ~ 4 V, a scanning rate of 0.2 V / s, and PMT = 800 V to detect ECL. RuDNA-Fc / Au@Fe3O4NPs were gathered in the cathode area of ​​BPE by magnetic attraction, and the same electrochemical method and parameter settings were used to detect ECL. HNCQDs strength.

[0022] Specifically, the present invention describes a ratiometric bipolar electrode electrochemiluminescence biosensor based on a quasi-homogeneous reaction, characterized in that the biosensor includes a signal probe-modified magnetic nanomaterial (DNA-Fc / Au@Fe3O4 NPs), enzymes and reagents required for the combination of ligase chain reaction and CRISPR / Cas technology, a dual-anode ECL luminescent probe and a co-reactant, a bipolar electrode chip constructed based on ITO and PDMS, and nucleic acid probes and reagents contained in a cathode cell. The biosensor can be used for ultra-sensitive detection of miRNA-222.

[0023] Furthermore, the dual-anode ECL luminescent probe and co-reactant are HNCQDs / H2O2 system and Ru(bpy)32+ / TPrA system.

[0024] Furthermore, the concentration of the signal probe-modified magnetic nanomaterial (DNA-Fc / Au@Fe3O4 NPs) of the present invention is 2.5 to 10 mg / mL, and the preparation method thereof comprises the following steps:

[0025] (1) Preparation of Au@Fe3O4 NPs: 500 μL of Fe3O4 NPs were added to 5 mL of 0.04 wt% HAuCl4 solution at a slightly boiling point. After the solution was boiled again, 100 μL of 5 wt% sodium citrate solution was added to generate gold nanoparticles by in situ reduction. When the color of the solution changed from brown to purple and finally to red, it indicated that gold nanoparticles were generated. After heating for 15 minutes, the solution was subjected to magnetic separation, washed three times with ultrapure water, and redispersed in 500 μL of ultrapure water to obtain Au@Fe3O4 NPs.

[0026] (2) Preparation of DNA-Fc / Au@Fe3O4 NPs: 200 μL of 10 μM DNA-Fc was mixed with 200 μL of Au@Fe3O4 NPs prepared in step (1). DNA-Fc was connected to Au@Fe3O4 NPs through Au-S bonds. The mixture was shaken overnight at pH 7.4. Then, 200 μL of 2 wt% BSA solution was added and shaken for 1 h to block nonspecific sites. The remaining DNA-Fc was separated by magnetic washing. After washing three times, the mixture was redispersed in 200 μL of ultrapure water to obtain DNA-Fc / Au@Fe3O4 NPs.

[0027] Furthermore, the bipolar electrode driving voltage is 0~4V.

[0028] Furthermore, in the above-mentioned ligase chain reaction combined with CRISPR / Cas technology, the nucleic acid probe used to detect miRNA-222 includes:

[0029] (1) Probe X1, sequence: 5'-CAAGCATCTTTCGAGACCCAGTAG -3';

[0030] (2) Probe Y1, sequence: 5′- P- CCAGATGTAGCTCTCAAC -3′;

[0031] (3) Probe X2, sequence: 5'-P-CTACTGGGTCTCGAAAGATGCTTG -3';

[0032] (4) Probe Y2, sequence: 5′- P- GTTGAGAGCTACATCTGG -3′;

[0033] (5) crRNA, sequence: 5'-UAAUUUCUACUAAGUGUAGAUGAGACCCAGUAGCCAGAUG -3'.

[0034] Furthermore, the probe concentrations of Probe X1, Probe Y1, Probe X2, and Probe Y2 used in the ligase chain reaction were 50 to 300 nM; the number of thermal cycles was 35 to 50; and the temperature during the thermal cycle amplification phase was 55 to 65°C.

[0035] Furthermore, the HNCQDs / H2O2 system was added to the anode pool; the Ru(bpy)32+ / TPrA system was added to the cathode pool; 20 μL of LCR products amplified by miRNA-222 at different concentrations were added to the CRISPR / Cas12a reaction system containing DNA-Fc / Au@Fe3O4 NPs, and the reaction was carried out at 37 °C for 2 h. The reacted DNA-Fc / Au@Fe3O4 NPs were extracted by magnetic separation and added dropwise to the BPE cathode pool; the DNA-Fc / Au@Fe3O4 NPs were aggregated on the anode region of the driving electrode by magnetic attraction, and cyclic voltammetry was used to detect the signal (ECLRu) intensity of the Ru(bpy)32+ / TPrA system with a scanning voltage of 0 ~ 4 V, a scanning rate of 0.2 V / s, and PMT = 800 V; the DNA-Fc / Au@Fe3O4 NPs accumulated in the cathode area of ​​BPE, and the same electrochemical method and parameter settings were used to detect the signal intensity (ECLHNCQDs) of the HNCQDs / H2O2 system.

[0036] The above-mentioned ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction of the present invention is characterized by being used for ultra-high sensitivity detection of miRNA-222.

[0037] Advantages of the present invention:

[0038] The present invention discloses a ratiometric bipolar electrode electrochemiluminescence (BPE-ECL) biosensor based on quasi-homogeneous reaction and its application in the detection and analysis of miRNA-222. 2+ Using a dual-anode signal source, a novel ratiometric BPE-ECL biosensor for miRNA detection and analysis was constructed using a ligase chain reaction (LCR) coupled with CRISPR / Cas technology. This multifunctional reaction interface, combined with gold nanoparticle-modified Fe3O4 magnetic nanoparticles enriched with ferrocene nucleic acid signal probes (DNA-Fc / Au@Fe3O4NPs), effectively modulated the signal changes of the two ECL reaction systems. Ultrasensitive detection of miRNA-222 was achieved through the ratio of the two signals. Based on a quasi-homogeneous reaction system, it eliminates the need for complex modification steps and exhibits high biorecognition efficiency. The ratiometric BPE-ECL biosensor constructed in this chapter is capable of effectively identifying ultratrace targets. The constructed sensor exhibited exceptional performance for miRNA-222 detection and is expected to become an ultrasensitive detection tool for analysis of extremely low-abundance biological samples, early clinical diagnosis, and single-cell analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is a diagram showing the working principle of a ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction for miRNA-222 detection according to the present invention.

[0040] Figure 2 In the ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction of the present invention, A is the HRTEM image of Au@Fe3O4NPs, and B is the EDS image of Au@Fe3O4NPs.

[0041] Figure 3 The present invention is a ratiometric bipolar electrode electrochemiluminescence biosensor assembly process based on quasi-homogeneous reaction, ECL Ru (A) with ECL HNCQDs(B) Signal intensity-voltage relationship curve: In the figure: (a) ITO, (b) Au@Fe3O4 NPs / ITO, (c) DNA-Fc / Au@Fe3O4 NPs / ITO and (d) cleaved DNA-Fc / Au@Fe3O4 NPs / ITO.

[0042] Figure 4 The ECL signal-time curve of the ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction for different miRNA-222 concentrations (A and B in the figure) is shown in the figure. Ru Intensity / ECL HNCQDs The relationship curve between the intensity (Figure: C) and the different concentrations of miRNA-222 and lg (ECL Ru Intensity / ECL HNCQDs The linear relationship diagram of the intensity) (in the figure: D). In the figure A and B, a) 0 aM, (b) 0.1 aM, (c) 0.5 aM, (d) 1 aM, (e) 5 aM, (f) 10 aM, (g) 10 2 aM、(h)10 3 aM、(i)10 4 aM、(j)10 5 aM、(k)10 6 aM. DETAILED DESCRIPTION

[0043] In order to make the technical problems, technical solutions and effects to be solved by the present invention clearer, the present invention is further described in detail below with reference to the embodiments and drawings.

[0044] like Figure 1 The figure shows the working principle of the present invention's ratiometric bipolar electrode electrochemiluminescence biosensor for ultra-high sensitivity detection of miRNA-222 based on quasi-homogeneous reaction: Ru(bpy)3 2+ / TPrA system and HNCQDs / H2O2 system are used as dual-anode ECL signal sources. LCR and CRISPR / Cas12a technology are introduced as nucleic acid amplification technology and signal amplification strategy. Combined with Fe3O4NPs as the signal probe reaction interface, a new ratiometric BPE-ECL detection method for miRNA-222 is constructed. Gold nanoparticles are generated by in situ reduction on the surface of Fe3O4NPs to obtain Au@Fe3O4NPs. The signal probe DNA-Fc labeled with ferrocene (Fc) is enriched on the surface of Au@Fe3O4NPs through Au-S bonds as a signal unit. As in Chapter 1, Ru(bpy)3 2+ / TPrA system in the driving electrode anode luminescence (ECLRu ), HNCQDs / H2O2 system emits light at the BPE anode (ECL HNCQDs ). DNA-Fc / Au@Fe3O4NPs were enriched on the driving electrode anode by magnetic adsorption, and the modified Fc had an obvious effect on ECL. Ru The signal is quenched. Then, through magnetic attraction, DNA-Fc / Au@Fe3O4NPs are transferred to the cathode area of ​​BPE. Fc, as an electrochemically active substance, also has excellent conductive properties, which can accelerate the electron transfer rate of the BPE chip and enhance ECL. HNCQDs The LCR reaction was designed to amplify the target miRNA-222. The amplified product can be recognized by crRNA, activating the nonspecific cleavage activity of the CRISPR / Cas12a system, cleaving the DNA-Fc signal probe, reducing the amount of Fc, weakening the quenching effect, and ECL Ru Signal recovery. At the same time, the electron transfer rate of the BPE chip decreases, resulting in ECL HNCQDs Signal weakening. Based on the change in the signal ratio of the two ECL systems, miRNA-222 detection and analysis is achieved. Example 1

[0045] A ratiometric bipolar electrode electrochemiluminescence biosensor based on a quasi-homogeneous reaction and a BPE chip for its application are prepared as follows:

[0046] Based on the dimensions of the designed circuit on the ITO glass, the corresponding screen printing template dimensions were designed using Adobe Illustrator 2021. Using screen printing, a protective coating ink (model: Zhongyi GK-501, Zhongyi Ink and Coating Co., Ltd., China) was transferred to the ITO glass using a squeegee through the screen printing template and dried at 120°C for 12 hours. Once the ink formed a dense, smooth protective coating with a specific pattern on the ITO layer, wet chemical etching was performed using an etching solution (containing 0.5 M FeCl₃, 1 M HCl, and 1 M HNO₃). After etching, the ITO electrodes were cleaned with acetone and boiled in an isopropanol solution containing 2 M KOH for 20 minutes to remove the ink. The resulting ITO glass was cut to the appropriate size, thus constructing the initial BPE chip substrate. The polydimethylsiloxane (PDMS) membrane was prepared by mixing PDMS with a curing agent (Sylgard 184, Dow Corning) at a ratio of 10:1 (w / w). The membrane was then vacuumed for 10 minutes to remove air bubbles, cast into a mold, and crosslinked at 40°C for 6 hours. After cooling to room temperature, the membrane was demolded, and the corresponding reservoirs were cut out and bonded to the BPE chip substrate made of ITO glass to form the BPE chip. Example 2

[0047] A ratiometric bipolar electrode electrochemiluminescence biosensor based on a quasi-homogeneous reaction and the preparation and characterization of DNA-Fc / Au@Fe3O4NPs for its application are as follows:

[0048] (1) Synthesis of HNCQDs

[0049] 2.1 g of citric acid was dissolved in 15 mL of DMF, and 1.25 mL of hydrazine hydrate was then added dropwise to the resulting colloidal precursor mixture. The colloidal precursor was placed in a microwave reactor (800 W) and reacted for 300 s. A large, porous solid was obtained. 15 mL of water was added to dissolve the reaction product, and the reaction was centrifuged (10,000 rpm, 10 min) to remove the large black precipitate. After settling, the supernatant was filtered through 0.45 μm and 0.22 μm membrane filters and dialyzed against deionized water for 24 h using a dialysis bag with a molecular weight cutoff (MWCO) of 100-500 Dalton. The resulting HNCQD solid was then dried at 60°C and stored sealed and protected from light.

[0050] (2) Preparation of DNA-Fc / Au@Fe3O4NPs:

[0051] To a slightly boiling HAuCl₄ solution (0.04 wt %, 5 mL), 500 μL of Fe₃O₄ NPs (5 mg / mL, purchased from Tianjin Bestle Chromatography Technology Development Center) were added. After the solution was brought to a boil again, 100 μL of 5 wt % sodium citrate solution was added for in situ reduction to generate gold nanoparticles. The formation of gold nanoparticles was confirmed when the solution color changed from brown to purple and finally to red. After heating for 15 minutes, the solution was magnetically separated, washed three times with ultrapure water, and redispersed in 500 μL of ultrapure water to obtain Au@Fe₃O₄ NPs. Then, 200 μL of DNA-Fc (10 μM, 5'-Fc-TTATT-(CH₂)₆-SH-3', Sangon Biotech Shanghai Co., Ltd.) was mixed with 200 μL of Au@Fe₃O₄ NPs to link the DNA-Fc to the Au@Fe₃O₄ NPs via Au-S bonds. The mixture was shaken overnight at pH 7.4. Then, 200 μL of 2 wt% BSA solution was added and shaken for 1 h to block nonspecific sites. The remaining DNA-Fc was separated by magnetic washing. After washing three times, it was redispersed in 200 μL of ultrapure water to obtain DNA-Fc / Au@Fe3O4NPs. The morphology of the structure was observed under a transmission electron microscope. The results are as follows: Figure 2As shown in Figure A, the TEM image of Au@Fe3O4NPs shows that small particles with uniform particle size are evenly distributed on the surface of spherical large particles. At the same time, EDS spectrum characterization results show that it contains Au and Fe elements ( Figure 2 B in ). Example 3

[0052] The ECL characterization of the assembly process of a ratiometric bipolar electrode electrochemiluminescence biosensor based on a quasi-homogeneous reaction is as follows:

[0053] Figure 3 As shown in A, on the unmodified BPE chip (curve a), ECL Ru The size is about 17000. When Au@Fe3O4NPs are attracted to the anode area of ​​the driving electrode by magnetic attraction (curve b), its ECL Ru It increases slightly to around 17500, which may be due to the conductivity of Au NPs, and the total current in the BPE chip increases slightly. When DNA-Fc / Au@Fe3O4NPs are enriched in the anode area of ​​the driving electrode (curve c), ECL Ru The intensity decreased significantly to 3200, indicating that Fc Ru The signal has a strong quenching effect. When the LCR product of miRNA-222 activates the non-specific cleavage of DNA-Fc by Cas12a (curve d), ECL Ru It recovered to about 11,000. This was because a large number of DNA-Fc probes were broken, and the number of Fc groups carried was reduced, resulting in a decrease in ECL. Ru The quenching effect is weakened.

[0054] At the same time, we also visited ECL HNCQDs changes in Figure 3 As shown in B, in the unmodified BPE chip (curve a), ECL HNCQDs The intensity is about 2200; after Au@Fe3O4NPs are enriched in the cathode area of ​​BPE by magnetic attraction (curve b), the signal is slightly increased. After DNA-Fc / Au@Fe3O4NPs are modified in the cathode area of ​​BPE (curve c), ECL HNCQDs The intensity is significantly improved to about 7500. Cas12a is activated for nonspecific cleavage, and the amount of Fc carried by cleaved DNA-Fc / Au@Fe3O4NPs after the reaction is reduced. HNCQDs The intensity decreased (curve d). Based on LCR and CRISPR / Cas12a technologies, combined with magnetic nanomaterials to enrich signal probes, a ratiometric BPE-ECL sensor was successfully constructed for miRNA-222 detection. Example 4

[0055] A quasi-homogeneous reaction-based ratiometric bipolar electrode electrochemiluminescence biosensor for ultra-sensitive detection of miRNA-222

[0056] (1) Ligase chain reaction

[0057] 1) Phase A of the ligase chain reaction: First, using miRNA-222 as a template, probe X1 and probe Y1 recognize the target, and a ligation reaction occurs under the action of ribonucleotide ligase (SplintR Ligase, New England Biolabs) to generate single-stranded DNA. The reaction system consisted of 1X ligation buffer (New England Biolabs, pH 7.5, 50 mM Tris-HCl, 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP) in a total volume of 100 μL, containing 200 U of recombinant ribonuclease inhibitor, 50 U of SplintR ligase, probe X1 (100 nM, 5'-CAAGCATCTTTCGAGACCCAGTAG -3', Sangon Biotech Shanghai Co., Ltd.), probe X2 (100 nM, 5'- P-CCAGATGTAGCTCTCAAC -3', Sangon Biotech Shanghai Co., Ltd.), and various concentrations of miRNA-222. The reaction system was placed in a constant temperature mixer. The first stage program was set as follows: reaction temperature was 25°C and reaction time was 20 min. The second stage program was set as follows: reaction temperature was 80°C and reaction time was 20 min. The product of stage A in the ligase chain reaction was stored at 4°C.

[0058] 2) Ligase Chain Reaction (LCR) Stage B: 40 μL of ligation probes (including Probe X1, Probe Y1, Probe X2, and Probe Y2, each at a concentration of 50 to 300 nM), 5 μL of HiFi Taq DNA Ligase Reaction Buffer (New England Biolabs), and 1 μL of HiFi Taq DNA Ligase (New England Biolabs) were added sequentially to a 50 μL volume with diethyl pyrocarbonate-treated and autoclaved ultrapure water (DEPC water) to prepare the LCR Stage B system. Probe X2 was 5'-P-CCAGATGTAGCTCTCAAC -3' (Shanghai Sangon Biotech Co., Ltd.); probe Y2 was 5'-P-GTTGAGAGCTACATCTGG -3' (Shanghai Sangon Biotech Co., Ltd.). The prepared LCR Stage B system was divided into 9 μL tubes, and 1 μL of the stage A product of the ligase chain reaction with different concentrations of miRNA-222 was added to form a reaction system. The reaction system was placed in a PCR instrument. The first stage program was set as follows: reaction temperature of 95°C and reaction time of 3 min; the second stage program was set as follows: reaction temperature of 55-65°C and reaction time of 1 min; the third stage program was set as follows: reaction temperature of 95°C and reaction time of 1 min; stage 2 to stage 3 constituted one thermal cycle, with a total of 35-50 cycles. The stage B product (LCR product) in the ligase chain reaction was obtained and stored at 4°C.

[0059] (2) Ligase chain reaction combined with CRISPR / Cas12a

[0060] 48 μL of DEPC water, 10 μL of reaction buffer solution (10X NEBuffer 2.1 Reaction Buffer, New England Biolabs), 10 μL of crRNA (2 μM, 5'-UAAUUUCUACUAAGUGUAGAUGAGACCCAGUAGCCAGAUG -3', Shanghai Biotech Co., Ltd.), 10 μL of DNA-Fc / Au@Fe prepared in Example 2 were added in sequence.

[0061] (3) Signal detection of ratiometric BPE-ECL biosensor based on quasi-homogeneous reaction

[0062] The HNCQDs / H2O2 system (50 μL 0.1 M PBS buffer solution containing 0.05-0.5 M H2O2 and 10-75 μg / mL HNCQDs) was added to the anode cell of the BPE chip prepared in Example 1. Ru(bpy)3 was added to the cathode cell of the BPE chip prepared in Example 1. 2+ / tripropylamine (TPrA) system (50 μL of 0.1 M PBS buffer containing 50 ~ 100 μM Ru(bpy)3 2+ and 25 ~ 75 mM TPrA). Then, 20 μL of the LCR product obtained in step (1) of Example 4 with different concentrations of miRNA-222 amplification was added to the prepared 80 μL CRISPR / Cas12a reaction system (containing DNA-Fc / Au@Fe3O4NPs) obtained in step (2) of Example 4. After reacting at 37 °C for 2 h, the reacted DNA-Fc / Au@Fe3O4NPs was extracted by magnetic separation and added dropwise to the BPE cathode pool. DNA-Fc / Au@Fe3O4NPs were aggregated in the anode area of ​​the driving electrode by magnetic attraction. Cyclic voltammetry was used with a scanning voltage of 0 ~ 4 V, a scanning rate of 0.2 V / s, and a photomultiplier tube voltage of 800 V to detect ECL. Ru DNA-Fc / Au@Fe3O4NPs were gathered in the cathode area of ​​BPE by magnetic attraction, and the same electrochemical method and parameter settings were used to detect ECL. HNCQDs strength.

[0063] Under the optimal experimental conditions, the ratiometric BPE-ECL biosensor was constructed to detect different concentrations of miRNA-222. Ru The intensity-time curve is as follows Figure 4 As shown in A, ECL Ru The intensity increases with the increase of miRNA-222 concentration. Due to the increase of LCR products, a large number of Cas12a are activated to cut DNA-Fc, the number of Fc decreases, the quenching effect weakens, and the signal recovers. At the same time, the target concentration increases, the number of Fc decreases, the electron transfer rate of the BPE chip decreases, and the ECL HNCQDs The signal gradually decreases ( Figure 4 In addition, ECL Ru / ECL HNCQDs The value showed an exponential growth trend with the concentration of miRNA-222 ( Figure 4 C in ECL Ru / ECLHNCQDs The logarithm of the value was taken when the miRNA-222 concentration was 0.1 aM−10 6 In the range of aM, lg(ECL Ru / ECL HNCQDs ) and lg C miRNA-222 There is a good linear relationship between Figure 4 D in), correlation coefficient ( R 2 ) is: 0.997, the linear equation is lg(ECL Ru / ECL HNCQDs ) = 0.1380lg C miRNA-222 The detection limit was − 0.1178, and the detection limit was as low as 0.051 aM. These results indicate that the ratiometric BPE-ECL biosensor based on LCR and CRISPR / Cas12a has high sensitivity and good application prospects for the detection of miRNA-222.

[0064] Description of Sequence Listing:

[0065] Sequence number 1: Probe X1, sequence: 5′- CAAGCATCTTTCGAGACCCAGTAG -3′;

[0066] Sequence number 2: Probe Y1, sequence: 5'- P- CCAGATGTAGCTCTCAAC -3';

[0067] Sequence number 3: Probe X2, sequence: 5′- P-CTACTGGGTCTCGAAAGATGCTTG -3′;

[0068] Sequence number 4: Probe Y2, sequence: 5'- P- GTTGAGAGCTACATCTGG -3';

[0069] SEQ ID NO: 5: crRNA, sequence: 5'-UAAUUUCUACUAAGUGUAGAUGAGACCCAGUAGCCAGAUG -3';

[0070] SEQ ID NO: 6: miRNA-222 sequence: 5'-AGCUACAUCUGGCUACUGGGUCUC-3'.

[0071] The DNA and RNA sequences in the sequence listing provided by the present invention are known. If a "u" is present in any residue, the "u", the initial "-" and the letters and numbers preceding it, and the final "-" and the letters and numbers following it are omitted. The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention are intended to be included within the scope of protection of the present invention.

Claims

1. A ratiometric bipolar electrode electrochemiluminescence biosensor based on a quasi-homogeneous reaction, characterized in that: The biosensor includes signal probe-modified magnetic nanomaterials DNA-Fc / Au@Fe3O4 NPs, enzymes and nucleic acid probes required for the combination of ligase chain reaction and CRISPR / Cas technology, dual-anode ECL luminescent probes and co-reactants, and a bipolar electrode chip constructed based on ITO and PDMS. The biosensor is used for ultra-high sensitivity detection of miRNA-222. The dual-anode ECL luminescent probe and co-reactant are HNCQDs / H2O2 system and Ru(bpy)3 2+ / TPrA system; HNCQDs / H2O2 system was added to the anode tank; Ru(bpy)3 was added to the cathode tank. 2+ / TPrA system; 20 μL of ligase chain reaction products amplified by miRNA-222 at different concentrations were added to the CRISPR / Cas12a reaction system containing DNA-Fc / Au@Fe3O4 NPs. After reacting at 37 °C for 2 h, the reacted DNA-Fc / Au@Fe3O4 NPs were extracted by magnetic separation and added dropwise to the cathode pool of the bipolar electrode; DNA-Fc / Au@Fe3O4 NPs were aggregated at the anode area of ​​the driving electrode by magnetic attraction, and cyclic voltammetry was used to detect Ru(bpy)3 2+ Signal ECL of / TPrA system Ru Intensity; DNA-Fc / Au@Fe3O4 NPs were aggregated in the cathode area of ​​the bipolar electrode by magnetic attraction, and the signal ECL of the HNCQDs / H2O2 system was detected using the same electrochemical method and parameter settings. HNCQDs strength; The HNCQDs were synthesized by the following steps: 2.1 g of citric acid was dissolved in 15 mL of DMF, and then 1.25 mL of hydrazine hydrate was dropwise added to form a colloidal mixed precursor; the colloidal mixed precursor was placed in an 800 W microwave reaction device and reacted for 300 seconds to obtain a large porous solid; 15 mL of water was added to dissolve the reaction product, and the reaction product was centrifuged at 10,000 rpm for 10 minutes to remove large black precipitates. The supernatant was filtered through 0.45 μm and 0.22 μm filters, and dialyzed in deionized water for 24 hours using a dialysis bag with a molecular weight cutoff of 100-500 Dalton. The product was then dried at 60°C to obtain HNCQDs solid, which was sealed and stored in the dark.

2. A ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction according to claim 1, characterized in that: The concentration of the signal probe-modified magnetic nanomaterial DNA-Fc / Au@Fe3O4 NPs is 2.5-10 mg / mL, and the preparation method thereof comprises the following steps: (1) Preparation of Au@Fe3O4NPs: Add 500μL Fe3O4NPs to 5mL of 0.04wt% HAuCl4 solution at a slight boiling point. After the solution is boiled again, add 100μL of 5wt% sodium citrate solution to generate gold nanoparticles by in situ reduction. When the color of the solution changes from brown to purple and finally to red, it indicates that gold nanoparticles are generated. After heating for 15 minutes, the solution is magnetically separated, washed three times with ultrapure water, and redispersed in 500μL ultrapure water to obtain Au@Fe3O4NPs. (2) Preparation of DNA-Fc / Au@Fe3O4 NPs: 200 μL of 10 μM DNA-Fc was mixed with 200 μL of Au@Fe3O4 NPs prepared in step (1). DNA-Fc was connected to Au@Fe3O4 NPs through Au-S bonds. The mixture was shaken overnight at pH 7.

4. Then, 200 μL of 2 wt% BSA solution was added and shaken for 1 h to block nonspecific sites. The remaining DNA-Fc was separated by magnetic washing. After washing three times, the mixture was redispersed in 200 μL of ultrapure water to obtain DNA-Fc / Au@Fe3O4 NPs.

3. The ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction according to claim 1, characterized in that: The bipolar electrode driving voltage is 0~4V.

4. The ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction according to claim 1, characterized in that: In the combination of ligase chain reaction and CRISPR / Cas technology, nucleic acid probes used to detect miRNA-222 include: (1) Probe X1, sequence: 5'-CAAGCATCTTTCGAGACCCAGTAG -3'; (2) Probe Y1, sequence: 5′- P- CCAGATGTAGCTCTCAAC -3′; (3) Probe X2, sequence: 5'-P-CTACTGGGTCTCGAAAGATGCTTG -3'; (4) Probe Y2, sequence: 5′- P-GTTGAGAGCTACATCTGG -3′; (5) crRNA, sequence: 5'-UAAUUUCUACUAAGUGUAGAUGAGACCCAGUAGCCAGAUG -3'.

5. The ratiometric bipolar electrode electrochemiluminescence biosensor based on quasi-homogeneous reaction according to claim 4, characterized in that: The concentrations of the nucleic acid probes Probe X1, Probe Y1, Probe X2, and Probe Y2 used in the ligase chain reaction were 50 to 300 nM; the number of thermal cycles was 35 to 50; and the temperature during the thermal cycle amplification phase was 55 to 65°C.

Images