Application of ZmPIF2 gene or its protein in regulating maize plant height

Abstract

The present invention belongs to the field of agricultural biotechnology, and discloses the use of the ZmPIF2 gene or its protein in regulating the plant height of maize. The present invention also discloses a method for reducing the plant height of maize. After knocking out the ZmPIF2 gene by using the CRISPR / Cas9 technology, the plant height of maize is significantly reduced, indicating that the ZmPIF2 gene can significantly regulate the plant height of maize plants, which has important theoretical and practical significance for the genetic improvement of plant height and the cultivation of dwarf maize.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and specifically relates to the use of the ZmPIF2 gene or its protein in regulating the plant height of maize. Background Art

[0002] In recent years, with the continuous growth of the population, the continuous deterioration of the environment, and the continuous reduction of arable land area, the productivity and planting area of maize have declined, resulting in a severe crisis in maize yield. Increasing yield has become an important task in maize production, and lodging problems accompany high yields. After maize lodges, the canopy structure of the plant is damaged, the photosynthetic ability is weakened, and the seed setting rate also decreases. At the same time, it also seriously affects the appearance, cooking taste, and nutritional quality of maize. The lodging resistance of maize itself is greatly affected by plant height. Therefore, the genetic mechanism related to reducing maize plant height has always been a research hotspot for maize genetic breeders.

[0003] Maize plant height and maize ear height are important factors affecting lodging resistance and maize yield, which are typical quantitative traits controlled by multiple genes. Many scholars at home and abroad have studied this trait. After years of research, certain achievements have been made in the molecular genetic mechanism of maize plant height, but the gene resources are relatively scarce, and more excellent alleles need to be mined and utilized urgently. Moreover, reports on reducing maize plant height through genetic engineering technology are still quite limited. Therefore, using genetic engineering technology to select genes for breeding is the focus of research.

[0004] The ZmPIF2 gene is a member of the phytochrome-interacting factor (PIF) family in maize, and was identified by Gao et al. (2015) through homology analysis in the maize genome. Currently, it is known that this gene is involved in the photoperiod-sensitive regulation network of maize and affects the flowering time of maize. There are no reports on its relationship with maize plant height. Summary of the Invention

[0005] The present invention provides the application of the ZmPIF2 gene or its protein in regulating maize plant height, which provides a good theoretical basis for the genetic improvement of maize plant height and the cultivation of dwarf maize, and also provides a scientific basis for further fully exploring the production potential of maize and increasing maize yield.

[0006] The technical solution provided by the present invention is as follows:

[0007] The application of the ZmPIF2 protein composed of the amino acid sequence shown in SEQ ID NO:1, or the gene encoding the protein shown in SEQ ID NO:2, or an expression cassette, recombinant vector, or recombinant microorganism containing the gene in regulating maize plant height.

[0008] Further, the regulation of maize plant height is to reduce maize plant height.

[0009] The present invention also provides a method for reducing the plant height of maize, which inhibits the expression of the maize ZmPIF2 gene and / or reduces the activity of the protein encoded by the ZmPIF2 gene.

[0010] The present invention also provides a method for cultivating dwarf maize, which selects maize plants with reduced or no expression of the ZmPIF2 gene, reduced or no expression of the ZmPIF2 protein, and / or reduced or no activity of the ZmPIF2 gene protein to obtain dwarf maize.

[0011] Furthermore, when breeding maize, at least one parent is the above-mentioned dwarf maize.

[0012] Furthermore, the ZmPIF2 gene in maize is knocked out.

[0013] The present invention also provides a method for cultivating maize with a low ear position, which selects maize plants with reduced or no expression of the ZmPIF2 gene, reduced or no expression of the ZmPIF2 protein, and / or reduced or no activity of the ZmPIF2 gene protein to obtain maize with a low ear position.

[0014] Furthermore, the ZmPIF2 gene in maize is knocked out.

[0015] Furthermore, two target sites are designed for the ZmPIF2 gene and a CRISPR vector is constructed. The sgRNA target sequences are as follows:

[0016] Target site 1: GCATGCCTCGGACACCACCAAGG

[0017] Target site 2: CCCCGTCGAGTCCACGGTCGTCC.

[0018] Furthermore, after constructing the CRISPR vector, maize genetic transformation is carried out to obtain positive seedlings.

[0019] The purpose of the present invention is to provide a new use of the maize ZmPIF2 gene.

[0020] The present invention provides the use of the ZmPIF2 gene or its protein in regulating the plant height of maize.

[0021] The present invention also provides a method for reducing maize plants, which inhibits the expression of the maize ZmPIF2 gene and / or reduces the activity of the protein encoded by the ZmPIF2 gene.

[0022] The present invention also provides the use of the ZmPIF2 gene or its protein in screening dwarf maize.

[0023] The present invention also provides a method for screening dwarf maize, which includes the following steps:

[0024] Select maize plants with reduced or no expression of the ZmPIF2 gene, reduced or no expression of the ZmPIF2 protein, and / or reduced or no protein activity of the ZmPIF2 gene.

[0025] Beneficial effects

[0026] Maize plant height is a key factor affecting maize yield and lodging resistance. Studies have also found that as the maize plant height decreases, the plant type becomes compact, the ear position decreases, and it is more suitable for high-density planting. These characteristics endow maize with strong lodging resistance and light energy utilization efficiency, promoting an increase in yield. We found that after knocking out the ZmPIF2 gene in maize, the plant height decreased significantly, the lodging resistance increased, and the yield also increased, providing a good theoretical basis for the genetic improvement of plant height and the cultivation of maize with lodging resistance and high yield. It also provides a scientific basis for further fully exploring the production potential of maize and increasing maize yield, with good application prospects. Description of the drawings

[0027] Figure 1 Electrophoresis pattern of overexpression line OE10: M: Marker DL2000; 1 - 12: PCR product bands for identification of T2 - generation pure lines, 13: negative control, water; 14: positive control, plasmid;

[0028] Figure 2 Analysis of ZmPIF2 expression levels in overexpression lines OE2, OE7, and OE10;

[0029] Figure 3 Comparison chart of plant heights of different maize lines;

[0030] Figure 4 Statistical chart of plant heights of different maize lines;

[0031] Figure 5 Knockout site and sequencing peak map. Detailed implementation manners

[0032] The following is a further detailed description of the above content of the present invention through specific implementation manners in the form of examples. However, this should not be construed as limiting the scope of the above - mentioned subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention.

[0033] Example 1 Construction and identification of ZmPIF2 overexpression lines

[0034] I. Construction of overexpression vector for the ZmPIF2 gene

[0035] Previously, the full-length ZmPIF2 gene (SEQ ID NO: 2) was cloned from the wild-type KN5585, and ZmPIF2 encodes a protein consisting of 505 amino acids (SEQ ID NO: 1). Then, the p3301 vector containing BamHI + KpnI restriction sites was double-digested, and homologous arms with sequences at both ends of the vector restriction sites were added to both ends of ZmPIF2. The digested vector and ZmPIF2 with homologous arms were recovered using a DNA recovery kit. ZmPIF2 was homologously recombined with the digested vector, and the resulting vector was named p3301-ZmPIF2, which was sent to Baige Gene Company for maize transformation to obtain T0 generation transgenic seedlings, and positive seedlings were identified.

[0036] Full-length ZmPIF2 sequence (SEQ ID NO: 2, 1518bp) in wild-type KN5585

[0037]

[0038] ZmPIF2 Amino Acid Sequence (SEQ ID NO:1)

[0039] MPVSISICRTGPGEELAELLWDRGPALRRAPPPFQPFTCSAAGSSRSQELKRHASDTTKASAFVTAVSVPLGTHDAGSGLGLAGLPVHDDDDAVPWLHCPVADDGDGDTAPLPPEFCAGLLSEYSEVAAPAPAFHAAATPPAEAAANKLAPPSAAGGGEGVLNFTFFSRPLQRPQAAAAPAAAAASNPVESTVVQAAANRLRSTPLFSEQRMAWLQPPKAPRTTAAAAAPPPPPLAPLLPDSRHGETVGTVAQPQPRSQPEARPPDAAAVTTSSVCSGNGGRSQLKRSRHLAADCSVSPDEDLDDEPGATRRSAARSAKRCRTAEVHNLSERRRRDRINEKMRALQELIPNCNKVDKSSMLEEAIEYLKTLQLQVQMMSMGTGLCMPPAAMLLPAMQQQLLHHHPMAHFPHLGMGLGFGMGAAAGFDMLPFPCVAAGAHFPCPPGAMFGVPGQAMPSLPAAFAHMYGAGSGAGPAGQTEAADAAAPARPGEAEQGDQQVQHAKQT

[0040] II. Identification of Overexpression Pure Lines of ZmPIF2 Gene

[0041] Extract the DNA of ZmPIF2 transgenic positive maize plants by the CTAB method. The specific steps are as follows:

[0042] (1) Take about 200 mg of fresh leaves and add them to a 2 ml centrifuge tube. Grind them into powder with liquid nitrogen freezing or a grinder.

[0043] (2) Add 600 μl of 2×CTAB preheated at 65°C, mix well and incubate in a 65°C water bath for 20 min. During this period, shake up and down 2 - 3 times to fully lyse the cells.

[0044] (3) Add 600 μl of chloroform / isoamyl alcohol (24:1), invert and mix well for 1 min, then let it stand for 3 - 5 min to separate the layers.

[0045] (4) Centrifuge at 10000 r / min for 10 min, carefully take the supernatant to a new 1.5 ml centrifuge tube.

[0046] (5) Add an equal volume of isopropanol pre-cooled to -20°C, invert the tube up and down to mix well, and place it in an environment at -20°C for 30 min to precipitate the DNA.

[0047] (6) Centrifuge at 12,000 r / min for 10 min, pour off the supernatant, add 0.5 ml of 70% ethanol solution, invert the tube up and down to wash the DNA precipitate (if the DNA precipitate slides or floats, etc., after washing, it can be centrifuged at 12,000 r / min for 5 min to make the DNA adhere to the bottom of the tube), and then pour off the ethanol solution (note not to pour off the white DNA precipitate at the bottom of the centrifuge tube).

[0048] (7) After pouring off the ethanol, air-dry the DNA precipitate at room temperature.

[0049] (8) Add 200 μl of pure water to dissolve the DNA and store it at 4°C for later use.

[0050] The 2X CTAB solution is prepared as follows:

[0051] CTAB powder: 4 g, NaCl: 16.364 g, 1M Tris-HCl: 20 ml (pH = 8.0), 0.5M EDTA: 8 ml, dissolve with ultrapure water, then make up the volume to 200 ml, add mercaptoethanol after autoclaving.

[0052] Perform PCR amplification on the obtained genomic DNA using detection primers. Take 2 μl of transgenic maize DNA as the template and use the detection primers:

[0053] F: 5’-TGACGACCTCTTCGGTCTG-3’ (SEQ ID NO.3),

[0054] R: 5’-TGATAATCATCGCAAGACCGG-3’ (SEQ ID NO.4) for PCR amplification.

[0055] The amplification conditions are: preheat at 95°C for 5 min; 95°C, 45 s, 61°C, 30 s, 72°C, 60 s, for a total of 38 cycles; 72°C, 10 min.

[0056] The amplification system is: 2x Es Tag MasterMix (ComWin Biotech) 10 μl, 1 μl each of the forward and reverse primers, 7 μl of ddH2O, 1 μl of DNA.

[0057] Amplify the target fragment with a length of 913 bp (see Figure 2) After sequencing, it was proven that this fragment was a fragment of the recombinant vector p1011-ZmPIF2, indicating that the recombinant vector had been transformed into maize. According to the pure line calculation method, if more than 10 individual plants were positive, then the line was considered a pure line. Therefore, they were named OE2, OE7, and OE10.

[0058] II. Identification of the ZmPIF2 gene knockout pure lines

[0059] CRISPR target sites were designed by Baige Company. Two target sites were designed for the ZmPIF2 gene and a CRISPR vector was constructed. The sgRNA target site design for this material is as follows:

[0060] Target site 1: GCATGCCTCGGACACCACCAAGG (SEQ ID NO.5)

[0061] Target site 2: CCCCGTCGAGTCCACGGTCGTCC (SEQ ID NO.6)

[0062] Then maize genetic transformation was carried out and positive seedlings were obtained. After sequencing, two pure lines of ZmPIF2 knockout lines were obtained and named KO-2 and KO-7. The knockout sites and sequencing peak maps are as Figure 5 shown:

[0063] WT: Target site 1 GCATGCCTCGGACACCACCAAGG (SEQ ID NO.7)

[0064] Target site 2 CCCCGTCGAGTCCACGGTCGTCC (SEQ ID NO.8)

[0065] KO-2: Target site 1 GCATGCCTCGGACACC...AAGG (SEQ ID NO.9)

[0066] (Three bases A, C, C were deleted at 172bp)

[0067] Target site 2 CCCCGTACGAGTCCACGGTCGTCC (SEQ ID NO.10)

[0068] (One base A was added at 567bp)

[0069] KO-7: Target site 1 GCATGCCTCGGACACCAACCAAGG (SEQ ID NO.11)

[0070] (One base A was added at 172bp)

[0071] Target site 2 CCCCGTCCGAGTCCACGGTCGTCC (SEQ ID NO.12)

[0072] (Addition of C base at 567bp)

[0073] Example 2 Measurement of the expression level of ZmPIF2 overexpression lines

[0074] I. Extraction of total RNA from maize and synthesis of cDNA

[0075] Plant KN5585, OE2, OE7, and OE10 until the three-leaf and one-heart stage, and follow the product instruction manual of RNAiso Plus from Takara. Grind the maize samples into powder quickly in liquid nitrogen, add RNAiso Plus, shake vigorously, place on ice for a while, centrifuge and aspirate the supernatant, then add chloroform for extraction. Mix the supernatant with an equal volume of isopropanol to precipitate RNA. After centrifuging to remove isopropanol, wash the RNA precipitate with 75% alcohol. After the alcohol evaporates, dissolve the RNA with DEPC water. Then reverse transcribe the extracted total RNA into cDNA. The cDNA is synthesized using the PrimeScript TM RT MasterMix (Perfect Real Time) reagent from Takara.

[0076] II. Analysis of gene expression by fluorescence quantitative PCR

[0077] Use the 7300 fluorescence quantitative instrument from ABI to perform fluorescence quantitative analysis of gene expression. The expression levels of ZmPIF2 in wild-type KN5585, OE2, OE7, and OE10 are shown in Figure 2 .

[0078] Example 3 Verification of the effect of ZmPIF2 on regulating maize plant height

[0079] Plant the identified ZmPIF2 knockout lines KO-2 and KO-7 and overexpression lines OE2, OE7, and OE10 in the experimental field of the College of Bioscience and Biotechnology, Yangzhou University. After they mature, harvest them and count the plant height.

[0080] The statistical data is analyzed using the software prism5.0, and the analysis method is one-way analysis of variance (One-way ANOVA).

[0081] The statistical results are shown in Table 1.

[0082] Note in the table: Compared with the wild-type KN5585, * indicates significant difference; ** indicates extremely significant difference.

[0083] Table 1 Plant height statistics of different maize lines

[0084] Strain Plant height (cm) KN5585 165.50±3.26 OE2 181.75±5.43** OE7 181.17±5.43** OE10 191.80±5.27** KO-2 141.38±6.24** KO-7 150.60±8.36**

[0085] As can be seen from Table 1, compared with the wild-type variety, the plant height of the ZmPIF2 overexpression lines increased significantly, ranging from 9% to 16%; while the plant height of the ZmPIF2 knockout lines decreased significantly, ranging from 9% to 15%; indicating that ZmPIF2 plays an important role in regulating maize plant height.

[0086] In summary, the ZmPIF2 gene can significantly regulate maize plant height and can be used for genetic improvement of plant height and enhancing lodging resistance and yield.

Claims

1. Use of a protein consisting of the amino acid sequence shown in SEQ ID NO:1 ZmPIF2 , a gene encoding the protein shown in SEQ ID NO:2, an expression cassette containing the gene, a recombinant vector, or a recombinant microorganism in regulating the plant height of maize.

2. A method for reducing the plant height of corn, characterized in that, Suppress maize ZmPIF2 gene expression, and / or reduce ZmPIF2 the activity of the protein encoded by the gene, wherein the maize ZmPIF2 gene has a sequence as shown in SEQ ID NO:2; the ZmPIF2 sequence of the protein encoded by the gene is as shown in SEQ ID NO:

1.

3. A method for cultivating dwarf corn, characterized in that, Select ZmPIF2 with reduced or no gene expression, ZmPIF2 reduced or no protein expression, and / or ZmPIF2 maize plants with reduced or no protein activity to obtain dwarf maize, wherein the ZmPIF2 sequence of the gene is as shown in SEQ ID NO:2; the ZmPIF2 sequence of the protein encoded by the gene is as shown in SEQ ID NO:

1.

4. The method for cultivating dwarf maize according to claim 3, characterized in that, When breeding maize, at least one parent is the dwarf maize described in claim 3.

5. The method for cultivating dwarf corn according to claim 3, characterized in that, Knock out the ZmPIF2 gene in corn.

6. The method according to claim 5, characterized in that, For ZmPIF2 Two target sites were designed for the gene and a CRISPR vector was constructed. The sequences of the sgRNA target sites are as follows: Target 1: GCATGCCTCGGACACCACCAAGG Target 2: CCCCGTCGAGTCCACGGTCGTCC.

7. The method according to claim 6, characterized in that, After constructing the CRISPR vector, maize genetic transformation is carried out and positive seedlings are obtained.

8. A method for cultivating maize with a low ear position, characterized in that, Select ZmPIF2 with reduced or no gene expression, ZmPIF2 reduced or no protein expression, and / or ZmPIF2 maize plants with reduced or no protein activity to obtain maize with a low ear position, wherein the ZmPIF2 sequence of the gene is shown in SEQ ID NO:2; the ZmPIF2 amino acid sequence of the protein is shown in SEQ ID NO:

1.

9. The method for cultivating low-ear-position corn according to claim 8, wherein, Knock out the ZmPIF2 gene in corn.

10. The method according to claim 9, wherein For ZmPIF2 Two target sites were designed for the gene and a CRISPR vector was constructed. The sgRNA target site sequences are as follows: Target 1: GCATGCCTCGGACACCACCAAGG Target 2: CCCCGTCGAGTCCACGGTCGTCC.

11. The method according to claim 10, wherein After constructing the CRISPR vector, maize genetic transformation is carried out and positive seedlings are obtained.

Images