Tomato plants resistant to ToBRFV, TMV, ToMV and ToMMV and the corresponding resistance genes

Abstract

Tomato plants resistant to ToBRFV, TMV, ToMV and ToMMV and the corresponding resistance genes The present invention relates to variants of the TM-2-2 protein which confer recognition of the movement protein (MP) of Tomato Brown Rugose Fruit Virus (ToBRFV) and wherein said variants comprise a tyrosine (Y), phenylalanine (F) or tryptophan (W) at a position corresponding to tyrosine 767 of the TM-2-2 protein and at least one of the following mutations associated with TM-2-2 protein: C848R, N822C, N822F, N822M, N822Y, N822W, S825H, S825K and S825T, possibly in combination with the F655L mutation. The invention also relates to genetic sequences encoding such variant proteins, preferably to mutated Tm-2-2 genes, and to plants, in particular tomato plants, comprising said mutated genes conferring resistance to ToBRFV in their genome. The invention also relates to parts of these plants and progeny and to the use of these sequences for providing ToBRFV resistance.

Description

Technical Field

[0001] The present invention relates to resistance of tomato (Solanum lycopersicum) (also known as Lycopersicum sculentum) plants to tobamoviruses, in particular to Tomato Brown Rugose Fruit virus (ToBRFV, formerly abbreviated TBRFV), and preferably also to Tobacco Mosaic Virus (TMV), Tomato Mosaic Virus (ToMV) and / or Tomato Mottle Mosaic Virus (ToMMV). More specifically, the present invention relates to tomato plants and fruits comprising resistance genes that confer resistance to at least ToBRFV and preferably to at least one additional tobacco mosaic virus. According to the present invention, the resistance genes that confer resistance to these tobacco mosaic viruses are variants of the Tm-2 and Tm-2-2 gene alleles. The resistance genes may be present in the genome of the tomato plant either homozygously or heterozygously. The present invention also relates to the resistance gene, its parts, the encoded polypeptides and proteins and the use of these sequences and proteins for obtaining resistant plants. The present invention also relates to the seeds and offspring of such plants, the propagation materials for obtaining such plants and the different uses of these plants. Background Art

[0002] All cultivated and commercial forms of tomatoes belong to a species most commonly known as Lycopersicon esculentum Miller. Lycopersicon is a relatively small genus within the extremely large and diverse Solanaceae family, which is thought to consist of approximately 90 genera, including peppers, tobacco, and eggplant. The genus Lycopersicon is divided into two subgenera, the esculentum complex, which contains species that can be easily hybridized with commercial tomatoes, and the peruvianum complex, which contains species that are difficult to hybridize. Due to its value as an agricultural crop, the tomato (Lycopersicon esculentum Miller) has spread widely throughout the world.

[0003] Tomatoes are cultivated for their fruit and are widely consumed fresh or as processed products. As an agricultural crop, tomatoes are grown commercially wherever environmental conditions permit economically viable yields. Most fresh-table tomatoes are hand-picked on the vine at the ripe, green stage. Fresh-table tomatoes are available year-round. Processing tomatoes are mostly harvested mechanically and used in a variety of forms, such as canned tomatoes, tomato juice, tomato sauce, tomato puree, tomato paste, and even tomato sauce (catsup).

[0004] Tomatoes are generally a simple diploid species with twelve pairs of differentiated chromosomes. However, polyploid tomatoes are also part of the present invention. Cultivated tomatoes are self-fertile and almost completely self-pollinating. Tomato flowers are hermaphroditic. Commercial cultivars were originally open-pollinated. Since hybrid vigor has been identified in tomatoes, hybrid varieties are becoming increasingly popular with farmers due to their higher yields and consistent plant characteristics. Tomatoes are intensively cultivated because of their wide distribution and high value. This explains why there are so many different varieties of tomatoes available today. Shapes may range from small to large, including cherry, plum, pear, blocky, round, and beefsteak types.

[0005] Tomatoes can be harvested in groups based on how long it takes the plant to mature its fruit. Generally speaking, cultivars are considered early, mid-ripening, or late. Tomatoes can also be grouped based on the plant's growth habit: determinate, semi-determinate, or indeterminate. Determinate plants tend to produce leaves first, then flowers. If pollinated, these flowers produce fruit. All the fruit on a plant tend to mature at approximately the same time. Indeterminate tomatoes begin with some leaves and continue to produce leaves and flowers throughout the growing season. These plants often produce tomatoes at different stages of maturity at any given time. Semi-determinate tomatoes are phenotypically between determinate and indeterminate varieties. They are typical determinate varieties, but they grow larger than determinate varieties. Recent developments in tomato breeding have resulted in a wider variety of fruit colors. In addition to the standard ripe red, tomatoes can also be creamy white, lime green, pink, yellow, gold, orange, or purple.

[0006] Hybrid commercial tomato seed can be produced through hand pollination. Pollen from the male parent is harvested and manually applied to the stigma surface of the female inbred line. Before and after hand pollination, the flowers are covered so that insects do not introduce foreign pollen, creating a mixture or impurity. Flowers are labeled to identify the pollinated fruit from which seeds will be harvested.

[0007] A variety of pathogens affect the productivity of tomato plants, including viruses, fungi, bacteria, nematodes, and insects. Tomatoes are particularly susceptible to many viruses, making viral resistance of interest in agriculture.

[0008] Tobacco mosaic virus (Tobamoviruses) is one of the most important plant viruses, causing serious damage to agriculture, especially to vegetable and ornamental crops around the world. Tobacco mosaic virus is easily transmitted mechanically and also easily spread through seeds. The general characteristic of tobacco mosaic virus is a rod-shaped particle of about 300 nm, which encloses a single-stranded positive RNA genome encoding four proteins. In tomatoes, tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) are feared by growers all over the world because they can seriously damage crop production, for example by irregular ripening (light yellow spots on the fruit surface and brown spots below the surface). However, over the years, plant breeders have identified several genes, and now there are tomato varieties that are resistant to TMV and / or ToMV.

[0009] Another tobacco mosaic virus, Tomato mottle mosaic virus (ToMMV), was recently described to infect tomato plants in several countries around the world, reducing the annual yield and quality of tomato production.

[0010] Tobacco mosaic virus (TMV) belongs to the alpha supergroup virus. It possesses a protein rod composed of copies of the coat protein (CP) encapsidating a linear RNA (+) genome. Upon infection of plant cells, the RNA genome is uncoated and transcribed, producing RNA-dependent RNA polymerase (RdRP), movement protein (MP), and coat protein (CP). Infection of neighboring cells and long-distance transport of the virus are both dependent on the movement protein (MP).

[0011] Resistance to pathogens such as tobacco mosaic virus (TMV) requires the presence of resistance (R) genes, whose polypeptide products, R proteins, can recognize TMV products and subsequently trigger a defense response, typically a hypersensitive response.

[0012] All modern indeterminate tomato varieties and many determinate tomato varieties grown over the past few decades do contain the Tm-2 gene, or a Tm-2 variant of the gene. 2 (also known as Tm-2-2) alleles as resistance genes. These genes, introgressed from Peruvian tomato (S. peruvianum), indeed conferred immunity to nearly all known tobacco mosaic virus species (ToMV and TMV) that affected commercial tomatoes before 2014. The resistance gene Tm-2-2 also appears to confer resistance primarily to ToMMV (Nagai et al., 2019; Sui et al., 2017).

[0013] The Tm-2 (SEQ ID No: 2) and Tm-2-2 (SEQ ID No: 3) resistance genes are considered alleles and share the movement protein (MP) of ToMV as a matching avirulence (Avr) protein. The TM-2 and TM-2-2 proteins (SEQ ID No: 7 and SEQ ID No: 8, respectively) have the hallmarks of a nucleotide binding site / leucine-rich repeat (NBS-LRR protein, also known as NLR protein) and are significantly different from the polypeptide (SEQ ID No: 6) encoded by the TM-2 allele (SEQ ID No: 1) isolated from a susceptible tomato (L. esculentum) line (Lanfermeijer et al., 2003). Tm-2 and Tm-2-2 mediated resistance requires these NLR proteins to recognize the movement protein (MP) of tobacco mosaic virus (Calder and Palukaitis, 1992; Meshi et al., 1989; Weber and Pfitzner, 1998; Weber et al., 1993).

[0014] The differences between the tm2 and Tm-2 gene products are concentrated in the leucine-rich repeat (LRR) domain, as well as between the Tm-2 and Tm-2-2 genes (Lanfermeijer et al., 2005).

[0015] During 2014-2015, a severe outbreak of a virus affected tomato production areas in the Middle East (e.g. Jordan and Israel). Most of the tomato varieties affected were considered resistant to TMV and / or ToMV, but were still severely affected and exhibited typical TMV / ToMV-like symptoms: while the foliar symptoms were very similar to TMV / ToMV symptoms, the fruit symptoms were more frequent and severe than common symptoms caused by such viruses, with fruit damage and deformities appearing. Fruit quality was very poor and quite unsalable. Salem et al., 2015 sequenced this new tobamovirus species and proposed the denomination of this Jordanian virus as: Tomato Brown Rugose Fruit virus (previously TBRFV, now ToBRFV). Comparison to other tobamovirus sequences indicated that it is indeed a tobamovirus, but not TMV or ToMV. Resistance to TMV and / or ToMV does not confer resistance to this new virus, ToBRFV; i.e. plants comprising the Tm-2 or Tm-2-2 resistance genes are still susceptible to ToBRFV.

[0016] Luria et al., in 2017, simultaneously isolated and sequenced the complete genome of the Israeli tobacco mosaic virus that infects Israeli tomatoes. They showed very high sequence identity (more than 99% sequence identity) between the Israeli and Jordanian viruses and derived two different isolates of the tomato brown wrinkled fruit virus.

[0017] Recently, the virus has been detected in Europe, particularly in Sicily, Germany, the Netherlands, and France, as well as in Mexico, and is now considered a major global threat to tomato crops. Therefore, identifying resistance genes against this novel tobacco mosaic virus has become important and urgent for tomato breeders.

[0018] The identification of tomato plants showing resistance to ToBRFV, as well as the mapping and identification of genetic determinants (hereinafter also referred to as QTLs (quantitative trait loci)) responsible for resistance to Tomato Brown Rough Fruit Virus, were recently described in WO2018 / 219941. Two QTLs, QTL1 and QTL2, located on chromosomes 6 and 9, respectively, when homozygously present in a tomato (S. lycopersicum) background, can independently or in combination confer improved tolerance or resistance to the fruits of tomato plants infected or potentially infected with ToBRFV. A third QTL, QTL3, is located on chromosome 11 and, when homozygously present, can confer improved tolerance or resistance to the leaves of tomato plants infected or potentially infected with ToBRFV.

[0019] Although these QTLs, either individually or in combination, confer tolerance or resistance to ToBRFV, this tolerance / resistance appears to be quantitative and polygenic, and plants are not virus-free. Furthermore, these QTLs are described as conferring resistance when present homozygously. Because QTL2 on chromosome 9 is present at the same locus as the Tm-2-2 gene, in a region that is typically transmitted "integrated" without recombination, this QTL on chromosome 9 may be difficult to combine with the Tm-2-2 gene, which is essential for commercially viable plants.

[0020] WO2020 / 148021 recently described a resistance gene on chromosome 8 that confers resistance to ToBRFV; this gene encodes an NBS-LRR protein (nucleotide binding site / leucine-rich repeat). Therefore, the resistance gene disclosed in this document is combined with the Tm-2-2 resistance gene to simultaneously provide resistance to ToBRFV, TMV, and ToMV.

[0021] Due to the very stable and highly infectious nature of the tobacco mosaic virus particles, prevention is usually very difficult. Therefore, one of the most effective ways to combat tobacco mosaic virus infection is to introduce a genetic resistance gene. Thus, there is an urgent need to identify improved resistance genes against several tobacco mosaic viruses, including this new type of tobacco mosaic virus ToBRFV, otherwise it will lead to the inability to produce tomato crops in entire regions.

[0022] Plant NLR proteins have been extensively reviewed. (Baggs et al., 2017; Kapos et al., 2019). NLRs are proteins that trigger plant resistance responses upon recognition of “effector proteins”. NLRs are divided into two main subclasses according to their N-terminal domain. The two main subclasses are the proteins CNL and TNL, whose N-terminus contains a coiled coil (C) or a toll / interleukin 1 receptor (TIR) domain, respectively. In addition to the N-terminal domain, NLRs have a nucleotide-binding (NB) domain and a leucine-rich repeat (LRR) domain. Each of the common domains (NB, LRR, CC, and TIR) is thought to play a role in activating NLR proteins (Wang et al., 2020). In particular, the LRR domain is often associated with effector protein recognition. Thus, allelic diversity in the LRR domain is often associated with the specificity of effector protein binding, and LRR domain diversity appears to be under positive selection (Mondragon-Palomino et al., 2002). The LRR domain can also act as a self-inhibitory domain, preventing auto-activation and downstream signaling. The NB domain binds ATP, which can switch between active or inactive forms. The CC and TIR domains are often thought to be involved in signaling. There are also reports that transferring parts of the LRR domain between two NLR proteins can confer new specificity to the NLR protein (Slootweg et al., 2017).

[0023] In the case of the NLR protein TM2 / TM-2-2, it has been demonstrated that a single amino acid (AA) change in the LRR domain results in an expansion of the diversity of the tobacco mosaic virus movement proteins (MPs) that this protein recognizes (Kobayashi et al., 2011).

[0024] The present inventors have surprisingly found that resistance to TMV, ToMV and ToBRFV can be conferred by a single resistance protein encoded by a single resistance gene, contrary to the teachings of the prior art, without the need for a combination of different resistance genes and proteins.

[0025] They have also found that by modifying the recognition domain of the NLR protein that confers resistance to TMV and ToMV, i.e. the LRR domain, i.e. by modifying the LRR domain of the TM-2-2 protein, it is possible to obtain this protein that confers resistance to ToBRFV. Summary of the Invention

[0026] The present invention relates to a variant LRR domain derived from the LRR domain of the TM-2-2 protein, such that the NBS-LRR protein comprising said mutant LRR domain recognizes and / or binds to the movement proteins of several different tobacco mosaic viruses, including at least ToBRFV, and preferably also including TMV, ToMV and / or ToMMV, most preferably TMV, ToMV and ToMMV.

[0027] The present invention also relates to polypeptides comprising such mutant LRR domains, and nucleotide sequences encoding the domains and polypeptides.

[0028] The present invention also relates to a resistance gene encoding a mutant or allelic variant of the TM-2-2 protein (SEQ ID No: 8), which confers resistance to several tobacco mosaic viruses, including at least resistance to ToBRFV, in tomato.

[0029] The newly discovered resistance protein or LRR domain confers resistance to ToBRFV, preferably in addition to resistance to ToMV and TMV, due to at least one substitution at position 822, 825 or 848 in the LRR domain of the TM-2-2 protein, i.e., asparagine (N) 822 is replaced by cysteine ​​(C), phenylalanine (F), methionine (M), tyrosine (Y) or tryptophan (W), serine (S) 825 is replaced by histidine (H), lysine (K) or threonine (T), cysteine ​​(C) 848 is replaced by arginine (R), or a combination of these substitutions.

[0030] Additional substitutions, preferably substitution of phenylalanine (F) with leucine (L) at position 655, may enhance the resistance conferred by substitutions at positions 848, 822 and / or 825, particularly at position 848.

[0031] The present invention also provides plants, particularly tomato (S. lycopersicum) plants that exhibit resistance to ToBRFV, including commercial plants, lines, and hybrids, as well as methods for producing or identifying plants, particularly tomato (S. lycopersicum) plants or populations (germplasm) that exhibit resistance to ToBRFV. The present invention also discloses molecular genetic markers associated with the newly discovered resistance genes. Plants obtained by methods and uses of such molecular markers are also provided.

[0032] The present application also provides several methods, including a method for identifying ToBRFV resistant plants, a method for increasing tomato yield in an environment subjected to infection by different tobamoviruses including ToBRFV, a method for protecting tomato fields from infection by tobamoviruses including ToBRFV, and a method for identifying, detecting and / or selecting mutants of the Tm-2-2 or Tm-2 gene conferring resistance to at least ToBRFV.

[0033] definition:

[0034] The term "resistance" is defined by the ISF (International Seed Federation) for vegetables and ornamental crops section to describe the reaction of a plant to a pest or pathogen, and for the vegetable seed industry to abiotic stress. Specifically, resistance refers to the ability of a plant variety to limit the growth and / or development of a specific pest or pathogen and / or the damage it causes, compared to a susceptible plant variety, under similar environmental conditions and pest or pathogen pressure. Resistant varieties can exhibit some disease symptoms or damage under heavy pest or pathogen pressure. Two levels of resistance are defined:

[0035] High resistance: a plant that highly limits the growth and / or development of a specific pest and / or the damage it causes, compared to a susceptible plant, under normal pest pressure. However, these plants can exhibit some symptoms or damage under heavy pest pressure.

[0036] Moderate resistance: a plant that highly limits the growth and / or development of a specific pest and / or the damage it causes, compared to a high resistant plant, but can exhibit a greater range of symptoms or damage. A moderately resistant plant will still exhibit lighter symptoms or damage than a susceptible plant when grown under similar environmental conditions and / or pest pressure.

[0037] The term "tolerance" is generally used to describe the ability of a plant to endure abiotic stress without serious consequences on growth, appearance and yield.

[0038] However, in the literature and patents, the term is also used to indicate a phenotype of a plant in which at least some of the disease symptoms are still absent when said plant is exposed to an infective dose of the virus, whereby, at least under some of the culture conditions, a systemic or local infection, virus multiplication, presence of viral genome sequences in at least the cells of said plant and / or its genomic integration can be determined. Thus, a tolerant plant is resistant to the manifestation of symptoms, but not to the symptomless carrier of the virus. Sometimes, viral sequences can be present in the plant, even multiplied in the plant, without causing disease symptoms. It will be understood that a tolerant plant, although infected with the virus, is generally able to limit the growth and development of the virus at least moderately. Thus, according to this definition, a tolerant plant is best characterized as a moderately resistant plant.

[0039] Symptoms on leaves of ToBRFV infection typically include mosaic, small leaf distortion, and in many cases also streaky symptoms. Symptoms on fruits of ToBRFV infection typically include typical yellow lesions (discoloration) and fruit malformation. In many cases, also “chocolate spots” on fruits.

[0040] Susceptibility: a plant is unable to limit the growth and development of a particular pest or pathogen; a susceptible plant exhibits detrimental symptoms associated with viral infection, i.e. leaf and fruit damage in case of ToBRFV infection.

[0041] A susceptible tomato (S. lycopersicum) plant to Tomato brown rugose fruit virus, for example is the commercially available variety Candela as mentioned in the 2015 publication by Salem et al.

[0042] As used herein, the term “offspring” or “progeny” refers to any plant that is a progeny produced from asexual or sexual reproduction of one or more parent plants or progeny thereof. For example, an offspring plant can be obtained by cloning or selfing of a parent plant or by crossing two parent plants, and includes selfing as well as F1 or F2 or further generations. F1 is the first generation of offspring produced from parents, at least one of which is used for the first time as a donor of a trait, while second generation (F2) or further generations (F3, F4, etc.) of offspring are specimens produced from selfing of F1, F2, etc. Thus, F1 can be (and usually is) a hybrid produced from a cross between two true genetic parents that are homozygous for the trait, while F2 can be (and usually is) offspring produced from self-pollination of said F1 hybrid.

[0043] As used herein, the terms "cross," "crossing," "crosspollination," or "cross-breeding" refer to the process of applying pollen from a flower on one plant (artificially or naturally) to the ovules (stigma) of a flower on another plant.

[0044] As used herein, the term "genotype" refers to the genetic makeup of a single cell, cell culture, tissue, organism (eg, a plant), or population of organisms.

[0045] As used herein, the term "grafting" is the process of grafting a scion onto a rootstock. The primary motivation for grafting is to avoid damage from soil-borne pests and pathogens when there are no genetic or chemical methods for disease management. Grafting a susceptible scion onto a resistant rootstock can provide resistant cultivars without having to breed resistance into the cultivar. In addition, grafting can enhance tolerance to abiotic stresses, increase yields, and enable more efficient use of water and nutrients.

[0046] As used herein, the term "heterozygote" refers to a diploid or polyploid individual cell or plant that has different alleles (forms of a particular gene, genetic determinant, or sequence) at least at one locus.

[0047] As used herein, the term "heterozygous" refers to the presence of different alleles (forms of a given gene, genetic determinant, or sequence) at a particular locus.

[0048] As used herein, the term "homozygous" refers to a single cell or plant that has identical alleles at one or more loci on all homologous chromosomes.

[0049] As used herein, the term "homozygous" refers to the presence of identical alleles at one or more loci in homologous chromosome segments.

[0050] As used herein, the term "hybrid" refers to any single cell, tissue, or plant produced by a cross between parents that differ in one or more genes.

[0051] As used herein, the term "locus" (plural: "loci") refers to any genetically defined site, which can be a single position (nucleotide) or a chromosomal region. A locus can be a gene, a genetic determinant, a portion of a gene, or a DNA sequence, and can be occupied by different sequences. A locus can also be defined by one SNP (single nucleotide polymorphism), several SNPs, or two flanking SNPs.

[0052] As used herein, the term "rootstock" refers to the lower part of the plant that is capable of receiving the scion during the grafting process.

[0053] As used herein, the term "scion" refers to the higher part of a plant that can be grafted onto a rootstock during the grafting process.

[0054] The present invention encompasses plants of different ploidy levels, essentially diploid plants, but also triploid plants, tetraploid plants, etc. DETAILED DESCRIPTION

[0055] The present inventors have identified variants of the LRR domain of the TM-2-2 protein such that the NBS-LRR protein comprising the variant of the LRR domain recognizes and / or binds to the movement protein (MP) of several tobacco mosaic viruses, including at least ToBRFV (Tomato Brown Rough Fruit Virus), preferably also including TMV (Tobacco Mosaic Virus) and / or ToMV (Tomato Mosaic Virus), and preferably also including ToMMV (Tomato Mottle Mosaic Virus).

[0056] Therefore, the present invention relates to a variant of the leucine-rich repeat sequence of the TM-2-2 protein, i.e., a variant of SEQ ID No: 11, wherein the variant has at least 90% sequence identity with SEQ ID No: 11 and the variant, if incorporated into the NBS-LRR protein, confers the ability to recognize and / or bind to at least the ToBRFV movement protein (SEQ ID No: 15; and also preferably the MP of ToMV (SEQ ID No: 14) and / or TMV (SEQ ID No: 13), and more preferably the MP of ToMMV (SEQ ID No: 16). In contrast, the LRR domain of TM-2-2, i.e., SEQ ID No: 11, confers the ability to bind to the MP of ToMV and TMV, but does not confer significant binding or recognition of the MP of ToBRFV. Variants of the LRR domain of TM-2-2 of the present invention are interchangeably referred to as LRR variants or mutants of the present invention, or LRR domain variants or mutants, or LRR variant domains.

[0057] Replacing the LRR domain of TM-2-2, ie, SEQ ID No: 11, with the LRR variant of the present invention confers protein recognition to the ToBRFV MP obtained thereby, ie, produces a protein that recognizes ToBRFV MP.

[0058] If the NBS-LRR protein binds directly or indirectly to the ToBRFV MP, the protein is said to recognize the ToBRFV MP; direct or indirect binding can be at the level of the LRR domain or can involve the entire protein. This recognition can be tested by the assay method disclosed in the Examples.

[0059] Furthermore, the inventors have demonstrated that the variation conferring ToBRFV MP recognition is that at least one amino acid at positions 822, 825, and 848 of the TM-2-2 protein (SEQ ID No: 8) is substituted, and more specifically, at least one substitution consisting of:

[0060] - Cysteine ​​(C) at position 848 of the TM-2-2 protein (SEQ ID No: 8), corresponding to position 372 of SEQ ID No: 11 (LRR domain of TM-2-2, corresponding to amino acids 477 to 861 of the TM-2-2 protein), is substituted with arginine (R);

[0061] - position 822 of the TM-2-2 protein (SEQ ID No: 8), corresponding to the asparagine (N) at position 346 of SEQ ID No: 11 (LRR domain of TM-2-2), is substituted with cysteine ​​(C), phenylalanine (F), methionine (M), tyrosine (Y) or tryptophan (W), and

[0062] - The serine (S) at position 825 of the TM-2-2 protein (SEQ ID No: 8) (corresponding to position 349 of SEQ ID No: 11 (LRR domain of TM-2-2)) is substituted with histidine (H), lysine (K) or threonine (T).

[0063] Thus, the LRR variants according to the present invention are characterized by the presence of an arginine at the position corresponding to cysteine ​​848 in the TM-2-2 protein, and / or the presence of a cysteine, phenylalanine, methionine, tyrosine or tryptophan at the position corresponding to asparagine 822 in the TM-2-2 protein, and / or the presence of a histidine, lysine or threonine at the position corresponding to serine 825 in the TM-2-2 protein. The LRR variants of the present invention may comprise one of the substitutions at only one of the positions 822, 825 and 848, or at two or all of the positions. Preferably, the LRR variants of the present invention do not simultaneously comprise the C848R and N822Y substitutions.

[0064] According to a preferred embodiment, only one of positions 822, 825 and 848 is substituted.

[0065] Furthermore, the inventors have shown that a mutation or substitution at position 655 in the LRR variant of the application can improve the recognition of the ToBRFV MP, preferably a substitution of phenylalanine (F) by leucine (L). Without being bound by theory, it is expected that the mutation at position 655 improves the presentation of the domain of the LRR variant that interacts with the ToBRFV MP. Thus, the preferred LRR variant of the application further comprises a mutation at position 655, more preferably a F655L mutation. In terms of the whole TM2-2 protein, position 655 corresponds to position 179 of SEQ ID No: 11 (LRR domain of TM-2-2).

[0066] The variant of the application is further characterized by the presence of a tyrosine (Y), a phenylalanine (F) or a tryptophan (W) in the TM-2-2 protein at a position corresponding to tyrosine 767, i.e. at a position corresponding to position 291 of the TM-2-2 LRR (SEQ ID No: 11) in the LRR variant. Indeed, as demonstrated by the inventors in the experimental part, said tyrosine naturally present in the TM-2-2 LRR / protein can be replaced by a F or a W without losing the function. Furthermore, this position is supported by Kobayashi et al. who demonstrated a durable resistance to ToMV.

[0067] In the following, the numbering of the amino acids is with respect to the position of said amino acid in the full-length TM-2-2 protein (SEQ ID No: 8).

[0068] The ability conferred to a given LRR domain to a NBS-LRR protein; in particular for the TM-2-2 protein, the ability to recognize and / or bind at least the movement protein of Tomato Brown Rugose Fruit Virus (ToBRFV) can be easily tested with the transient expression assay disclosed in the experimental part, i.e. by transiently expressing in N. benthamiana a NBS-LRR protein comprising the LRR domain under test in the presence of ToBRFV-MP, and by screening for hypersensitive response. Preferably, the NBS-LRR protein is a TM-2-2 protein wherein the naturally occurring LRR domain is replaced by the LRR variant under test.

[0069] Preferably, the LRR domain mutant of the application is such that the LRR domain of TM-2-2, i.e. SEQ ID No: 11, is replaced by the LRR variant of the application, retains the ability to recognize the MP of ToMV, TMV and / or ToMMV, and preferably at least the MP of TMV and ToMV.

[0070] The variant LRR domain of the application exhibits at the amino acid level at least 90% sequence identity with SEQ ID No: 11 corresponding to the sequence of the LRR domain of TM-2-2.

[0071] The sequence identity between two amino acid sequences is generally defined in the context of the present invention. A suitable program for defining sequence identity is, for example, Clustal Omega.

[0072] According to a preferred embodiment of the present invention, the LRR variant preferably has at least 95% sequence identity, preferably at least 96%, at least 97% or at least 98% with SEQ ID No: 11. According to a further embodiment, the LRR variant has 99% or higher sequence identity with SEQ ID No: 11.

[0073] Regardless of the percentage of sequence identity to the wild-type LRR domain of TM-2-2, variants according to the invention comprise a Y, F or W at the position corresponding to position 767 of the TM-2-2 protein, and one or more of:

[0074] - R at the position corresponding to cysteine ​​848 of the TM-2-2 protein,

[0075] - C, F, M, Y or W at the position corresponding to asparagine 822 of the TM-2-2 protein, and

[0076] - H, K or T at the position corresponding to serine 825 of the TM-2-2 protein.

[0077] In addition to the above-mentioned changes, the variant preferably further comprises a leucine (L) at a position corresponding to position 655 of the TM-2-2 protein.

[0078] It is preferred to limit variation in the LRR domain of TM-2-2 to around amino acids 822, 825, and 848 in the three-dimensional structure of the LRR domain; amino acids near positions 822, 825, and 848 are positions 823, 826, 827, 830, 847, 849, 850, 851, 857, and 858. However, as shown in this example, some variation at these positions is acceptable, such as the K857Q substitution.

[0079] Therefore, the variations or mutations between the LRR variants of the present invention and SEQ ID No. 11 preferably involve those amino acids that are not in the vicinity of amino acids 346, 349 and 372 (corresponding to amino acids 822, 825 and 848 in the TM-2-2 protein).

[0080] The variations or mutations are preferably conservative amino acid substitutions, preferably preserving the 3D structure of the LRR domain.

[0081] That is, a basic amino acid such as lysine or arginine is preferably substituted with another basic amino acid; an acidic amino acid such as aspartic acid or glutamic acid is preferably substituted with another acidic amino acid. A small non-polar amino acid such as glycine, alanine, proline, cysteine ​​or valine is preferably substituted with another small non-polar amino acid. A large non-polar amino acid such as leucine, isoleucine, phenylalanine, methionine or tryptophan is preferably substituted with another large non-polar amino acid. A small polar amino acid such as serine or threonine is preferably substituted with another small polar amino acid. A large polar amino acid such as asparagine or glutamine is preferably substituted with another large polar amino acid. An aromatic amino acid such as tyrosine, phenylalanine or tryptophan is preferably substituted with another aromatic amino acid.

[0082] Potential variations or mutations according to the present invention may involve the amino acids corresponding to position 655, or position 857 and / or position 769 of TM-2-2, as shown in the experimental part.

[0083] According to a preferred embodiment, the LRR domain variants according to the present invention exhibit 20 or fewer mutations, preferably 15 or fewer, more preferably 10 or fewer mutations relative to the LRR domain of TM-2-2. Said mutations are preferably conservative mutations; they are preferably found in the portion of the LRR domain that is not near the substitutions of cysteine ​​848, asparagine 822, and serine 825.

[0084] Potential LRR variants according to the present invention include: leucine (L) at position 655, arginine (R) at position 848 and tyrosine (Y) at position 767, or leucine (L) at position 655, arginine (R) at position 848 and phenylalanine (F) at position 767, or leucine (L) at position 655, arginine (R) at position 848 and tryptophan (W) at position 767, or arginine (R) at position 848 and tyrosine (Y) at position 767, as well as all LRR variants described in the Examples.

[0085] The present application also relates to a nucleotide sequence encoding a LRR domain mutant as defined above. In view of the degeneration of the genetic code, very different nucleotide sequences can be envisaged which encode a LRR domain variant of the application, i.e. a variant of SEQ ID No: 11, which is essentially characterized by an arginine at the position corresponding to cysteine 848 of the TM-2-2 protein, and / or a cysteine, a phenylalanine, a methionine, a tyrosine or a tryptophan at the position corresponding to asparagine 822, and / or a histidine, a lysine or a threonine at the position corresponding to serine 825, wherein said variant of SEQ ID No: 11 has a tyrosine, a phenylalanine or a tryptophan at position 767 and possibly a leucine at position 655. The sequence can or can not be isolated.

[0086] A suitable nucleotide sequence is for example the sequence corresponding to SEQ ID No: 12, i.e. the wild-type sequence encoding a Tm-2-2 LRR, wherein at least the codon corresponding to the cysteine at position 848 of TM-2-2 has been replaced by a codon corresponding to an arginine, or at least the codon corresponding to the asparagine at position 822 of TM-2-2 has been replaced by a codon corresponding to a cysteine, a phenylalanine, a methionine, a tyrosine or a tryptophan, or at least the codon corresponding to the serine at position 825 of TM-2-2 has been replaced by a codon corresponding to a histidine, a lysine or a threonine. A suitable nucleotide sequence is for example nucleotides 1429 to 2586 (or 2583 excluding the stop codon) of SEQ ID No: 4 or SEQ ID No: 5. Other suitable nucleotide sequences derived from SEQ ID No: 12, wherein at least one of the following codons has been replaced:

[0087] - the codon TGC encoding the cysteine at position 848 of TM-2-2, i.e. the nucleotides at positions 1114-1116 of SEQ ID No: 12, has been replaced by a codon encoding an arginine, i.e. by AGA, AGG, CGG, CGA, CGC or CTG;

[0088] - the codon AAT encoding the asparagine at position 822 of TM-2-2, i.e. the nucleotides at positions 1036-1038 of SEQ ID No: 12, has been replaced by a codon encoding a cysteine (i.e. TGT or TGC), by a codon encoding a phenylalanine (i.e. TTT or TTC), by a codon encoding a methionine (i.e. ATG), by a codon encoding a tyrosine (i.e. TAT or TAC), or by a codon encoding a tryptophan (i.e. TGG), and

[0089] - The codon TCT encoding the serine at position 825 of TM-2-2, i.e., the nucleotides at positions 1045-1047 of SEQ ID No: 12, has been substituted by a codon encoding histidine (i.e., CAT or CAC), a codon encoding lysine (i.e., AAA or AAG), or a codon encoding threonine (i.e., ACC, ACT, ACG or ACA).

[0090] In addition, the codon TAC encoding tyrosine at position 767 of TM-2-2, i.e., the nucleotides at positions 871-873 of SEQ ID No: 12, can be replaced by a codon encoding phenylalanine (i.e., TTT or TTC), or by a codon encoding tryptophan (i.e., TGG).

[0091] The codon encoding phenylalanine at position 655 of TM-2-2, i.e., nucleotides at positions 535-537 of SEQ ID No: 12, can be substituted by a codon encoding leucine (i.e., CTT, CTC, CTA, CTG, TTA, or TTG).

[0092] The present invention also relates to sequences derived from SEQ ID No: 12, which have at least 70% sequence identity, preferably at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity with said sequence. Regardless of the percentage of sequence identity with SEQ ID No: 12, the sequences according to the present invention encode the LRR domain variants of the present invention as defined above. Taking into account the degeneracy of the genetic code, sequences encoding LRR domain variants of the present invention may still have less than 70% sequence identity with SEQ ID No: 12 and are within the scope of the present invention.

[0093] According to another aspect, the present invention also relates to polypeptides and proteins comprising the mutant LRR domain of the present invention, in particular polypeptides and proteins that recognize or bind to the movement protein (MP) of at least ToBRFV, preferably also other tobacco mosaic viruses (including at least ToMV or TMV and preferably also ToMMV).

[0094] According to a preferred embodiment of the present invention, the protein comprising the mutant or variant LRR domain of interest is a member of the NLR class of proteins (NBS-LRR), more preferably a coiled-coil NLR (CC-NBS-LRR). As shown in Slootweg et al., LRR exchange between NBS-LRR proteins may indeed modify the target site of the NBS-LRR protein. Therefore, the LRR domain mutants of the present invention can be replaced by the wild-type LRR of any NBS-LRR, thereby generating a chimeric NBS-LRR that specifically targets MPs of ToBRFV, and preferably also targets MPs of ToMV, TMV and / or ToMMV.

[0095] Therefore, the present invention also includes such chimeric NBS-LRR proteins, which comprise the NBS portion of an NBS-LRR protein and an LRR domain mutant according to the present invention. As mentioned above, such NBS-LRR protein is preferably CC-NBS-LRR.

[0096] Such NBS-LRR proteins of the present invention preferably comprise the NBS portion of the TM-2-2 protein, corresponding to amino acids 1 to 476 of SEQ ID No: 8, fused to an LRR domain mutant of the present invention. Such proteins may advantageously have the sequence SEQ ID No: 9 (TM2-14-25), SEQ ID No: 10 (TM2-467), SEQ ID No: 17 (TM2-4), SEQ ID No: 18 (TM2-5), SEQ ID No: 19 (TM2-825H), SEQ ID No: 20 (TM2-825K), SEQ ID No: 21 (TM2-825T), SEQ ID No: 22 (TM1-822C), SEQ ID No: 23 (TM2-822F), SEQ ID No: 24 (TM2-822M), SEQ ID No: 25 (TM2-822Y) or SEQ ID No: 26 (TM2-822-W). Therefore, the proteins of the present invention are TM-2-2 protein variants that differ from TM-2-2 protein only in the LRR domain.

[0097] Alternative NBS-LRR proteins of the invention comprise the NBS portions of SEQ ID No: 6 and SEQ ID No: 7 (corresponding to the proteins encoded by the tm2 and Tm2 genes) fused to the LRR domain mutants of the invention.

[0098] The present invention also relates to a TM-2-2 protein variant having at least 90% amino acid identity with the sequence of the TM-2-2 protein (SEQ ID No: 8), interacting with and / or recognizing or targeting the MP of ToBRFV, and comprising a tyrosine, a phenylalanine, or a tryptophan at a position corresponding to Y767 of SEQ ID No: 8, and comprising an arginine at a position corresponding to C848 of SEQ ID No: 8, a histidine, a lysine, or a threonine at a position corresponding to S825, and at least one of a cysteine, a phenylalanine, a methionine, a tyrosine, or a tryptophan at a position corresponding to N822, i.e., comprising at least one of the following variants: N822C, N822F, N822M, N822Y, N822W, S825H, S825K, S825T, and C848R. Such variants may also comprise a leucine at a position corresponding to F655 of SEQ ID No: 8. Variations within the TM-2-2 protein may occur in either the NBS domain or the LRR domain of the protein. They are preferably found primarily in the NBS domain. For variations in the LRR domain, the requirements for variation or mutation are as previously described for the LRR mutants of the present invention. Variations or mutations are preferably conservative mutations. Variants may be isolated or not isolated.

[0099] According to a preferred embodiment, only one of the 822, 825 and 848 positions is substituted. According to an alternative embodiment, two or all of these positions are substituted. Preferably, the variant does not simultaneously comprise C848R and N822Y substitutions.

[0100] The TM-2-2 protein variants according to the present invention preferably have at least 90% amino acid identity with the TM-2-2 protein sequence overall, and at least 95% sequence identity at the LRR domain level. According to additional embodiments, the TM-2-2 protein variants according to the present invention have an overall sequence identity of at least 95% with SEQ ID No: 8, preferably with a higher sequence identity at the LRR domain level. Preferably, the sequence identity between the TM-2-2 protein and SEQ ID No: 8 is at least 96%, at least 97%, at least 98%, or even at least 99%.

[0101] According to a preferred embodiment, the TM-2-2 protein variant according to the present invention exhibits 60 or fewer mutations, preferably 50 or fewer, more preferably 20 or fewer mutations relative to the TM-2-2 protein. Said mutations are preferably conservative mutations; they are preferably mostly present in protein domains other than LRR domains.

[0102] The TM-2-2 protein variants according to the present invention trigger a hypersensitive response (HR) in the presence of MPs of ToBRFV, and preferably also in the presence of MPs of other tobacco mosaic viruses (including at least one of TMV, ToMV and ToMMV). Thus, the TM-2-2 protein variants according to the present invention confer resistance to tomato against infection with ToBRFV, and preferably also against other tobacco mosaic viruses (including TMV, ToMV and / or ToMMV).

[0103] It is noteworthy in this regard that the detection of a hypersensitive response in transient expression assays in alternative plants such as N. benthamiana is equivalent to the detection of resistance in tomato. Indeed, there is a perfect correlation between the ability of NBS-LRR proteins to trigger a strong HR response in N. benthamiana leaves (in the presence of tobacco virus MPs) and viral resistance in tomato. The present inventors have demonstrated this in the experimental section.

[0104] According to yet another embodiment, the present invention also relates to a nucleotide sequence encoding a polypeptide or protein as disclosed above, in particular encoding a protein comprising an LRR domain mutant of the present invention, a chimeric NBS-LRR, or a TM-2-2 protein variant of the present invention. The nucleotide sequence according to the present invention comprises at least DNA, single-stranded DNA, RNA, double-stranded RNA, or a mixture of DNA and RNA. The sequence may or may not be isolated.

[0105] Suitable nucleotide sequences are, for example, SEQ ID No: 4 or SEQ ID No: 5; these sequences are derived from the wild-type sequence Tm-2-2 encoding TM-2-2, wherein at least the codon corresponding to cysteine ​​at position 848 of TM-2-2 has been substituted with a codon corresponding to arginine. Therefore, the present invention also relates to mutant Tm-2-2 genes, such as SEQ ID No: 4 (Tm2-14-25) or SEQ ID No: 5 (Tm2-467). The present invention also relates to a sequence derived from SEQ ID No: 3, corresponding to the wild-type sequence Tm-2-2 encoding TM-2-2, wherein at least one of the following codons has been substituted:

[0106] - the codon TGC encoding cysteine ​​at position 848 of TM-2-2, i.e., the nucleotides at positions 2542-2544 of SEQ ID No: 3, has been substituted by a codon encoding arginine, i.e., by AGA, AGG, CGG, CGA, CGC, or CTG;

[0107] - the codon AAT encoding asparagine at position 822 of TM-2-2, i.e., nucleotides at positions 2464-2466 of SEQ ID No: 3, has been substituted by a codon encoding cysteine ​​(i.e., TGT or TGC), a codon encoding phenylalanine (i.e., TTT or TTC), a codon encoding methionine (i.e., ATG), a codon encoding tyrosine (i.e., TAT or TAC), or a codon encoding tryptophan (i.e., TGG), and / or

[0108] - The codon TCT encoding the serine at position 825 of TM-2-2, i.e., the nucleotides at positions 2473-2475 of SEQ ID No: 3, has been substituted by a codon encoding histidine (i.e., CAT or CAC), a codon encoding lysine (i.e., AAA or AAG), or a codon encoding threonine (i.e., ACC, ACT, ACG or ACA).

[0109] The codon TAC encoding tyrosine at position 767 of TM-2-2, i.e., the nucleotides at positions 2299-2301 of SEQ ID No: 3, can also be replaced by a codon encoding phenylalanine (i.e., TTT or TTC), or by a codon encoding tryptophan (i.e., TGG).

[0110] The codon TTT encoding phenylalanine at position 655 of TM-2-2, i.e., the nucleotides at positions 1963-1965 of SEQ ID No: 3, can also be substituted by a codon encoding leucine (i.e., CTT, CTC, CTA, CTG, TTA, or TTG).

[0111] According to a specific embodiment, the replacement sequence derived from SEQ ID No: 3 as described above is selected from SEQ ID No: 27 (encoding TM2-4), SEQ ID No: 28 (encoding TM2-5), SEQ ID No: 29 (encoding TM2-825H), SEQ ID No: 30 (encoding TM2-825K), SEQ ID No: 31 (encoding TM2-825T), SEQ ID No: 32 (encoding TM1-822C), SEQ ID No: 33 (encoding TM2-822F), SEQ ID No: 34 (encoding TM2-822M), SEQ ID No: 35 (encoding TM2-822Y) or SEQ ID No: 36 (encoding TM2-822-W).

[0112] The present invention also relates to sequences derived from SEQ ID No: 3, 4, 5, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 or from the above-mentioned substituted sequences, which have at least 70% sequence identity thereto, preferably at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity thereto. Regardless of the percentage of sequence identity to SEQ ID No: 3, 4, 5, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 or to the above-mentioned substituted sequences, such sequences encode proteins, polypeptides or TM-2-2 variants according to the present invention. Given the degeneracy of the genetic code, sequences encoding such polypeptides, proteins or variants of the present invention may still have less than 70% sequence identity to SEQ ID No: 3, 4, 5, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 or to the above-mentioned substituted sequences, and still fall within the scope of the present invention.

[0113] Potential additional variations are in particular substitutions of Y767 by F or W. Additional mutations or variations have been described in the foregoing aspects of the invention and apply mutatis mutandis to this aspect.

[0114] According to another aspect, the present invention also relates to a resistance gene encoding an NBS-LRR protein that is a mutant or allele of the TM-2-2 protein, conferring resistance to at least ToBRFV, preferably to at least one or more of TMV, ToMV, and ToMMV in plants, particularly tomatoes. Preferably, this resistance gene confers resistance to at least ToBRFV, TMV, and ToMV, and even more preferably to ToBRFV, TMV, ToMV, and ToMMV. The mutant or allele of the TM-2-2 protein is a variant of the TM-2-2 protein as described above, comprising at least one of a substitution selected from the group consisting of C848R at position 848 of the TM-2-2 protein, N822C, N822F, N822M, N822Y, and N822W at position 822 of the TM-2-2 protein, and S825H, S825K, and S825T at position 825 of the TM-2-2 protein.

[0115] The mutant or allele of TM-2-2 protein may comprise one of the substitutions at only one of positions 822, 825, and 848, or at two or all of the positions. Preferably, the mutant or allele of TM-2-2 protein of the present invention does not comprise both C848R and N822Y substitutions.

[0116] The mutant or allele of the TM-2-2 protein may also comprise an F655L substitution.

[0117] The newly discovered resistance proteins and the resistance genes encoding the proteins confer resistance to ToBRFV, preferably in addition to resistance to ToMV and TMV, due to the replacement of cysteine ​​848, asparagine 822 and / or serine 825 in the LRR domain of the TM-2-2 protein by arginine of C848, by cysteine, phenylalanine, methionine, tyrosine or tryptophan of N822 and by histidine, lysine or threonine of S825.

[0118] According to another aspect, the present invention also relates to a nucleic acid construct comprising a sequence encoding a polypeptide or protein according to the present invention, or comprising a nucleotide sequence encoding a TM-2-2 variant, or comprising a resistance gene according to the present invention.

[0119] Such sequences encoding the polypeptide or protein according to the present invention, or comprising a nucleotide sequence encoding a TM-2-2 variant, or comprising a resistance gene are hereinafter interchangeably referred to as the nucleotide sequence or resistance gene of the present invention, or variant TM-2-2 gene or mutant TM-2-2 gene.

[0120] The sequence encoding the protein, polypeptide or variant of interest is preferably under the control of a promoter that is a constitutive or inducible promoter. Preferably, the promoter is a promoter that is active in plant cells. According to one embodiment, the promoter is not the wild-type promoter of the Tm-2, Tm-2-2 or tm-2 gene. Preferably, the promoter of the Tm-2-2 variant gene is the native promoter of Tm-2, Tm-2-2 or tm-2.

[0121] Thus, the nucleic acid construct according to the invention may be a vector, a plasmid or a T-DNA plasmid. Thus, the presence of the construct of the invention in a cell may result in the expression of a protein, polypeptide TM-2-2 variant or resistance protein according to the invention and as defined above.

[0122] The present invention also includes expression vectors or constructs suitable for expressing a polypeptide, protein, TM-2-2 variant or resistance protein according to the present invention, preferably in plant cells.

[0123] According to another embodiment, the present invention also relates to the use of defined sequences encoding the TM-2-2 variants of the present invention, or constructs comprising such sequences, for conferring resistance to at least ToBRFV on tomato (S. lycopersicum) plants or for obtaining transgenic tomato (S. lycopersicum) plants resistant to ToBRFV. In fact, as shown in this example, the TM-2-2 variant recognizes the ToBRFV MP, thereby triggering the HR response associated with ToBRFV resistance. The TM-2-2 variants of the present invention may also recognize at least the movement proteins of TMV, ToMV and / or ToMMV, thereby conferring resistance to these tobacco mosaic viruses. Therefore, the present invention also includes the use of the sequences for conferring resistance to ToBRFV and to at least one of TMV, ToMV and ToMMV on tomato (S. lycopersicum) plants, as well as for obtaining transgenic tomato (S. lycopersicum) plants exhibiting these resistances.

[0124] According to another aspect, the present invention also relates to a cell comprising a nucleotide sequence or a resistance gene according to the invention or a DNA construct as disclosed above.

[0125] The cell is preferably a plant cell, preferably from the Solanaceae, for example from the genus Solanum, even more preferably a cell of a tomato (S.lycopersicum) plant or a cell of the genus Capsicum or Nicotiana. The cell comprises a nucleotide sequence or a resistance gene or a DNA construct according to the present invention in its genome and preferably in its nuclear genome. The presence of these sequences confers a phenotype of interest, i.e., the expression of a protein that interacts with the ToBRFV MP that triggers HR responses under suitable conditions. The presence of these sequences can be disclosed based on the sequence by any technology well known to those skilled in the art.

[0126] Particularly preferred cell types are cells of the genus Solanum, Nicotiana or Capsicum, and more preferably S. lycopersicum.

[0127] The cell according to the present invention may be any type of cell, in particular a tomato (S. lycopersicum) cell, in particular an isolated cell and / or a cell capable of regenerating a whole plant, in particular a tomato (S. lycopersicum) plant carrying a nucleotide sequence or a resistance gene according to the present invention. Thus, the cell may be a regenerable cell or a non-regenerable cell.

[0128] The nucleotide sequence or resistance gene of interest may be present homozygously or heterozygously in the cell of the invention. Preferably, the cell according to the invention comprises the resistance gene or the nucleotide sequence as defined above in a heterozygous state.

[0129] The present invention also relates to a tissue culture of non-renewable or regenerable cells as defined above according to the invention; preferably, the regenerable cells are derived from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, fruits, seeds, flowers, cotyledons and / or hypocotyls according to the invention, and the cells contain in their genome a nucleotide sequence or resistance gene that confers resistance to at least ToBRFV. Preferably, such sequences or resistance genes also provide resistance to TMV and / or ToMV, and preferably also provide resistance to ToMMV.

[0130] The invention also relates to any plant part, in particular a tomato (S. lycopersicum) plant part, especially a seed, an explant, propagation material, a scion, a cutting, a seed, a fruit, a root, a rootstock, pollen, an ovule, an embryo, a protoplast, a leaf, an anther, a stem, a petiole or a flower, wherein the plant part comprises at least one cell as described above.

[0131] The present invention also provides a protoplast comprising the nucleotide sequence or resistance gene of the present invention.

[0132] According to another aspect, the present invention relates to a plant, more preferably to a tomato (S. lycopersicum) plant comprising in its genome a nucleotide sequence as defined above encoding a protein or peptide of the present invention or a resistance gene. Thus, this nucleotide sequence or resistance gene encodes a variant of the TM-2-2 protein comprising (1) a C848R mutation at position 848, a N822C, N822F, N822M, N822Y or N822W mutation at position 822, and at least one of a S825H, S825K or S825T mutation at position 825, and (2) a Y, F or W at position 767, and conferring resistance to at least ToBRFV, and preferably resistance to one or more of TMV, ToMV and ToMMV, and more preferably resistance to TMV, ToMV and ToMMV in addition to ToBRFV. Preferably, the nucleotide sequence or resistance gene encodes a variant of the TM-2-2 protein further comprising a leucine at position 655.

[0133] Accordingly, the present application also encompasses at least tomato (S. lycopersicum) plants that are resistant to ToBRFV, comprising a mutated Tm-2-2 gene encoding a variant of the TM-2-2 protein according to the present application (SEQ ID No: 8), i.e. having at least 90% sequence identity to SEQ ID No: 8, comprising a tyrosine, a phenylalanine or a tryptophan at a position corresponding to position 767 of SEQ ID No: 8, and comprising at least one mutation / variation:

[0134] - an arginine at a position corresponding to position 848 of SEQ ID No: 8, instead of the cysteine present in the wild-type TM-2-2 sequence;

[0135] - a cysteine, a phenylalanine, a methionine, a tyrosine or a tryptophan at a position corresponding to position 822 of SEQ ID No: 8, instead of the asparagine present in the wild-type TM-2-2 sequence, and

[0136] - a histidine, a lysine or a threonine at a position corresponding to position 825 of SEQ ID No: 8, instead of the serine present in the wild-type TM-2-2 sequence.

[0137] The mutated Tm-2-2 gene is a resistance gene according to the present application.

[0138] It can also advantageously comprise a leucine at a position corresponding to position 655 of SEQ ID No: 8, instead of the phenylalanine present in the wild-type TM-2-2 sequence.

[0139] The resistance gene or nucleotide sequence of the present application is preferably stably present in the nuclear genome of the plant cell. It can be stably integrated into the nuclear genome, for example after transformation, or it can result from a mutagenesis process, such as Tilling, detailed in the experimental part of the present application. The presence of these sequences conferring at least resistance to ToBRFV can also result from a gene introgression from a resistant parent. These sequences conferring resistance to tobamoviruses, including at least ToBRFV, are preferably, but not necessarily, found on chromosome 9, at the tm-2 or Tm-2 locus. Other positions in the genome, for example resulting from random integration, are also suitable and encompassed by the present application.

[0140] The resistance phenotype can be tested and scored at the first leaf level or at the fruit level, by natural infection or artificial inoculation, as described in the experimental part, in particular in Example 1.4.

[0141] The sequences or resistance genes conferring resistance to at least ToBRFV may be present homozygously or heterozygously in the genome of the plant according to the invention, in particular a tomato (S. lycopersicum) plant. These sequences may also be present in multiple copies.

[0142] The resistance gene or mutated Tm-2-2 gene according to this aspect of the invention is as defined in conjunction with the other aspects of the invention, and therefore encodes a variant of the TM-2-2 protein, which may be SEQ ID No: 9, SEQ ID No: 10, SEQ ID No: 17, SEQ ID No: 18, SEQ ID No: 19, SEQ ID NO: 20, SEQ ID No: 21, SEQ ID No.: 22, SEQ ID No: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID No: 26. Suitable resistance genes or mutated Tm-2-2 genes are, for example, those having SEQ ID No: 4 or SEQ ID No: 5, SEQ ID No: 27, SEQ ID No: 28, SEQ ID No: 29, SEQ ID No: 30, SEQ ID No: 31, SEQ ID NO: 32, SEQ ID No: 33, SEQ ID No: 34, SEQ ID No: 35, SEQ ID NO: 36 or substitutions thereof, or sequences derived from SEQ ID No: 4 or SEQ ID No: 5, or sequences derived from substitutions thereof which further result in degeneracy of the genetic code.

[0143] The present invention also relates to tissues of the plant of the present invention; the tissues may be undifferentiated tissues or differentiated tissues, and the tissues contain one or more cells containing the resistance gene of the present invention or the mutant Tm-2-2 gene.

[0144] The present invention also relates to propagation material capable of producing resistant plants according to the invention, in particular resistant tomato plants, comprising a resistance gene or a mutant Tm-2-2 gene as defined above. The present invention particularly relates to seeds of such resistant plants, comprising a resistance gene or a mutant Tm-2-2 gene, in particular tomato (S. lycopersicum) seeds and seeds that can be grown into tomato (S. lycopersicum) plants according to the invention.

[0145] Such tomato (S. lycopersicum) seeds are preferably coated or pelleted with individual or combined active substances such as phytonutrients, enhancing microorganisms or products for disinfecting the seed and the plant's environment. Such substances and chemicals may be products that promote plant growth, such as hormones, or products that increase their resistance to environmental stresses, such as defense stimulants, or products that stabilize the pH value of the substrate and its surroundings, or alternatively nutrients.

[0146] They can also be products for protecting against chemical agents that are detrimental to the growth of seedlings, including viruses and pathogenic microorganisms herein, such as fungicidal, bactericidal, hemolytic, insecticidal or herbicidal products that act by contact, ingestion or gaseous diffusion; for example, it is any suitable essential oil, such as thyme extract. All these products enhance the resistance response of the plant and / or disinfect or regulate the environment of the plant. They can also be living biological materials, such as non-pathogenic microorganisms, such as at least one fungus, or bacteria, or viruses, if necessary, with a culture medium that ensures their vitality; and such microorganisms, such as Pseudomonas, Bacillus, Trichoderma, fungi, Fusarium, Rhizoctonia, etc., stimulate the growth of the plant or protect it from pathogens.

[0147] The plants, cells or seeds of the present invention may be heterozygous or homozygous for the resistance gene of the present invention or the mutated Tm-2-2 gene that confers ToBRFV resistance. The resistance conferred by the gene is expected to be dominant, so that plants heterozygous for the resistance gene of the present invention or the mutated Tm-2-2 gene are also resistant to ToBRFV. Therefore, the present invention also includes plants, cells or seeds heterozygous for the resistance gene of the present invention or the mutated Tm-2-2 gene as defined above in their genome.

[0148] Preferably, the tomato (S. lycopersicum) plant according to the present invention is a commercial plant or line. Such commercial plant or line preferably also exhibits one or more of the following additional characteristics: nematode resistance traits (Mi-1 or Mi-j), Fusarium resistance, Verticillium resistance and / or TYLCV resistance.

[0149] Other resistances or tolerances are also contemplated according to the present invention.

[0150] Furthermore, the commercial plants of the present invention produce, under suitable conditions, fruits weighing at least 10 g, preferably 25 g, preferably at least 100 g and / or even more preferably at least 150 g or at least 200 g when fully mature. Furthermore, the number of fruits per plant is not substantially affected by the presence of the resistance gene or the mutant Tm-2-2 gene of the present invention, i.e. the productivity of the plants according to the present invention is not less than 20% of that of plants of the same genotype but lacking the resistance gene or the mutant Tm-2-2 gene.

[0151] According to yet another embodiment, the plant of the present invention is a determinate, indeterminate or semi-determinate plant, or a seed or cell thereof, ie corresponds to a determinate, determinate or semi-determinate growth habit.

[0152] Determinate tomatoes tend to produce leaves first, then flowers. If pollinated, these flowers produce fruit. All the fruit on a plant tend to mature at approximately the same time. Indeterminate tomatoes begin with some leaves and continue to produce leaves and flowers throughout the growing season. These plants often produce fruit at varying stages of maturity at any given time. Semi-determinate tomatoes are phenotypically somewhere between determinate and indeterminate varieties. They are typical determinate varieties, but they grow larger than determinate varieties.

[0153] The plants, cells or seeds according to the present invention may also advantageously contain a Tm-1 gene. The Tm-1 gene is particularly as defined in the publication by Ishibashi et al. in 2007; preferably, "Tm-1 gene" refers to a gene sequence encoding a protein having the Tm-1 activity reported in the article, i.e., the ability to inhibit viral replication of a Tm-1-sensitive wild-type ToMV strain, such as the strain ToMV-L disclosed in the article.

[0154] Therefore, the present invention also includes tomato plants, cells or seeds homozygously or heterozygously comprising the Tm-1 gene in addition to the resistance gene or mutant Tm-2-2 gene of the present invention.

[0155] According to another embodiment, the plant of the present invention is used as a scion or stock in a grafting process. Grafting is a process that has been used for many years on crops such as Cucurbitaceae, but has only recently been used for tomatoes. Grafting can be used to provide a certain level of resistance to earth pathogens such as Phytophthora or to certain nematodes. Therefore, grafting is intended to prevent the plant or variety to be cultivated from contacting infected soil. The variety of interest (optionally an F1 hybrid) used as a graft or scion is grafted onto a resistant plant used as a stock. The resistant stock remains healthy and provides a normal supply from the soil for the graft separated from the diseased plant.

[0156] As described above, the present invention relates to tomato (S. lycopersicum) plants that exhibit resistance to ToBRFV, preferably also resistance to TMV, ToMV and / or ToMMV, as well as seeds that produce those plants, and cells of these plants or seeds, or other plant parts, whose genomes contain a resistance gene or a mutated Tm-2-2 gene, as well as progeny of such plants of the present invention that contain said resistance gene or mutated Tm-2-2 gene.

[0157] Progeny include the first, second and all other offspring of a cross with a plant according to the present invention, where the cross includes a cross with itself or with another plant.

[0158] It should be noted that seeds or plants of the present invention can be obtained by different processes, rather than only by essentially biological processes. The Tm-2-2 gene of the resistance gene or mutation can indeed be introduced, incorporated or obtained "in cellulose" by different techniques. Therefore, plants, cells or seeds according to the present invention can be genetically modified or non-genetically modified, and they are preferably obtained by technological processes that are not essentially biological processes, as described in detail in other parts of this specification sheets and in the examples. According to a preferred embodiment, plants, cells or seeds according to the present invention are not only obtained by essentially biological processes.

[0159] The mutated Tm-2-2 gene encoding the disclosed TM-2-2 variant can be advantageously obtained by gene editing technology, base editing or guide editing technology, such as mutagenesis, in particular targeted mutagenesis (such as TILLING), or by other gene editing technologies such as the CRISPR / Cas system, or by customized nucleases, or by base editing or guide editing using Cas9, Cas12a or other Cas proteins.

[0160] These techniques are well known to those skilled in the art. Examples of these techniques are described in the experimental section of this application.

[0161] In the detailed description of the invention, the mutation of the Tm-2-2 gene is induced by genetic engineering. The genetic engineering means that can be used include the use of all such technologies known as new breeding technologies, which are various new technologies developed through genetic variation and / or used to create new traits in plants, with the aim of targeted mutagenesis, targeted introduction of new genes or gene silencing (RdDM). Examples of such new breeding technologies are by using the zinc finger nuclease (ZFN) technology (ZFN-1, ZFN-2 and ZFN-3, see US Patent No. 9,145,565), oligonucleotide-directed mutagenesis (ODM), cis- and endogenesis, grafting (on transgenic rootstocks), reverse breeding, agricultural infiltration (agricultural infiltration "narrow", agricultural inoculation, flower dip), transcription activator-like effector nucleases (TALEN, see US Patent Nos. 8,586,363 and 9,181,535), CRISPR / Cas system (see US Patent Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233 and 8,999,641), engineered meganucleases - reengineered homing endonucleases, DNA-directed genome editing (Gao et al., Nature Biotechnology (2016)) and targeted sequence changes facilitated by synthetic genomics. A major part of targeted genome editing, another name for new breeding technologies, is the use of DNA double-strand breaks (DSBs) induced at selected positions in the genome where modifications are intended. The directed repair of DSBs allows targeted genome editing. Such applications can be used to generate mutations (e.g. targeted mutations or precise natural gene editing) as well as precise insertion of genes (e.g. cisgenes, intragenic or transgenes). The applications that lead to mutations are generally identified as site-directed nuclease (SDN) technologies, such as SDN1, SDN2 and SDN3. For SDN1, the effect is a targeted, non-specific gene deletion mutation: the position of the DNA DSB is chosen precisely, but the DNA repair of the host cell is random and leads to small nucleotide deletions, additions or substitutions. For SDN2, the SDN is used to generate a targeted DSB, a DNA repair template (a short DNA sequence identical to the targeted DSB DNA sequence except for one or a few nucleotide changes) is used to repair the DSB: this leads to the targeted and predetermined point mutation in the gene of interest desired. As for SDN3, the SDN is used with a DNA repair template containing a new DNA sequence (e.g. a gene). The effect of this technology will be to integrate this DNA sequence into the plant genome. The most likely application illustrating the use of SDN3 is the insertion of an expression cassette of a cisgene, intragenic or transgene at a selected genomic position.Each of these techniques is fully described in the 2011 report “New plantbreeding techniques-State-of-the-art and prospects for commercial development” by the Institute for Prospective Technological Studies of the European Commission’s Joint Research Centre (JRC).

[0162] The defined resistance genes can also be introduced into the plants, cells or seeds of the invention by transformation, in particular Agrobacterium transformation, thereby producing transgenic plants, cells or seeds. This technique is also described in the Examples section of the application.

[0163] The present application relates to plants, seeds or cells comprising a defined resistance gene or a mutated Tm-2-2 gene, regardless of the manner in which these sequences are provided; thus, it relates to transgenic and non-transgenic plants.

[0164] In another aspect, the present invention also relates to different methods for obtaining, breeding or producing plants, in particular tomato (S. lycopersicum) plants, which are resistant to ToBRFV, and preferably also to ToMV, TMV and / or ToMMV, more preferably to ToMV, TMV and ToMMV.

[0165] Therefore, the present invention includes a method for producing plants, in particular tomato (S. lycopersicum) plants, which are resistant to ToBRFV, and preferably also to ToMV, TMV and / or ToMMV, comprising the following steps:

[0166] a) treating M0 seeds of plants, preferably tomato plants modified with a mutagen, to obtain M1 seeds;

[0167] b) growing plants from the M1 seeds thus obtained to obtain M1 plants;

[0168] c) producing M2 seeds by self-fertilization of M1 plants; and

[0169] d) Optionally repeat steps b) and c) n times to obtain M1+n seeds.

[0170] M1 or M2 seeds were grown into plants and infected with ToBRFV or screened to identify mutations in the Tm-2-2 gene.

[0171] In this method, the M1 seeds of step a) can be obtained by chemical mutagenesis (e.g. EMS mutagenesis) or by other chemical mutagens or physical means (e.g. irradiation), such as selected ionizing radiation (X-rays, gamma rays, alpha particles...), heavy ion beam irradiation, ultraviolet radiation, radioactive decay or fast neutron irradiation.

[0172] Another method for producing tomato (S. lycopersicum) plants that are resistant to at least ToBRFV and preferably also to one or more of TMV, ToMV and ToMMV, comprises introducing a mutation in the tm2, Tm-2 or Tm-2-2 gene into a plant already containing the tm2, Tm-2 or Tm-2-2 gene on chromosome 9 to produce a mutated Tm-2-2 according to the present invention, i.e., encoding a Tm-2-2 variant, the Tm-2-2 mutant comprising at least one of the C848R, N822C, N822F, N822M, N822Y, N822W, S825H, S825K and S825T mutations relative to Tm-2-2, and comprising F, Y or W at position 767, and possibly also comprising the F655L mutation.

[0173] When the starting material is a tomato (S. lycopersicum) plant comprising a Tm-2-2 gene, the method advantageously comprises introducing at least one mutation in said Tm-2-2 gene, preferably by mutagenesis, by TILLING or by genome editing, base editing or guide editing, in particular by mutagenesis induced by a physical or chemical agent, in particular by a mutagenesis selected from ethyl methanesulfonate (EMS) mutagenesis, N-methyl-N-nitrosourea (MNU) mutagenesis or sodium azide (NaN3, SA) mutagenesis, oligonucleotide-directed mutagenesis (ODD-MS) mutagenesis or oligonucleotide-directed mutagenesis. M), zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN), CRISPR / Cas system, Cas9, Cas12a or other Cas proteins, engineered large-range nucleases, re-engineered homing endonucleases and DNA-guided genome editing technology, wherein the at least one mutation produces C848R, N822C, N822F, N822M, N822Y, N822W, S825H, S825K or S825T substitution in the protein encoded by the Tm-2-2 gene. The method can include introducing other mutations in the Tm-2-2 gene, for example, for producing Y767F or Y767W substitutions in the protein encoded by the Tm-2-2 gene.

[0174] Additional mutations may also be introduced, provided that recognition of the ToBRFV MP is not lost, and preferably recognition of the TMV, ToMV and ToMMV MPs is not lost.

[0175] The present invention also includes various methods for obtaining transgenic plants according to the present invention, in particular transgenic tomato (S. lycopersicum) plants resistant to at least ToBRFV and preferably also to ToMV, TMV and / or ToMMV, by introducing a resistance gene according to the present invention or a mutated Tm-2-2 gene. These methods may comprise the following steps:

[0176] - obtaining a DNA construct as defined in the previous aspects of the invention, i.e. comprising a resistance gene or a mutated Tm-2-2 gene encoding a TM-2-2 variant according to the invention,

[0177] - introducing said construct into cells, in particular into tomato (S. lycopersicum) cells,

[0178] - regenerating transgenic plants, and

[0179] - optionally propagating the plants obtained.

[0180] According to another aspect, the present invention also relates to the use of tomato seeds or plants of the present invention (preferably homozygously comprising the resistance gene or mutated Tm-2-2 gene of the present invention) as breeding partners in a breeding program for obtaining tomato (S. lycopersicum) plants having a ToBRFV-resistant phenotype and preferably having resistance to ToBRFV, ToMV, TMV and ToMMV. In fact, such breeding partners homozygously carry in their genome the resistance gene or mutated Tm-2-2 gene that confers the phenotype of interest. By crossing this plant with a tomato plant, in particular a strain, the resistance gene or mutated Tm-2-2 gene of the present invention that confers the desired phenotype can therefore be transferred to the progeny. Therefore, the plant according to the present invention can be used as a breeding partner for introgressing the resistance gene or mutated Tm-2-2 gene into a tomato (S. lycopersicum) plant or germplasm. Although plants or seeds heterozygously carrying the resistance gene of interest can also be used as breeding partners as described above, the separation of the phenotype may make the breeding program more complicated.

[0181] Therefore, the present invention also relates to a method for breeding tomato (S. lycopersicum) plants resistant to at least ToBRFV and preferably also to TMV, ToMV and / or ToMMV, most preferably to all, the method comprising:

[0182] (a) crossing a tomato (S. lycopersicum) plant comprising the resistance gene or the mutated Tm-2-2 gene according to the present invention with an initial tomato (S. lycopersicum) plant lacking the resistance gene or the mutated gene,

[0183] (b) selecting plants carrying the resistance gene or mutant gene among the progeny thus obtained,

[0184] (c) optionally, subjecting the plant obtained in step (b) to one or more self-pollinations,

[0185] And selection is carried out among the progeny to obtain plants carrying resistance genes or mutant genes.

[0186] Selection can be performed by any suitable means known to the person skilled in the art, in particular by using markers specific for the resistance gene or mutant gene.

[0187] The present invention also relates to a method for producing a tomato (S. lycopersicum) plant resistant to at least ToBRFV and preferably also to TMV, ToMV and / or ToMMV, most preferably to all, the method comprising obtaining a part of a plant according to the invention, thereby comprising a defined resistance gene or a mutated Tm-2-2 gene, and vegetatively propagating said plant part to produce a plant from said plant part.

[0188] In all methods and processes according to the present invention, the tomato (S. lycopersicum) plants are determinate, indeterminate or semi-determinate.

[0189] As already disclosed, the tomato plants according to the invention are preferably also resistant to nematodes, TYLCV, Fusarium and / or Verticillium wilt.

[0190] The present invention is also directed to a tomato (S. lycopersicum) plant and seed obtained or obtainable by any of the methods and processes disclosed above. This plant is indeed a tomato (S. lycopersicum) plant expressing the TM-2-2 variant of the present invention, which confers resistance to tobacco mosaic virus, in particular to ToBRFV, and preferably also to at least one of TMV, ToMV and ToMMV.

[0191] According to yet another aspect, the present application also relates to a method for genotyping a plant, preferably a Solanum lycopersicum plant or a Solanum lycopersicum germplasm, for detecting the presence of a resistance gene or a mutated Tm-2-2 gene according to the present application associated with resistance to ToBRFV infection, wherein the method comprises determining or detecting in the genome of the tested plant a nucleic acid, said nucleic acid comprising or corresponding to at least one of the C848R, N822C, N822F, N822M, N822Y, N822W, S825H, S825K and S825T mutations in the Tm-2-2 gene. Preferably, the method comprises a step of identifying in the plant sample to be tested the specific sequence associated with one of these mutations conferring resistance to ToBRFV. Similarly, the present application also relates to a method for identifying, detecting and / or selecting a Solanum lycopersicum plant resistant to ToBRFV in a plant resistant to TMV and ToMV, said method comprising detecting a mutated allele of the Tm-2-2 gene in the genome of said plant, wherein said mutated allele comprises at least one mutation selected from the group consisting of a mutation resulting in a C848R amino acid substitution at position 848 of the TM-2-2 protein, a mutation resulting in a N822C, N822F, N822M, N822Y or N822W amino acid substitution at position 822 of the TM-2-2 protein and a mutation resulting in a S825H, S825K and S825T amino acid substitution at position 825 of the TM-2-2 protein.

[0192] In view of the ability of the resistant plants of the present application to limit the damage caused by infection with different tobamoviruses, including ToBRFV infection, they are advantageously planted in environments infested with ToBRFV or likely to be infested or infected with ToBRFV or likely to be infested or infected with TMV, ToMV and / or ToMMV; under these conditions, the resistant plants of the present application produce more marketable tomatoes than susceptible plants. The present application therefore also relates to a method for increasing the yield of tomato plants in environments infested with ToBRFV and likely to be infested with TMV, ToMV and / or ToMMV, which comprises planting tomato plants comprising in their genome a resistance gene or a mutated Tm-2-2 gene, said resistance gene or mutated Tm-2-2 gene being as defined according to the preceding aspect of the present application and conferring to said plants at least resistance to ToBRFV.

[0193] Preferably, the method comprises a first step of selecting or choosing a tomato plant comprising said resistance gene or mutated Tm-2-2 gene of interest. The method can also be defined as a method for increasing the productivity of a tomato field, tunnel or greenhouse, or as a method for reducing the intensity or the number of applications of chemicals or fungicides in tomato production.

[0194] The invention also relates to a method for reducing tomato production losses under conditions of infection or infestation by ToBRFV, or more generally under conditions of infection by ToMV, TMV and / or ToBRFV, which method comprises planting tomato plants as defined above.

[0195] These methods are particularly valuable for tomato plant populations in the field, tunnel, or greenhouse.

[0196] Alternatively, the method for increasing tomato production yield or reducing tomato production losses may comprise a first step of identifying a tomato plant that is resistant to ToBRFV, preferably also to ToMV, TMV and ToMMV, and comprises in its genome a resistance gene or a mutated Tm-2-2 gene of the present invention that confers at least ToBRFV resistance to the plant, and then planting the resistant plant in an environment infected or potentially infected by the virus.

[0197] The resistant plants of the present invention can also limit the growth of ToBRFV, thereby limiting the infection of other plants and the spread of the virus. Therefore, the present invention also relates to a method for protecting a field, a tunnel or a greenhouse or any other type of plantation from ToBRFV infection, or at least a method for limiting the level of ToBRFV infection in the field, tunnel and greenhouse, or a method for limiting the spread of ToBRFV in a field, tunnel or greenhouse, in particular in a tomato field. This method preferably includes the step of planting the resistant plant of the present invention, i.e. a plant comprising in its genome a resistance gene or a mutated Tm-2-2 gene that confers ToBRFV resistance to the plant.

[0198] The present invention also relates to the use of ToBRFV-resistant plants for controlling ToBRFV infection or infestation in fields, tunnels, greenhouses or other plantations; such plants are plants of the present invention, comprising in their genome a resistance gene or a mutated Tm-2-2 gene as defined above. This use or method is also a method for disinfecting a field, tunnel or greenhouse by reducing the virus population therein.

[0199] In another aspect, the present invention also relates to a method for producing tomatoes, comprising:

[0200] a) planting tomato (S. lycopersicum) plants of the present invention, comprising the resistance gene or the mutated Tm-2-2 gene as defined above;

[0201] b) allowing the plant to bear fruit; and

[0202] c) harvesting the fruits of the plant, preferably at maturity and / or before maturity.

[0203] All preferred embodiments regarding the Tm-2-2 gene of the resistance gene or mutation have been disclosed in the context of the aforementioned aspects of the application. The method can advantageously comprise the further step of processing said tomato into a tomato processed food product.

[0204] The application also relates to a process for producing a tomato in a transgenic tomato plant, comprising introducing a nucleic acid molecule encoding a TM-2-2 variant according to the application into a tomato (S. lycopersicum) plant. The process can further comprise the steps of regenerating the transgenic plant and allowing the plant to fruit. The process can further comprise the step of harvesting the fruit of said transgenic plant.

[0205] According to yet another embodiment, the application also relates to a method for identifying, detecting and / or selecting a mutant of the Tm-2-2 gene conferring at least resistance to ToBRFV, and preferably also to at least one of TMV, ToMV and ToMMV, the method comprising:

[0206] - transiently or constitutively expressing the mutated Tm-2-2 gene to be tested in the presence of the motor protein (MP) of ToBRFV in an alternative plant host, preferably in a plant of the Solanaceae family, even more preferably in a species of the genus Nicotiana or Capsicum, and

[0207] - detecting the interaction between the protein expressed by the mutated gene and the ToBRFV MP protein, and preferably detecting a hypersensitive reaction.

[0208] Preferred Nicotiana and Capsicum species are Nicotiana benthamiana, Nicotiana tabacum and Capsicum annuum. The method is described in the experimental section of the present application in Nicotiana benthamiana and Nicotiana tabacum plants. If resistance to part or all of TMV, ToMV and ToMMV is also required, the method can be performed simultaneously, replacing the ToBRFV MP with the MP of these viruses. Preferably, the mutated Tm-2-2 gene or the mutant of the Tm-2-2 gene is as defined in conjunction with the aforementioned aspects of the present invention, i.e., having at least one of C848R, N822C, N822F, N822M, N822Y, N822W, S825H, S825K and S825T substitutions, and having Y, F or W at position 767, and possibly also having L at position 655. By this method, other mutations of the Tm-2-2 gene can be tested easily and quickly.As already emphasized, the detection of hypersensitivity in this assay is an alternative to the detection of resistance to the tobacco mosaic virus in tomatoes containing the mutant Tm-2-2 gene to be tested.

[0209] Similarly, in order to identify, detect or select mutants of TM-2-2 protein that confer resistance to ToBRFV, the method is performed by transiently or constitutively expressing a nucleotide sequence encoding the mutant of the TM-2-2 protein to be tested.

[0210] sequence:

[0211] SEQ ID No: 1: Nucleotide sequence of tm2.

[0212] SEQ ID No: 2: Nucleotide sequence of Tm-2.

[0213] SEQ ID No: 3: Nucleotide sequence of Tm-2-2.

[0214] SEQ ID No: 4: Nucleotide sequence of Tm2-14-25.

[0215] SEQ ID No: 5: Nucleotide sequence of Tm2-467.

[0216] SEQ ID No: 6: Amino acid sequence of the protein encoded by tm2.

[0217] SEQ ID No: 7: Amino acid sequence of TM-2 encoded by Tm-2.

[0218] SEQ ID No: 8: Amino acid sequence of TM-2-2 encoded by Tm-2-2.

[0219] SEQ ID No: 9: Amino acid sequence of TM2-14-25 encoded by Tm2-14-25.

[0220] SEQ ID No: 10: Amino acid sequence of TM2-467 encoded by Tm2-467.

[0221] SEQ ID No: 11: Amino acid sequence of the LRR domain of TM-2-2.

[0222] SEQ ID No: 12: Nucleotide sequence encoding the LRR domain of TM-2-2.

[0223] SEQ ID No: 13: Amino acid sequence of the movement protein of TMV.

[0224] SEQ ID No: 14: Amino acid sequence of the movement protein of ToMV.

[0225] SEQ ID No: 15: Amino acid sequence of the movement protein of ToBRFV.

[0226] SEQ ID No: 16: Amino acid sequence of the movement protein of ToMMV.

[0227] SEQ ID No: 17: Amino acid sequence of TM2-4.

[0228] SEQ ID No: 18: Amino acid sequence of TM2-5.

[0229] SEQ ID No: 19: Amino acid sequence of TM2-825H.

[0230] SEQ ID No: 20: Amino acid sequence of TM2-825K.

[0231] SEQ ID No: 21: Amino acid sequence of TM2-825T.

[0232] SEQ ID No: 22: Amino acid sequence of TM2-822C.

[0233] SEQ ID No: 23: Amino acid sequence of TM2-822-F.

[0234] SEQ ID No: 24: Amino acid sequence of TM2-822-M.

[0235] SEQ ID No: 25: Amino acid sequence of TM2-822-Y.

[0236] SEQ ID No: 26: Amino acid sequence of TM2-822-W.

[0237] SEQ ID No: 27: Nucleotide sequence of TM2-4.

[0238] SEQ ID No: 28: Nucleotide sequence of TM2-5.

[0239] SEQ ID No: 29: Nucleotide sequence of TM2-825H.

[0240] SEQ ID No: 30: Nucleotide sequence of TM2-825K.

[0241] SEQ ID No: 31: Nucleotide sequence of TM2-825T.

[0242] SEQ ID No: 32: Nucleotide sequence of TM2-822C.

[0243] SEQ ID No: 33: Nucleotide sequence of TM2-822-F.

[0244] SEQ ID No: 34: Nucleotide sequence of TM2-822-M.

[0245] SEQ ID No: 35: Nucleotide sequence of TM2-822-Y.

[0246] SEQ ID No: 36: Nucleotide sequence of TM2-822-W.

[0247] SEQ ID No: 37: Nucleotide sequence of primer npt2F.

[0248] SEQ ID No: 38: Nucleotide sequence of primer npt2R.

[0249] SEQ ID No: 39: Nucleotide sequence of primer tm2-2-F2.

[0250] SEQ ID No: 40: Nucleotide sequence of primer thsp-R.

[0251] SEQ ID No: 41: Nucleotide sequence of binary plasmid pJL469.

[0252] SEQ ID No: 42: Nucleotide sequence of binary plasmid pJL470.

[0253] SEQ ID No: 43: Nucleotide sequence of binary plasmid pJL471.

[0254] SEQ ID No: 44: Nucleotide sequence of primer LM_TBRFV-1-F.

[0255] SEQ ID No: 45: Nucleotide sequence of primer LM_TBRFV-1-R.

[0256] SEQ ID No: 46: Nucleotide sequence of probe LM_TBRFV-1-probe. BRIEF DESCRIPTION OF THE DRAWINGS

[0257] Figure 1 Figure 3: Transient expression of different TM-2-2 variants in N. benthamiana in the presence or absence of TMV or ToBRFV movement proteins. Photos taken approximately 5 days after infiltration.

[0258] Figure 2 Figure 2: Transient expression of different TM-2-2 variants in N. benthamiana in the presence or absence of TMV or ToBRFV motor proteins. Leaves of two N. benthamiana plants of different ages were infiltrated. Approximately 50-day-old plants (left) or 43-day-old plants (right) were infiltrated with Agrobacterium culture to transiently express different TM-2-2 protein variants in the presence or absence of TMV or ToBRFV motor proteins. Photos taken approximately 5 days after infiltration.

[0259] Figure 3: Plasmids for tomato transformation

[0260] Figure 3A : Binary plasmid pJL469 (SEQ ID NO: 41)

[0261] Figure 3B : binary plasmid pJL470 (SEQ ID NO: 42),

[0262] Figure 3C : Binary plasmid pJL471 (SEQ ID NO: 43).

[0263] Figure 4 : Alignment of proteins of genes Tm2-2, Tm-2-14-25 and Tm2-467.

[0264] Figure 5: Transient expression of different TM-2-2 variants in N. benthamiana in the presence or absence of the motor protein of ToBRFV. TM22 848R variants with different amino acids at AA 767 were transiently expressed in the presence (+MP) or absence of the motor protein of ToBRFV. The various amino acids at position 767 are labeled in the figure using a standard single amino acid code to identify the variants. Photographs taken 2 days after Agrobacterium infiltration.

[0265] Figure 5A :N.benthamiana

[0266] Figure 5B :Tobacco (N.tabacum)

[0267] Example

[0268] The TM-2-2 protein (product of the Tm-2-2 gene) is a nucleotide-binding leucine-rich repeat protein (NLR). It binds to the movement protein (MP) produced by either TMV or ToMV, signaling an effective immune response against the invading virus and conferring resistance to both TMV and ToMV. The binding between TM-2-2 and the tobacco mosaic virus MP can be observed as a hypersensitivity reaction (tissue necrosis) in transient expression assays in Nicotiana benthamiana.

[0269] The NLR proteins TM-2 and TM-2-2 differ by only four amino acids (Lanfermeijer et al., 2005). These differences are associated with distinct resistance profiles. For example, the TM-2-2 variant can confer resistance to a wider range of TMV and ToMV isolates than TM-2 (Lanfermeijer et al., 2005; Lanfermeijer, 2004). One amino acid change, specifically amino acid 767 in the LRR domain, was shown to be responsible for a more durable and broader host resistance spectrum in the TM-2-2 protein (Kobayashi et al., 2011). However, the TM-2 and TM-2-2 proteins do not confer resistance to ToBRFV.

[0270] Therefore, the present inventors hypothesized that mutations in the TM-2 and TM-2-2 proteins could retain the ability to recognize ToMV and TMV MPs while conferring the ability to also recognize ToBRFV MPs.

[0271] Using transient expression assays in N. benthamiana to test the ability to recognize tobacco mosaic virus MP, the inventors have been able to effectively test a large number of variants. They unexpectedly isolated variants of the TM-2-2 protein that effectively recognized the movement protein (MP) of ToBRFV and triggered a hypersensitive response when co-expressed with ToBRFV MP (effector). In addition, these variants also bind and respond to ToMV and TMV MP.

[0272] The DNA sequences of these variants have been obtained, as well as the sequences of other variants that recognize ToBRFV MP in addition to TMV and ToMV MP (Examples 2, 3, 4 and 5).

[0273] Plants containing the TM-2-2 mutant were obtained by TILLING (Example 6) and by Agrobacterium transformation (Example 7).

[0274] Example 1: Materials and Methods

[0275] 1.1. The sequences of the tm-2 gene alleles and MP proteins mentioned in this section are:

[0276] Table 1. List of some tm2 gene alleles.

[0277]

[0278]

[0279] TMV-U1 = Tobacco mosaic virus U1

[0280] ToMV = Tomato mosaic virus GeRo strain

[0281] ToBRFV = Tomato brown rugose fruit virus

[0282] HR = hypersensitivity reaction

[0283] R = resistant; S = susceptible

[0284] Table 2. Amino acid sequences of selected tobacco mosaic virus MPs mentioned in the Examples.

[0285] MP source Amino acid sequence Plasmid name TMV (AF546184.1Flavum strain) SEQ ID No: 13 pJL 380 ToMV(X02144.1OM strain) SEQ ID No:14 pJL 481 ToBRFV (MS549394.1Ca1A isolate) SEQ ID No:15 pJL 379 ToMMV(KX898033) SEQ ID No: 16

[0286] 1.2. Mutagenesis:

[0287] To find TM-2-2 protein variants that trigger HR in the presence of ToBRFV MP (hereafter MP_Rugose), two different approaches were used, random and site-directed mutagenesis, each designed to generate variations in the LRR domain of TM-2-2.

[0288] The final approximately 750 nucleotides of the TM-2-2 gene were amplified by PCR using the Takara Diversify PCR Random Mutagenesis Kit and PCR conditions that produced an average of four changes per 1000 base pairs. The resulting PCR product was cloned into the Tm-2-2 gene expression plasmid, replacing the wt 3' to 750 nt of the Tm-2-2 gene.

[0289] When needing to introduce variation at the specific position of Tm-2-2 gene, site-directed mutagenesis can be used.This is to realize by synthesizing the part of the Tm-2-2 gene with sequence variation at the specific codon place interested.For example, the synthetic oligonucleotide that can be used as primer in PCR can be designed for amplification part Tm-2-2 gene, but still is designed to have one or more non-wild type Nucleotide at the specific position.After carrying out PCR with this type of oligonucleotide primer, PCR product can be cloned into the appropriate position of Tm-2-2 gene.In this way, Nucleotide diversity can be introduced at the specific position in the gene.

[0290] 1.3. Transient Expression and Necrosis Assessment in N. benthamiana:

[0291] Transient expression in N. benthamiana and N. tabacum was performed essentially as described in Ma et al. and Kobayashi et al.

[0292] The product of the ligation reaction disclosed in Example 1.2 was transformed into Agrobacterium tumefaciens (GV3101) and plated on LB plates containing 50 ug / ml kanamycin and 25 ug / ml gentamicin to select transformed Agrobacterium.

[0293] Approximately 860 different Agrobacterium colonies were selected from the transformation. Each colony was grown in liquid culture and used to prepare an Agrobacterium suspension for agroinfiltration using standard procedures commonly used in plant biology (Tomita et al., 2019). Prior to infiltration into N. benthamiana leaves, the culture was mixed 1:1 with an Agrobacterium suspension transformed with a Tobacco Mosaic Virus MP expression plasmid (e.g., ToBRFV MP expression plasmid pJL379).

[0294] The infiltrated plants were maintained at 22°C to 25°C under LED or fluorescent lighting (18 hours of light and 6 hours of darkness). With an error rate of approximately 4 changes per kb, it is estimated that approximately 2500 nucleotide changes were sampled (750 base pairs / clone x 860 clones x 4 errors / 1000 base pairs = approximately 2580 nucleotide changes). In the initial characterization of the library by sequencing, the inventors estimated that approximately 75% of nucleotide changes would result in an amino acid change. If 75% of all nucleotide mutations in the clones screened resulted in an amino acid change, this would screen for approximately 1900 amino acid changes in the TM-2-2 protein (0.75 x 2580 = 1935).

[0295] Approximately 6 days after infiltration, the infiltrated leaves were observed and the degree of necrosis in the infiltrated area (hypersensitive reaction, HR) was measured. A 0 to 4 scale was typically used to estimate the percentage of the infiltrated area showing necrosis. The scale details are as follows: 0 = 0% HR, 1 = approximately 25% HR, 2 = approximately 50% HR, 3 = approximately 75% HR, and 4 = 100% HR. As a control, plants were also infiltrated with a 1:1 mixture of Agrobacterium carrying the wt Tm-2-2 expression plasmid (pJL366) and the Rugose MP expression plasmid (pJL379).

[0296] 1.4. Protocol for evaluating tobacco mosaic virus resistance:

[0297] Several tobacco mosaic virus isolates were used to perform the bioassays: ToBRFV isolates (particularly Jordan_2015), ToMV, TMV or other tobacco viruses.

[0298] Virus isolates were maintained by frozen storage of infectious sap from 14-day-old infected tomato leaves ground in water (inoculation ratio: 1 g leaf / 4 ml water). Bioassays were performed by inoculating tomato plantlets at the two-leaf stage (i.e., 14-16 days after sowing) with sap by rubbing the cotyledons with the index finger. At least 18 plantlets (replicates of 2 or 3 isolates) of each tomato line / germ / genotype were tested for resistance to tobacco mosaic virus.

[0299] The phenotypic evaluation of the plants was carried out by scoring each plant without touching the plants. The presence of local lesions on the inoculated organs was carried out between 7 and 10 days in the experiment. If at least one plant of each genotype showed local lesions on the inoculated organs, the genotype was considered to be potentially interesting. In fact, tobacco mosaic virus does not usually cause necrosis on susceptible plants.

[0300] Systemic symptoms were assessed at 14, 21, and 28 days per iod (dpi), with the last assessment optional. Symptoms were visually assessed according to the following scale: 9: no visible symptoms / 7: minor phenotypic differences, but not clearly attributable to disease symptoms / 5: mild symptoms (mosaicing and / or shallow veining) / 3: strong symptoms (strong mosaicing and / or pronounced veining and / or leaflet deformation) / 1: very strong symptoms (leaf deformation and / or mosaicing and / or very pronounced veining).

[0301] After 14 and / or 28 days of testing, symptom-free plants were tested by ELISA and / or quantitative PCR to assess the presence of TMV in the plants.

[0302] 1.5. TILLING (Targeted Induction of Localized Damage in Genomes):

[0303] The Tilling method was applied according to the usual protocol.

[0304] All DNA-reactive chemical agents (mutagens) can be used to induce DNA damage and are not limited to EMS.

[0305] Physical DNA reactants (mutagens) can also be used, such as:

[0306] Ionizing radiation (X-rays, gamma rays, alpha particles, etc.), heavy ion beam irradiation

[0307] Ultraviolet radiation

[0308] Radioactive decay

[0309] A physical or chemical mutagen is applied to M0 seeds. M1 plants, heterozygous for all mutations introduced by the mutagen, are then selfed to produce M2 seeds. A portion of these seeds is stored. At least eight M2 plants are then sampled for sequencing. The theoretical ratio is that 1 / 2 of the plants will be heterozygous for a given mutation, 1 / 4 will be homozygous for that mutation, and 1 / 4 will be homozygous for the absence of the mutation.

[0310] Alternatively, screening for suitable mutations can also be performed on M1 plants.

[0311] In the present case, as long as the expected mutation in the Tm-2-2 gene is highly specific, it is important to test a large number of mutants.

[0312] Example 2 :Identification of the Tm2 gene allele that recognizes ToBRFV MP.

[0313] background:

[0314] Tomato brown rugose fruit virus (ToBRFV) is a serious pathogen of tomatoes and peppers. It is related to other tobacco mosaic viruses such as tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV).

[0315] Genetic resistance to TMV and ToMV maps to Tm-2 - 2 gene. The TM-2-2 protein is the product of the Tm-2 gene and is a resistance (R) protein of the nucleotide-binding leucine-rich repeat (NLR) class (also known as the NBS-LRR class). There are two commonly used Tm-2 gene alleles in commercial tomato germplasm, namely Tm-2 and Tm-2-2. Different alleles confer resistance to different tobacco mosaic viruses (see Table 1). In particular, the Tm-2-2 allele is widely used in commercial tomato germplasm because it confers durable genetic resistance to two tobacco mosaic viruses (TMV and ToMV), which are major disease threats to tomatoes. However, ToBRFV can infect plants carrying either the Tm-2 or Tm-2-2 genes, and no Tm-2 allele that confers resistance to ToBRFV has been identified.

[0316] In addition, there are currently no known resistance genes that can simultaneously provide effective resistance to ToBRFV, TMV, and ToMV.

[0317] The TM-2-2 protein confers resistance to TMV and ToMV by binding to the movement protein (MP) produced by either virus. This protein also signals an effective immune response against the invading virus by triggering a hypersensitive response (HR) in tomatoes, leading to cell death. The consequences of TM-2-2 binding to the tobacco mosaic virus MP, known as the HR response, were also observed by transiently expressing TM-2-2 and either TMV or ToMV MP in leaves of Nicotiana benthamiana plants, following the protocol published in Kobayashi et al., 2011.

[0318] Transient expression of TM-2-2 and TMV or ToMV MP in N. benthamiana leaves (via agroinfiltration) did result in hypersensitivity and extensive tissue necrosis within a few days. In contrast, transient expression of TM-2-2 and ToBRFV MP (MP_Rugose) in N. benthamiana leaves generally did not result in necrosis, or occasionally resulted in very mild necrosis.

[0319] The HR response assay in Nicotiana benthamiana was previously used to identify specific amino acids in NLR proteins that are critical for recognizing TMV MPs (Kobayashi et al., 2011). The ability of the TM2 NLR protein to trigger a robust HR response in N. benthamiana leaves (in the presence of TMV MPs) correlated perfectly with viral resistance in tomato. Furthermore, transient protein expression via Agrobacterium infiltration is a well-established technique in plant biology.

[0320] Given this perfect correlation, this assay in N. benthamiana can be used as a surrogate for resistance in tomato.

[0321] However, although previous uses of this assay or method were aimed at identifying specific amino acids in NLR proteins that are critical for recognizing tobacco mosaic virus MP, Loss of function The inventors used this method for the first time to test mutations that may provide Functional gain mutants, namely the ability to recognize other tobacco mosaic virus MPs.

[0322] The inventors first used an error-prone PCR method to generate a mutant library of the Tm-2-2 gene. This variant library was then transiently expressed in leaves of N. benthamiana plants together with ToBRFV-MP (see Materials and Methods in Examples 1.2 and 1.3). After screening more than 860 transformed Agrobacterium cultures (corresponding to an average of 2.25 amino acid modifications per variant), the inventors identified a colony (LP 14-25) that showed a reproducible and significantly increased HR response (compared to the control) when co-expressed with ToBRFV MP. ​​In addition, the inventors have verified that the variant that triggered a strong HR response in the presence of ToBRFV MP did not lose its ability to trigger a strong HR response in the presence of TMV or ToMV MP (see Figure 1 and Figure 2 and Table 3).

[0323] Table 3 :HR responses of various TM2 protein variants to tobacco mosaic virus movement protein.

[0324] protein TMV_U1 MP SEQ ID No:13 ToBRFV MP SEQ ID No: 15 tm2 - - Tm-2-2 + - Tm2-14-25 + + Tm2-467 + +

[0325] - = No HR response when proteins were co-expressed in N. benthamiana leaves.

[0326] + = Strong HR response when proteins were co-expressed in N. benthamiana leaves.

[0327] Detailed analysis of this variant showed that it differed from the TM-2-2 protein at two amino acids (F655L and C848R). This new variant was designated Tm2-14-25 (see Table 1).

[0328] By using additional analysis of standard molecular techniques including site-directed mutagenesis, the inventors mapped the ability to recognize ToBRFVMP to a single amino acid change (C848R). The inventors identified this new Tm-2 allele as Tm2-467 (see Tables 1 and 4). This experiment showed that the C848R change in TM-2-2 is both involved in and sufficient to detect and respond to MP Rugose (ToBRFV-MP).

[0329] Table 4 Reporting HR responses for different variants:

[0330] Construct name Amino acid changes in TM-2-2 HR when expressed in MP Rugose LP_14-25 F655L、C848R 4 pJL 466 F655L <1 pJL 467 C848R 4 pJL 366 None (wt TM-2-2) <1

[0331] Figure 4 Shown is an alignment of proteins TM2-2, TM2-14-25, and TM2-467 (the protein products of the Tm-2-2, Tm2-14-25, and Tm2-467 genes, respectively).

[0332] Since both TM2-14-25 and TM2-467 proteins recognized ToBRFV MP, it is clear that the amino acid changes they share lead to the ability to robustly recognize ToBRFV MP (compared to the TM-2-2 protein). It was also observed that the protein can have additional mutations (such as changes unique to TM2-14-25) and still recognize ToBRFV MP. ​​TM2-14-25 and TM2-467 proteins still recognized TMV and ToMV MP.

[0333] The TM2_14-25 or TM2-467 protein sequence can improve the resistance of tomato to ToBRFV, and also confer resistance to TMV and ToMV.

[0334] Example 3 : Additional mutants.

[0335] As described in the previous example, the present inventors have shown that a single amino acid change in the TM-2-2 protein is sufficient to trigger a strong HR response in the presence of ToBRFV MP without losing resistance to TMV and ToMV.

[0336] In order to better characterize this mutation and the additional mutation that may improve resistance, other amino acid variations were created using a site-directed approach. Selected codons in the LRR domains were changed to encode non-wild-type amino acids. Functional screening of protein variants (as described above) was performed by agrobacterium infiltration and transient expression in N. benthamiana in the presence of MP-rugose. In some cases, selected amino acid changes were screened in the TM-2-2 protein background, which also had the 848R changes discussed in Example 2. The results of some screenings are shown in Tables 5-11.

[0337] Position 848

[0338] Table 5: Testing of mutants at position 848

[0339]

[0340]

[0341] in conclusion : None of the amino acid variations at position 848 produced a TM-2-2 variant that induced a similar, not to mention a more intense, hypersensitivity response compared to C848R in the presence of MP_Rugose.

[0342] Position 857

[0343] The effect of amino acid variation at position 857, which is near position 848 and amino acid 848 in the 3D structure of the TM-2-2 protein, was also tested. The results are shown in Table 6.

[0344] Table 6 : Testing of mutants at position 857, with or without the C848R mutation.

[0345] Construct name Amino acid 848 Amino acid 857 HR to MP Rugose pJL 366 C(wt) K(wt) <1 pLP 14-25 R K 3 pJL 480Q R Q 3 pJL 480E R E <1 pJL 480T R T <1 pJL 480R R R <1 pJL 480I R I <1

[0346] in conclusion Several amino acid changes at position 857, which convert amino acid 848 to R, reduced the HR response to MP Rugose. However, other amino acid changes near 848R maintained the response to MP Rugose.

[0347] Therefore, variation at position 857 is permitted, but within a limited range. Acceptable variation can be easily tested.

[0348] Position 767

[0349] The effect of the amino acid change at position 767 (only) was also tested (no variation at position 848). Kobayasi et al. have shown that the amino acid at this position is crucial for the difference in resistance between TM-2 and TM-2-2. The results are shown in Table 7.

[0350] Table 7:

[0351] Construct name Amino acid 767 HR to MP Rugose pJL 366 Y(wt) <1 L11_10 I 0 L11_11 C 0 L11_15 L 0 L11_16 G 0 L11_19 N 0 L11_20 V 0 L11_1 R <1

[0352] in conclusion Of the seven different amino acid variants tested at position 767, none improved the ability to detect and respond to MP Rugose in the absence of the CR848R mutation.

[0353] Position 769

[0354] The effect of the amino acid change at position 767 (only) was also tested (no variation at position 848). The results are shown in Table 8.

[0355] Table 8:

[0356] Construct name Amino acid 769 HR to MP Rugose pJL 366 S(wt) <1 L12_11 G <1 L12_12 R <1 L12_4 F <1 L12_16 E <1 L12_3 V <1 L12_A A 0

[0357] in conclusion : TM22 variants with 6 different (non-wt) amino acids at position 769 were tested and no variant was found that bound and responded to MP Rugose better than the C848R variant.

[0358] TM-2-2 848R Location 767 in the background

[0359] In addition to the C848R mutation, the effect of the amino acid mutation at position 767 was also tested. The results are shown in Table 9.

[0360] Table 9:

[0361] Construct name Amino acid 767 Amino acid 769 Amino acid 848 HR to MP Rugose pJL 511_1 S A R 0 pJL 511_2 S S(wt) R 0 pJL 511_3 Y A R 4 pJL 511_5 Y(wt) S(wt) R 4 pJL 511_8 D A R 0 pJL 511_12 D S(wt) R 0

[0362] in conclusion Detection of :MP Rugose is dependent on amino acids at positions 767 and 848.

[0363] TM-2-2 variants with amino acid 848 as R and amino acid 767 as Y could detect and respond to MP-Rugose. However, changing amino acid 767 to S or D significantly reduced the protein's ability to respond to MP-Rugose. This suggests that both residues 767 and 848 are important for binding to MP-Rugose.

[0364] However, further studies by the inventors have shown that position 767 can be substituted by W and F without significantly reducing the ability of the protein to respond to MP_Rugose, and even enhancing this ability (see Example 4).

[0365] Position 822

[0366] In the context of the C848R variant, the effect of the amino acid variant at position 822, which is considered to be near amino acid 848 in the 3D structure of the TM-2-2 protein, was also tested. The results are shown in Table 10.

[0367] Table 10:

[0368] Construct name Amino acid 822 Amino acid 848 HR to MP Rugose pJL 366 N(wt) C(wt) <1 pLP 14-25 N R 4 pJL 476_S S R 4 pJL 476_I I R 0 pJL 476_F F R 2 pJL 476_C C R 2 pJL 476_T T R <1 pJL 477_H H R <1 pJL 477_D D R <1 pJL 476_K K R 0 pJL 476_R R R 0

[0369] in conclusion Various amino acids at position 822 can reduce the ability of TM22 848R to bind and respond to MP-rugose, but other variations are permitted. When 848 is R, amino acids N and S are preferred at position 822.

[0370] However, further studies by the inventors have shown that position 822 can be substituted by C, F, M, Y and W and provide the ability of the protein to respond to MP_Rugose even in the absence of the C848R mutation (see Example 5).

[0371] In total, more than 1,000 different variants were screened using a combination of site-directed and random mutagenesis in the process of identifying this mutant and others containing mutations that allow this gain-of-function. It is important to note that some members of the mutant library obtained by random mutagenesis were screened in the HR assay without sequencing.

[0372] Table 11 below details the different variants screened for response to ToBRFV MP and mentions the mutation tested (if known).

[0373] Table 11 : Overview of TM22 variants screened for response to MP_Rugose

[0374]

[0375] In summary, based on these tests, 767Y and 848R in TM-2-2 appear to be key residues for binding and responding to MP-Rugose (however, other modifications appear to be permissible, see Example 4). Other amino acid changes at other positions in the LRR domain generally result in a slight or sometimes significant reduction in MP-Rugose binding, but not all; suitable amino acid changes can be easily tested by the assays described in the present invention.

[0376] The amino acids near amino acid 848 in the 3D structure of TM-2-2 may be less prone to mutation without losing binding to ToBRFV.

[0377] In other experiments, libraries of variants of a single codon were screened. An example of such an experiment, at codon 827, yields the following results:

[0378] Degenerate codon library at codon 827 in the TM-2-2 848R gene background

[0379]

[0380] Degenerate codon library screened at codon 827 in the TM22 (848C) gene context

[0381]

[0382] Similar to the results obtained at other positions, the results obtained with libraries 1–6 indicate that the variation at position 848 is important, and that variations at other codons in the LRR region of TM-2-2 Won't Generate variants that better recognize and respond to MP_rugose. Regardless, the mutation at position 848 appears to be required for MP_rugose recognition.

[0383] Example 4: Additional modifications at position 767 and validation in different Nicotiana species.

[0384] Other modifications at position 767 of TM-2-2 protein variants comprising the C848R substitution have been tested in different Nicotiana species.

[0385] Specifically, plants (N. benthamiana and N. tabacum) were infiltrated with Agrobacterium cultures containing plasmids with T-DNA to express TM-2-2 protein variants alone or to co-express TM-2-2 protein variants and MP_Rugose.

[0386] The results are shown in Figure 5. The letters spotted on the leaves represent the amino acid at position 767 in the TM-2-2 848R variant background. TM-2-2 variants were expressed alone (letters only) or co-expressed with Rugose MP (+MP).

[0387] Plants were photographed approximately 48 hours after infiltration.

[0388] The results showed that TM-2-2 767Y 848R (TM2-467); 767F 848R (TM2-4) and 767W 848R (TM2-5) were all in N. benthamiana ( Figure 5A ) or N. tabacum cv Xanthi ( Figure 5B ) in the presence of MP-Rugose. In this assay, the 767W and Y variants appeared to be more "responsive" to MP-Rugose than the 767F variant. In contrast, TM-2-2 variants with R, Q, or G amino acids at position 767 did not trigger HR in the presence of MP-Rugose.

[0389] Example 5: Identification of additional Tm2 gene alleles that recognize ToBRFV MP.

[0390] Given the importance of the C848R mutation, other mutants have been tested in which amino acids near C848 in the 3D structure are mutated. That is, 20 different amino acids have been tested at positions 822 and 825 of the TM2-2 protein in the absence of the C848R mutation.

[0391] Plants (N. benthamiana) were infiltrated with Agrobacterium cultures containing plasmids with T-DNA to express TM-2-2 protein variants alone or to co-express TM-2-2 protein variants and MP_Rugose.

[0392] Table 12 reports the variants that caused strong hypersensitivity reactions, as well as details of the alleles at positions 767, 822, 825, and 848. All other variants at positions 822 and 825 did not cause HR to MPRugose in combination with C848 (wt) and Y767 (wt).

[0393] Table 12: Other variants at positions 822 and 825 and results of HR testing on MP Rugose

[0394]

[0395] In summary, in addition to the C848R mutation of the TM2-2 protein, the N822C, N822F, N822M, N822Y, N822W, S825H, S825K and S825T mutations of the TM2-2 protein are also sufficient to confer resistance to ToBRFV, which can be inferred from the HR response to MP_Rugose.

[0396] Example 6: Non-transgenic plants carrying new Tm2 variants that recognize ToBRFV MP were provided by the TILLING (targeted induced local lesions in genomes) strategy.

[0397] In the mutagenized population:

[0398] A large population of mutant tomatoes is created using physical or chemical mutagens known to those skilled in the art that induce various random mutations in the genomic sequence by nucleotide substitution. The parental lines used for the population are preferably those carrying homozygous levels of Tm2 2 This strain is resistant to ToMV and TMV, and is susceptible to ToBRFV.

[0399] Large-scale screening of the population is performed at the M1 or M2 step (protocol detailed in Example 1.5) to identify variations in the Tm2 gene (Solyc09g018220) using well-known screening methods (preferably molecular assay-based or sequencing-based).

[0400] Plants carrying the Tm2 gene variant are selfed to produce seed. The next generation (M2 or M3) is genotyped for the targeted variant, and heterozygous or homozygous plants (fixed variant) are used for phenotypic analysis and for introgression into the Elite line using MABC (marker-assisted backcrossing) or other classical breeding methods. Several backcrosses are performed to remove additional variants in the genetic background.

[0401] Plants carrying the mutations were phenotyped for resistance to ToBRFV and other tobacco mosaic viruses using the protocol detailed in Example 1.4.

[0402] Example 7: Providing transgenic plants carrying a new Tm2 variant that recognizes ToBRFV MP

[0403] The Anabelle tomato line was used for Agrobacterium transformation with the Tm2-2 variant, as identified in the previous section of the Results.

[0404] The seeds were surface sterilized in 2% sodium hypochlorite containing 2 drops of Tween 20 for 20 minutes under agitation and then washed three times with sterile distilled water.

[0405] The seeds were then cultured in plastic pots on MS medium (M0222, Duchefa) with a pH of 5.9, 20 g / l sucrose and 0.8% microagar, at 25° C. under illumination (3000-4000 lux, 16 h photoperiod).

[0406] Explants were cut from the cotyledons of 10-day-old seedlings. Using sterile forceps and a razor blade, both ends of each cotyledon were removed, and the cotyledon was then cut into two pieces. The explants were placed on a 10 cm diameter Petri dish containing CC medium (MS medium pH 5.9, containing 20 g / l sucrose and 0.8% microagar, supplemented with 2 mg / l NAA, 1 mg / l BAP, 160 mg / l glucuronic acid, and 40 mg / l acetosyringone) and placed under light at 25°C (3000-4000 lux, 16-hour photoperiod) for one day.

[0407] By combining the binary plasmids pJL470, pJL471 and pJL469 (see Figure 3A 、 3B and 3C) were electroporated into Agrobacterium tumefaciens strain GV3101 to obtain Agrobacterium tumefaciens strains A1224, A1225, and A1250.

[0408] Cells of a single colony of Agrobacterium tumefaciens containing the T-DNA plasmid were cultured in 15 ml of LB broth containing 10 μg / ml rifampicin and 50 μg / ml kanamycin in a shaking incubator (200 rpm) at 28° C. for 20 hours.

[0409] The bacteria were pelleted by centrifugation of the overnight suspension at 1000 g for 20 min and resuspended in sterile CC liquid medium (MS medium pH 5.9 containing 20 g / l sucrose supplemented with 2 mg / l NAA, 1 mg / l BAP, 160 mg / l glucuronic acid and 40 mg / l acetosyringone) to an OD600 nm of 0.1.

[0410] In a sterile beaker, cotyledon explants were immersed in an Agrobacterium suspension for 15 minutes under slow agitation (100 rpm). Explants were blotted dry on sterile filter paper using sterile tweezers and then transferred to solid CC medium (MS medium pH 5.9, containing 20 g / l sucrose and 0.8% microagar, supplemented with 2 mg / l NAA, 1 mg / l BAP, 160 mg / l glucuronic acid and 40 mg / l acetosyringone). Plates were placed under 25°C illumination (3000-4000 lux, 16 hour photoperiod) for 48 hours.

[0411] Explants were rinsed twice with 100 ml of liquid MS medium (pH 5.9, containing 20 g / l sucrose and supplemented with 100 mg / l amoxicillin, 20 mg / l clavulanic acid), then blotted dry on sterile paper and transferred to solid selection medium (MS medium containing 20 g / l sucrose and 0.8% microagar, supplemented with 1 mg / l zeatin, 100 mg / l amoxicillin, 20 mg / l clavulanic acid and 100 mg / l kanamycin) (10 explants / dish). The dishes were placed under 25° C. light (3000-4000 lux, 16 hour photoperiod) and the medium was changed every 2 weeks until shoot regeneration.

[0412] Shoots and plantlets were isolated and placed in plastic pots containing rooting medium (MS medium, pH 5.9, containing 20 g / l sucrose and 0.8% micro agar, supplemented with 0.5 mg / l IAA, 100 mg / l amoxicillin, 20 mg / l clavulanic acid and 100 mg / l kanamycin). The pots were placed at 25°C under light (3000-4000 lux, 16 hour photoperiod).

[0413] The plantlets with good root systems are transferred to soil. The roots are rinsed with water, the agar is carefully removed, and the plantlets are placed in a tray filled with soil and transferred to the greenhouse.

[0414] After two weeks of acclimatization, the plants were sampled and one young leaf was analyzed by flow cytometry to select diploid plants. Genomic DNA was extracted from the young leaf discs and the nptII gene was amplified by PCR using the following primers:

[0415] Forward primer: npt2F CCTGCCGAGAAAGTATCC (SEQ ID NO: 37) and

[0416] Reverse primer: npt2R GCCAACGCTATGTCCTGA (SEQ ID NO: 38)

[0417] To screen transformants.

[0418] Transformants were also characterized by PCR amplification using the following primers:

[0419] Forward primer: tm2-2-F2 TTCCTCCAAATCTCATCAAGC (SEQ ID NO: 39), and

[0420] Reverse primer: thsp-R CAACAAGCCAAGAgAAAACACA (SEQ ID NO: 40).

[0421] Plants obtained through this program have been tested to confirm resistance to ToBRFV, as well as resistance to TMV, ToMV, and ToMMV.

[0422] Molecular quantification of ToBRFV sequences in infected plants was also performed by quantitative PCR (qPCR) using TaqMan probes to confirm the reduction of viral replication.

[0423] The protocol for molecular quantification of ToBRFV by qPCR is as follows:

[0424] Young leaves growing from the head were sampled (3 to 4 leaves per plant). The leaves were ground in liquid nitrogen and 100 mg of the sample was retained for RNA extraction. For each sample, 100 mg of ground leaves were used for RNA extraction.

[0425] use of 16LEV Plant RNA Kit" and Extraction Robot RNA was extracted and stored at -20°C.

[0426] TaqMan Universal Master Mix (ThermoFisher) was used according to the manufacturer's instructions. ) and the kit GoTaq probe one-step RTqPCR system A6120 Promega were used for virus quantification by qPCR.

[0427] The primers and probes used are disclosed in the table below:

[0428] Primers sequence SEQ ID NO LM_TBRFV-1-F AGATTTCCCTGGCTTTTGGA SEQ ID NO:44 LM_TBRFV-1-R CTCTTTCTGATATCAAGCACT SEQ ID NO:45 LM_TBRFV-1-probe CAAGGAGAGACTGCTAAATCGG SEQ ID NO:46

[0429] The length of the amplified fragment was 187 bp.

[0430] Mixture:

[0431] Kit TaqMan universal master mix, Applied Biosystem ThermoFisher Scientific.

[0432]

[0433] The total volume of the mixture was 20 μL; 2 μL of RNA was added; the final volume was 22 μL.

[0434] Thermal cycler:

[0435] Reverse transcription: 45°C for 15 minutes;

[0436] Inactivation of reverse transcription and activation: 95°C for 2 minutes;

[0437] The 40 loops include:

[0438] Denaturation: 95°C for 15 seconds,

[0439] Anneal primers: 54°C for 15 seconds; and

[0440] Annealing probe: 48°C for 30 seconds.

[0441] For each sample, three replicates were performed, and a standard dilution curve was used for relative quantification.

[0442] exist Perform a melting curve at the end of the protocol to ensure specificity of detection / quantification

[0443] The Ct of each sample was reported on the standard curve to calculate the relative amount of virus in each sample.

[0444] result:

[0445] The Anabelle tomato line, which is susceptible to ToMV, TMV, ToBRFV and ToMMV, was used for Agrobacterium transformation with the Tm2-2 variant, as identified in the previous section of the Results.

[0446] Infection with ToBRFV was carried out as disclosed in point 1.4 on transformants (the presence of T-DNA was verified as disclosed above) and different controls (untransformed Anabelle). The phenotype of the plants was then scored at 14 DPI and 21 DPI. The presence of viral DNA was quantified by qPCR at 28 DPI, generating a Ct value. The Ct or cycle threshold is the cycle number at which the fluorescence produced in the reaction crosses the fluorescence threshold, corresponding to a fluorescence signal that is significantly higher than the background fluorescence. At the threshold cycle (Ct), a detectable amount of amplification product is generated in the early exponential growth phase of the reaction. The threshold cycle is inversely proportional to the original relative expression level of the gene of interest, i.e. the higher the Ct value, the higher the level of resistance (i.e. the lower the proliferation of the virus in the plant). The values ​​of susceptible plants transformed by T-DNA providing the unmutated sequence of Tm2-2 can be used as a control. A Ct difference of 3.32 means that the amount of virus in the samples differs by 10 times.

[0447] The experiment was performed in duplicate (Trial 1 and Trial 2).

[0448] The results are detailed in Table 13 below.

[0449] In the table, REP indicates the number of repeats, and "Plt nb" indicates the plant number. When "present" is shown in the "T-DNA genotype" column, this means that the presence of T-DNA has been verified by PCR, as disclosed above.

[0450] The results reported in this table clearly demonstrate that the resistance observed in the transiently expressed alternative assay in N. benthamiana is indeed representative of the resistance of tomato plants comprising the resistance gene.

[0451] These results also indicate that the mutant TM-2-2 gene with at least the C848R mutation confers resistance to ToBRFV infection and that the presence of the F655L mutation can enhance this resistance.

[0452] The results of resistance assessed by visual symptoms (area under the disease progression curve AUDPC at 0, 14 and 21 DPI) and by qPCR Ct (corresponding to the presence of the virus) can be summarized in the table below according to genotype. Visual symptoms were assessed against susceptible controls, where "+" indicates fewer symptoms than the control and "-" indicates no improvement. Ct assessed by qPCR was also assessed against susceptible controls, where "+" indicates fewer viral sequences were detected and "-" indicates no improvement.

[0453]

[0454] The inventors then verified resistance to other tobacco mosaic viruses, in particular ToMV race 0, TMV, and ToMMV, in plants transformed with T-DNA containing the Tm2-2 variant with double mutations (C848R and F655L). The results are reported in Table 14, which clearly show that plants containing T-DNA (i.e., marked as "present" in the last column) are resistant to all of these tobacco mosaic viruses, except ToBRFV (same mutant code) shown in Table 13.

[0455] These results fully confirm the results presented in the previous examples, that is, mutants of the TM-2-2 gene can provide tomato plants with resistance to ToBRFV infection, while also providing resistance to ToMV, TMV and ToMMV.

[0456]

[0457]

[0458]

[0459]

[0460] Table 14 : Resistance of transformants transformed with Tm2-14-25 (double mutant) to ToMV, TMV and ToMMV. R stands for "resistant" and S stands for "susceptible".

[0461]

[0462]

[0463]

[0464]

[0465]

[0466] References:

[0467] Baggs, E., Dagdas, G., and Krasileva, KV 2017. NLR diversity, helpers and integrated domains: making sense of the NLR IDentity. Curr Opin Plant Biol 38:59-67.

[0468] Calder, VL, and Palukaitis, P. 1992. Nucleotide sequence analysis of the movement genes of resistancebreaking strains of tomato mosaic virus. J Gen Virol 73(Pt 1):165-168.

[0469] Ishibashi et al, 2007. An inhibitor of viral RNA replication is encoded by a plant resistance gene. PNAS 104(34)13833-13838.

[0470] Kapos, P., Devendrakumar, KT, and Li, X. 2019. Plant NLRs: From discovery to application. Plant Sci 279:3-18.

[0471] Kobayashi, M., Yamamoto-Katou, A., Katou, S., Hirai, K., Meshi, T., Ohashi, Y., and Mitsuhara, I. 2011. Identification of an amino acid residue required for differential recognition of a viral movement protein by the Tomato mosaic virus resistance gene Tm-2(2). J Plant Physiol 168: 1142-1145.

[0472] Lanfermeijer, F.C., Warmink, J., and Hille, J. 2005. The products of the broken Tm-2and the durable Tm-2(2)resistance genes from tomato differ in four aminoacids. J Exp Bot 56:2925-2933.

[0473] Lanfermeijer, F.C., Dijkhuis, J., Sturre, M.J., de Haan, P., and Hille, J. 2003. Cloning and characterization of the durable tomato mosaic virus resistance gene Tm-2(2) from Lycopersicon esculentum. Plant Mol Biol 52: 1037-1049.

[0474] Lanfermeirjer, F., Jiang, G., Ferwerda, M.A., Kijkhuis, J., de Haan, P., Yang, R., Hille, J. 2004. The durable resistance gene Tm-22 from tomato confers resistance against ToMV in tobacco and preserves its viral specificity. Plant Science 167: 687-692.

[0475] Luria N. et al. 2017. A New Israeli Tobamovirus Isolate Infects Tomato Plants Harboring Tm-22 Resistance Gene. PLoS ONE 12(1): e0170429. 2 ResistanceGenes.PLoS One.;12(1):e0170429).

[0476] Ma, L., Lukasik, E., Gawehns F, Takken F LW. 2012. The use of agroinfiltration for transient expression of plant resistance and fungal effector proteins in Nicotiana benthamiana leaves. Methods Mol Biol 835:61-74.

[0477] Meshi, T., Motoyoshi, F., Maeda, T., Yoshiwoka, S., Watanabe, H., and Okada, Y. 1989. Mutations in the tobacco mosaic virus 30-kD protein gene overcome Tm-2 resistance in tomato. Plant Cell 1:515-522.

[0478] Mondragon-Palomino, M., Meyers, BC, Michelmore, RW, and Gaut, BS. 2002. Patterns of positive selection in the complete NBS-LRR gene family of Arabidopsis thaliana. Genome Res 12: 1305-1315.

[0479] Nagai, A., Duarte MLL, Chaves A.LR., Peres L.EP., dos Santos D.YAC 2019. Tomato mottle mosaic virus in Brazil and its relationaship with Tm-22 gene, European Journal of Phytopathology 155, 353-359. 2 gene.Eur J Plant Pathol 155,353-359).

[0480] Salem N. et al, 2015. A new tobamovirus infecting tomato crops in Jordan. Arch. Virol. 161(2), 503-506.

[0481] Segretin, ME, Pais, M., Franceschetti, M., Chaparro-Garcia, A., Bos, JIB, Banfield, MJ, and Kamoun, S. 2014. A single amino acid mutation in the potato immune receptor R3a expands responses to Phytophthora effectors. Molecular Plant-Microbe Interactions 27:624-637 (Segretin, ME, Pais, M., Franceschetti, M., Chaparro-Garcia, A., Bos, JIB, Banfield, MJ, and Kamoun, S. 2014. Single Amino Acid Mutations in the Potato Immune Receptor R3a ExpandResponse to Phytophthora Effectors. Molecular Plant-Microbe 27:624-637).

[0482] Slootweg, E., Koropacka, K., Roosien, J., Dees, R., Overmars, H., Lankhorst, R.K., van Schaik, C., Pomp, R., Bouwman, L., Helder, J., Schots, A., Bakker, J., Smant, G., and Goverse, A., 2017. Sequence exchange between homologous NB-LRR genes converts virus resistance to nematode resistance and vice versa. Plant Physiology 175: 498-510. Goverse, A. 2017. Sequence Exchange between HomologousNB-LRR Genes Converts Virus Resistance into Nematode Resistance, and ViceVersa. Plant Physiol 175:498-510).

[0483] Sui, X. et al, 2017. Molecular and Biological Characterization of Tomato mottle mosaic virus and Development of RT-PCR Detection. Plant Disease 101, 704-711.

[0484] Tomita, R., Sekine, KT, Tateda, C., and Kobayashi, K. 2019. Identification and Functional Analysis of NB-LRR-Type Virus Resistance Genes: Overview and Functional Analysis of Candidate Genes. Methods Mol Biol 2028: 1-10.

[0485] Wang, J., Chen, T., Han, M., Qian, L., Li, J., Wu, M., Han, T., Cao, J., Nagalakshmi, U., Rathjen, JP, Hong, Y., and Liu, Y. 2020. NB-ARC domain-mediated CC domain self-association is required for activation of the plant NLR immune receptor Tm-22. PLoS Pathogens 16:e1008475 (Wang, J., Chen, T., Han, M., Qian, L., Li, J., Wu, M., Han, T., Cao, J., Nagalakshmi, U., Rathjen, JP, Hong, Y., and Liu, Y. 2020. Plant NLR immune receptor Tm-22 activation requires NB-ARCdomain-mediated self-association of CC domain. PLoS Pathog 16:e1008475).

[0486] Weber, H., and Pfitzner, AJ 1998. Tm-2(2) resistance in tomato requires recognition of the carboxyterminus of the movement protein of tomato mosaic virus. Mol Plant Microbe Interact 11:498-503.

[0487] Weber, H., Schultze, S., and Pfitzner, AJ 1993. Two amino acid substitutions in the tomato mosaic virus 30-kilodalton movement protein confer the ability to overcome the Tm-2(2) resistance gene in the tomato. J Virol 67:6432-6438.

[0488] Weber, H., Ohnesorge, S., Silber, MV, and Pfitzner, AJ. 2004. The Tomatomosaic virus 30 kDa movement protein interacts differentially with the resistance genes Tm-2 and Tm-2(2). Arch Virol 149: 1499-1514. SEQUENCE LISTING <110> Wilmoline <120> Tomato plants resistant to ToBRFV, TMV, ToMV and ToMMV and their corresponding resistance genes <130> B14361WO-CS <150> EP20306496.9 <151> 2020-12-03 <150> EP21306078.3 <151> 2021-08-02 <160> 46 <170> PatentIn version 3.5 <210> 1 <211> 2820 <212> DNA <213> Tomato (Lycopersicon esculentum) <400> 1 atagaaaaaa gaaatttctc ctttttcatt aatgtgcagc tgccccacgt tgtcactccc 60 cttcttcttt ataatttcct tcttgacaat tattaggaga cttggccgag gactccatct 120 accactaaaa agctaaagcc atcagtatac tcattttttg gtagctactg aaaaagagag 180 aaaaaaaaat ggctgaaatt cttcttacat cagtaatcaa taaatctgta gaaatagctg 240 gaaatttact gattcaagaa ggaaagcgtt tatattggtt gaaagaggat atcgattggc 300 tccagagaga aatgagacac attcgatctt atgttgacaa cgcaaaggcc aaggaagctg 360 gaggtgattc aagggtcaaa aacttattga aagatattca agaattggca ggtgatgtgg 420 aggatctctt agatgacttc cttccaaaaa ttcaacgatc caataagttc aattattgcc 480 ttaagacgag ttcttttgcg gatgagtttg ctatggagat tgagaagata aagagaaggg 540 ttgttgacat tgaccgaata aggaaaactt acaacatcat agatacagat aacaataatg 600 atgattgtgt tttgctggat cggagaagat tattcctaca tgctgatgaa agagagatca 660 tcggtttgga tgatgacttc aatatgctac aagccaaatt actcaatcaa gatttgcatt 720 atggagttgt ttccatagtt ggcatgcccg gtctgggggaa aacaactctt gccaagaaac 780 tttataggct cattcgtgat caatttgagt gttctggact ggtctacgtt tcacaacagc 840 caagagcggg tgaaatctta cttgacattg ccaaacaaat tggactgacg gaacagaaaa 900 ttaaggaaaa tttgggaggac aacctgcgat cactcttgaa aataaaaagg tatgttatcc 960 tcctagatga catttgggat gttgaaattt gggatgatct gaaacttgtc cttcctgaat 1020 gtgactcaaa agtcggcagt agaatgataa tcacgtctcg aaatgaat gtaggcagat 1080 acataggagg ggaatcctcc ctccatgcat tgcaacccct agaatccgag aaaagctttg 1140 aactctttac caagaaaatc tttaattttg atgataataa tagttgggcc aatgcttcac 1200 ctgacttggt gaatattggt agaaatatag ctgggagatg tggaggtata ccgctagcca 1260 tagtggtgac tgcaggcatg ttaagggcaa gagaagaac agaacatgcg tggaacagag 1320 tacttgagag tatgggccat aaagttcaag atggatgtgc taaggtattg gctctcagtt 1380 acaatgattt accgattgcc tcaaggccat gtttcttgta ctttagcctt taccccgagg 1440 accatgaaat tcgtgctttt gatttgataa atatgtggat tgctgagaag tttattgtag 1500 1560 tttctagaaa cttgattcaa cttgccaaaa ggacatataa tggagaatt tcaagttgtc 1620 gcatacatga cttgttacat agtttgtgtg tggacttggc taggaaagt aacttctttc 1680 acaccgcgca tgatgtattt ggtgatcccg gcaatgtcgc taggcttcga aggattacat 1740 tctactctga caatgtcatg attgagttct tcggttctaa tcctaagctt gagaagcttc 1800 gtgtactttt ctgtttcaca aaagaccctt catatattttc tcatatggct tgttttgact 1860 tcaaattgtt gcacacattg gttgtagtca tgtctcaaag ttttcaagca tatgtcacta 1920 tcccaagcaa atttgggaac atgacttgct tacgctatct gaaattggag gggaatattt 1980 gtggaaaact gccaaatagt attgtcaagc tcacacgtct agagaccata gacattgatc 2040 gacgtagcct cattcaactt ccttctggtg tttgggagtc taaacatttg agacatcttt 2100 gttatagaga ttatggacaa gcatgtaaca gttgcttttc tataagctca ttttacccaa 2160 acatttactc attgcatcct aacaatctac aaaccttgat gtggatacct gataaatttt 2220 ttgaaccgag gttgttgcac cgattgatca atttaagaaa actgggtata ctgggagtgt 2280 ccaattcaac cgttaagata ttatcaacat gtcgccctgt gccaaaggcg ctaaaggttc 2340 tgaagctcag gtttttcagt gatccgagtg agcaaataaa cttgtcatcc tatccaaaaa 2400 ttgttaagtt gcatttgaat gttgacagaa caatagcctt gaactctgaa gcattccctc 2460 caaatattat caagcttact cttgtctgct ttatggtaga cagttgtcta ctggcagtgc 2520 ttaagacatt acccaaatta agaaaactta aaatggtcat ctgcaagtat aatgaagaaa 2580 agatggctct ctcgggcgag gcaaatggtt atagctttcc gcaacttgaa gttttgcata 2640 ttcatagccc gaatgggttg tctgaagtaa catgcacgga tgatgtcagt atgcccaaat 2700 tgaaaaagct gttacttaca ggattccatt gcggaatcag tttatcggaa cggcttaaaa 2760 agctgagtaa atgaacatct caacaggtca gtttgctagt ataactattt acgtacaggg 2820 <210> 2 <211> 2819 <212> DNA <213> 番茄(Lycopersicon esculentum) <400> 2 atagaaaaaa gaaatttctc ctttttcatt aatgtgcagc tgccccacgt tgtcactccc 60 cttcttcttt atcatttcct tcttgacatt attaggagac ttggccgtgg actccatcta 120 ccactaaaaa gctaaagcca tcagtatact cattttttgg tagctactga aaaagagaga 180 aaaaaaaatg gctgaaattc ttcttacatc agtaatcaat aaatctgtag aaatagctgg 240 aaatttactg attcaagaag gaaagcgttt atattggttg aaagaggata tcgattggct 300 ccagagagaa atgagacaca ttcgatctta tgttgacaac gcaaaggcca aggaagctgg 360 aggtgattca agggtcaaa acttattgaa agatattca gattggcag gtgatgtgga 420 ggatctctta gatgacttcc ttccaaaat tcacaatcc ataagttca attattgcct 480 tagaggagt tctttgcgg tagagttttgc tatggatt gagagata agagaagggt 540 tgttgacatt gaccgaataa ggaaactta cacacata gacagata acaataatga 600 tgattgtgtt ctgctggatc ggagagatt attcctacat gctgatgaaa cagagatcat 660 cggtttggat gatgacttca attgctaca agccaaatta cttaatcaag atttgcatta 720 tggagttgtt tccatagttg gcatgcccgg tctggggaa acaaccttg ccaagaaact 780 ttataggctc attcgtgatc aatttgagtg tctggactg gtctacgttt cacacagcc 840 aagagcgagt gaatcttac ttgacattgc CAacaatt ggactgacgg aacagaaaat 900 gaaggaaaat tggaggaca actgcgatc actcttgaaa aaaaaggt atgttttcct 960 cctagatgac atttgggatg tggaatttg ggatgatctg aaacttgtcc ttcctgaatg 1020 tgattcaaa gtcggcagta gattataat cacgtctcga atagtaatg taggcagata 1080 cataggaggg gaatcctccc tccatgcatt gcaaccccta gaatccgaga aaagctttga 1140 actctttacc aagaaaatct ttaatttga tgataataat agttgggcca atgcttcacc 1200 tgacttggtg aatattggta gaaatatagt tgggagatgt ggaggtatac cgctagccat 1260 agtggtgact gcaggcatgt taagggcaag agaaagaaca gaacatgcgt ggaacagagt 1320 acttgagagt atgggccata aagttcaaga tggatgtgct aaggtattgg ctctcagtta 1380 caatgatta cctattgcct caaggccatg tttcttgtac tttggccttt accccgagga 1440 ccatgaaatt cgtgctttg atttgataaa tatgtggatt gctgagaagt ttatagtagt 1500 aaatagtggt aataggcgag aggctgagga tttggcggag gacgtcctaa atgatttggt 1560 ttctagaaac ttgattcaac ttgccaaaag gacatataat ggaagaattt caagttgtcg 1620 catacatgac ttgttacata gtttgtgtgt ggacttggct aaggaaagta acttctttca 1680 caccgcgcat gatgcatttg gtgatcccgg caatgttgct aggctccgaa ggattacatt 1740 ctactctgac aatgtcatga ttgagttctt ccgttcaaat cctaagcttg agaagcttcg 1800 tgtacttttc tgtttcgcaa aagacccttc catattttct catatggctt attttgactt 1860 caaattgttg cacacattgg ttgtagtcat gtctcaaagt tttcaagcat atgtcactat 1920 cccaagcaaa tttgggaaca tgacttgctt acgctatctg agattggagg ggaatatttg 1980 tggaaaactg ccaaatagta ttgtcaagct cacacgtcta gagaccatag acattgatcg 2040 acgtagcctc attcaacctc cttctggtgt ttgggagtct aaacatttga gacatctttg 2100 tttatagagat tatggacaag catgtaacag ttgcttttct ataagctcat tttacccaaa 2160 tatttactca ttgcatccta acaatctaca aaccttgatg tggatacctg ataaattttt 2220 tgaaccgagg ttgttgcacc gattgatcaa tttaagaaaa ctgggtatac tgggagtgtc 2280 caattctacc gttaagatgt tatcaatatt tagccctgtg ctcaaggcgc tggaggttct 2340 gaagctcagt ttttccagtg acccgagtga acaaataaag ttgtcatcgt atccacatat 2400 tgctaagttg catttgaatg ttaacagaac aatggccttg aactctcaat catttcctcc 2460 aaatctcatc aagcttactc tagccaactt tacggtagac cgttatatac tggcagtact 2520 taagacattt cccaaattaa gaaaacttaa aatgttcatc tgcaagtata atgaagaaaa 2580 gatggatctc tcgggcgagg caaatggtta tagctttccg caacttgaag ttttgcatat 2640 tcatagcccg aatgggttgt ctgaagtaac gtgcacggat gatgtcagta tgcccaaatt 2700 gaaaaagctg ttacttacag gattccattg ccgaatcagt ttatcggaac ggcttaaaaa 2760 gctgagtaaa tgaacatctc aacaggtcag tttgctagta taactattta cgtacaggg 2819 <210> 3 <211> 2586 <212> DNA <213>番茄(Lycopersicon esculentum) <400> 3 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttctttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg agggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctgggaggt tctgaagctc 2160 agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc 2460 ccgaatgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 aaatga 2586 <210> 4 <211> 2586 <212> DNA <213> Artificial <220> <223> Mutant <400> 4 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgagac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttcttttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagaaacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattataccc aaatatttac 2040. tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataatt ttttgaaccg aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcattcc tccaaatctc atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca tttcccaaat tagaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc ccgaatgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag ctgttactta caggattcca tcgccgaatc agtttatcgg aacggcttaa aaagctgagt aaatga 2586 <210> 5 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 5 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttctttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaattgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagaaacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc 2160 agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc 2460 ccgaatgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca tcgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 6 <211> 861 <212> PRT <213>番茄(Lycopersicon esculentum) <400> 6 Put Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Arg Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Thr Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gin Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gin Gin Pro Arg Ala Gly Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gin Ile Gly Leu Thr Glu Gin Lys Ile Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gin Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Ala Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Ser Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Val Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515,520,525 Gly Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Thr 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Cys Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565,570,575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Lys 580,585,590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595,600,605 Thr Arg Leu Glu Thr Ile Asp Three Asp Arg Arg Leu Leu I Gln Leu 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Phe Tyr 645,650,655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Ile 690 695 700 Leu Ser Thr Cys Arg Pro Val Pro Lys Ala Leu Lys Val Leu Lys Leu 705 710 715 720 Arg Phe Phe Ser Asp Pro Ser Glu Gln Ile Asn Leu Ser Ser Tyr Pro 725 730 735 Lys Ile Val Lys Leu His Leu Asn Val Asp Arg Thr Ile Ala Leu Asn 740 745 750 Ser Glu Ala Phe Pro Pro Asn Ile Ile Lys Leu Thr Leu Val Cys Phe 755 760 765 Met Val Asp Ser Cys Leu Leu Ala Val Leu Lys Thr Leu Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Val Ile Cys Lys Tyr Asn Glu Glu Lys Met Ala 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Gly Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 7 <211> 861 <212> PRT <213> 番茄(Lycopersicon esculentum) <400> 7 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Phe Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Ile Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Asn Phe 755 760 765 Thr Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 8 <211> 861 <212> PRT <213> 番茄(Lycopersicon esculentum) <400> 8 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Only Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485,490,495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515,520,525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565,570,575 Thr Ile Pro Server Lys PhE Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580,585,590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595,600,605 Three Arg With Glu Thr With Asp Three Asp Arg Arg Ser With Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr He Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe He Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gin Leu Glu Val Leu 805 810 815 His He His Ser Pro Asn Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg He Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 9 <211> 861 <212> PRT <213> Artificial <220> <223> Mutant <400> 9 Met Ala Glu He Leu Leu Thr Ser Val He Asn Lys Ser Val Glu He 1 5 10 15 Ala Gly Asn Leu Leu He Gin Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Leu Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Arg 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 10 <211> 861 <212> PRT <213> artificial sequence <220> <223> mutant <400> 10 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys lie Gin Gin Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu lie Glu 100 105 110 Lys lie Lys Arg Arg Val Val Asp lie Asp Arg lie Arg Lys Thr Tyr 115 120 125 Asn lie lie Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu lie lie Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gin Ala Lys Leu Leu Asn Gin Asp Leu 165 170 175 His Tyr Gly Val Val Ser lie Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu lie Arg Asp Gin Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gin Gin Pro Arg Ala Ser Glu lie Leu 210 215 220 Leu Asp lie Ala Lys Gin lie Gly Leu Thr Glu Gin Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Arg 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 11 <211> 385 <212> PRT <213>番茄 (Lycopersicon esculentum) <400> 11 Cys Arg Ile His Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys 1 5 10 15 Glu Ser Asn Phe Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly 20 25 30 Asn Val Ala Arg Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met 35 40 45 Ile Glu Phe Phe Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu 50 55 60 Phe Cys Phe Ala Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe 65 70 75 80 Asp Phe Lys Leu Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe 85 90 95 Gln Ala Tyr Val Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu 100 105 110 Arg Tyr Leu Arg Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser 115 120 125 Val Lys with Thr Arg and Glu with Asp and Asp with Arg Ser 130 135 140 Leu Ile Gln Pro Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His 145 150 155 160 Leu Cys Tyr Arg Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile 165 170 175 Ser Ser Phe Tyr Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln 180 185 190 Thr Leu Met Trp Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His 195 200 205 Arg Leu Ile Asn Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser 210 215 220 Thr Val Lys Met Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu 225 230 235 240 Val Leu Lys Leu Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu 245 250 255 Ser Ser Tyr Pro His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr 260 265 270 Met Ala Leu Asn Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr 275 280 285 Leu Ala Tyr Phe Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr 290,295,300 Phe Pro Lys Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu 305 310 315 320 Glu Lys Met Asp Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln 325 330 335 Leu Glu Val Leu His Ile His Ser Pro Asn Gly Leu Ser Glu Val Thr 340 345 350 How Thr Asp Asp Will Met Pro Lys Leu Lys Leu Leu Leu Thr 355 360 365 Gly Phe His Arg Arg Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser 370 375 380 Lys 385 <210> 12 <211> 1158 <212> DNA <213>番茄 (Lycopersicon esculentum) <400> 12 tgtcgcatac atgacttgtt acatagtttg tgtgtggact tggctagga aagtaacttc 60 tttcacaccg cgcatgatgc atttgatt cccggcaatg ttgctaggct ccgaggatt 120 acatctact ctgacaatgt catgattgag ttctccgtt caatcctaa gcttgagaag 180 cttcgtgtac ttttctgttt cgcaaaagac ccttccatat tttctcatat ggcttatttt 240 gacttcaaat tgttgcacac attggttgta gtcatgtctc aaagttttca agcatatgtc 300 actatcccaa gcaaatttgg gaacatgact tgcttacgct atctgagatt ggaggggaat 360 atttgtggaa aactgccaaa tagtattgtc aagctcacac gtctagagac catagacatt 420 gatcgacgta gcctcattca acctccttct ggtgtttggg agtctaaaca tttgagacat 480 ctttgttata gagattatgg acaagcatgt aacagttgct tttctataag ctcattttac 540 ccaaatattt actcattgca tcctaacaat ctacaaacct tgatgtggat acctgataaa 600 ttttttgaac cgaggttgtt gcaccgattg atcaatttaa gaaaactggg tatactggga 660 gtgtccaatt ctaccgttaa gatgttatca atatttagcc ctgtgcttaa ggcgctggag 720 gttctgaagc tcagtttttc cagtgacccg agtgaacaaa taaagttgtc atcgtatcca 780 catattgcta agttgcattt gaatgttaac agaacaatgg ccttgaactc tcaatcattt 840 cctccaaatc tcatcaagct tactctagcc tactttagtg tagaccgtta tatactggca 900 gtacttaaga catttcccaa attaagaaaa cttaaaatgt tcatctgcaa gtataatgaa 960 gaaaagatgg atctctcggg cgaggcaaat ggttatagct ttccgcaact tgaagttttg 1020 catattcata gcccgaatgg gttgtctgaa gtaacgtgca cggatgatgt cagtatgcc 1080 aaattgaaaa agctgttact tacaggattc cattgccgaa tcagtttatc ggaacggctt 1140 aaaaagctga gtaaatga 1158 <210> 13 <211> 268 <212> PRT <213>烟草花叶病毒(Tobacco mosaic virus) <400> 13 Met Ala Leu Val Val Lys Gly Lys Val Asn Ile Asn Glu Phe Ile Asp 1 5 10 15 Leu Thr Lys Met Glu Lys Ile Leu Pro Ser Met Phe Thr Pro Val Lys 20 25 30 Ser Val Met Cys Ser Lys Val Asp Lys Ile Met Val His Glu Asn Glu 35 40 45 Ser Leu Ser Gly Val Asn Leu Leu Lys Gly Val Lys Leu Ile Asp Ser 50 55 60 Gly Tyr Val Cys Leu Ala Gly Leu Val Val Thr Gly Glu Trp Asn Leu 65 70 75 80 Pro Asp Asn Cys Arg Gly Gly Val Ser Val Cys Leu Val Asp Lys Arg 85 90 95 Met Glu Arg Ala Asp Glu Ala Thr Leu Gly Ser Tyr Tyr Thr Ala Ala 100 105 110 Ala Lys Lys Arg Phe Gln Phe Lys Val Val Pro Asn Tyr Ala Ile Thr 115 120 125 Thr Gln Asp Ala Met Lys Asn Val Trp Gln Val Leu Val Asn Ile Arg 130 135 140 Asn Val Lys Met Ser Ala Gly Phe Cys Pro Leu Ser Leu Glu Phe Val 145 150 155 160 Ser Val Cys Ile Val Tyr Arg Asn Asn Ile Lys Leu Gly Leu Arg Glu 165 170 175 Lys Ile Thr Asn Val Arg Asp Gly Gly Pro Met Glu Leu Thr Glu Glu 180 185 190 Val Val Asp Glu Phe Met Glu Asp Val Pro Met Ser Ile Arg Leu Ala 195 200 205 Lys Phe Arg Ser Arg Thr Gly Lys Lys Ser Asp Val Arg Lys Gly Lys 210 215 220 Asn Ser Ser Ser Asp Arg Ser Val Pro Asn Lys Asn Tyr Arg Asn Val 225 230 235 240 Lys Asp Phe Gly Gly Met Ser Phe Lys Lys Asn Asn Leu Ile Asp Asp 245 250 255 Asp Ser Glu Ala Thr Val Ala Glu Ser Asp Ser Phe 260 265 <210> 14 <211> 264 <212> PRT <213> 番茄花叶病毒(Tomato mosaic virus) <400> 14 Met Ala Leu Val Val Lys Gly Lys Val Asn Ile Asn Glu Phe Ile Asp 1 5 10 15 Leu Ser Lys Ser Glu Lys Leu Leu Pro Ser Met Phe Thr Pro Val Lys 20 25 30 Ser Val Met Val Ser Lys Val Asp Lys Ile Met Val His Glu Asn Glu 35 40 45 Ser Leu Ser Glu Val Asn Leu Leu Lys Gly Val Lys Leu Ile Glu Gly 50 55 60 Gly Tyr Val Cys Leu Val Gly Leu Val Val Ser Gly Glu Trp Asn Leu 65 70 75 80 Pro Asp Asn Cys Arg Gly Gly Val Ser Val Cys Met Val Asp Lys Arg 85 90 95 Met Glu Arg Ala Asp Glu Ala Thr Leu Gly Ser Tyr Tyr Thr Ala Ala 100 105 110 Ala Lys Lys Arg Phe Gln Phe Lys Val Val Pro Asn Tyr Gly Ile Thr 115 120 125 Thr Lys Asp Ala Glu Lys Asn Ile Trp Gln Val Leu Val Asn Ile Lys 130 135 140 Asn Val Lys Met Ser Ala Gly Tyr Cys Pro Leu Ser Leu Glu Phe Val 145 150 155 160 Ser Val Cys Ile Val Tyr Lys Asn Asn Ile Lys Leu Gly Leu Arg Glu 165 170 175 Lys Val Thr Ser Val Asn Asp Gly Gly Pro Met Glu Leu Ser Glu Glu 180 185 190 Val Val Asp Glu Phe Met Glu Asn Val Pro Met Ser Val Arg Leu Ala 195 200 205 Lys Phe Arg Thr Lys Ser Ser Lys Arg Gly Pro Lys Asn Asn Asn Asn 210 215 220 Leu Gly Lys Gly Arg Ser Gly Gly Arg Ser Lys Pro Lys Ser Phe Asp 225 230 235 240 Glu Val Glu Lys Glu Phe Asp Asn Leu Ile Glu Asp Glu Ala Glu Thr 245 250 255 Ser Val Ala Asp Ser Asp Ser Tyr 260 <210> 15 <211> 266 <212> PRT <213> 番茄褐色皱纹果病毒(Tomato brown rugose fruit virus) <400> 15 Met Ala Leu Val Lys Gly Lys Val Asn Ile Asn Glu Phe Ile Asp Leu 1 5 10 15 Ser Lys Ser Glu Lys Phe Leu Pro Ser Met Phe Thr Pro Val Lys Ser 20 25 30 Val Met Ile Ser Lys Val Asp Lys Ile Leu Val His Glu Asp Glu Ser 35 40 45 Leu Ser Glu Val Asn Leu Leu Lys Gly Val Lys Leu Ile Asp Gly Gly 50 55 60 Tyr Val His Leu Ala Gly Leu Val Val Thr Gly Glu Trp Asn Leu Pro 65 70 75 80 Asp Asn Cys Arg Gly Gly Val Ser Val Cys Leu Val Asp Lys Arg Met 85 90 95 Glu Arg Ala Asp Glu Ala Thr Leu Ala Ser Tyr Tyr Thr Ala Ala Ala 100 105 110 Lys Lys Arg Phe Gln Phe Lys Val Val Pro Asn Tyr Asn Ile Thr Thr 115 120 125 Lys Asp Ala Glu Lys Ala Val Trp Gln Val Leu Val Asn Ile Arg Asn 130 135 140 Val Lys Ile Ala Ala Gly Tyr Cys Pro Leu Ser Leu Glu Phe Val Ser 145 150 155 160 Val Cys Ile Val Tyr Lys Asn Ile Ile Lys Leu Gly Leu Arg Glu Lys 165 170 175 Ile Thr Ser Val Thr Asp Gly Gly Pro Met Glu Leu Ser Glu Glu Val 180 185 190 Val Asp Glu Phe Met Glu Glu Val Pro Met Ser Val Arg Leu Ala Lys 195 200 205 Phe Arg Ser Lys Thr Gly Lys Lys Phe Ser Ser Lys Ser Glu Asn Asn 210 215 220 Ser Gly Asn Asn Arg Pro Lys Pro Asn Lys Asn Gln Arg Lys Glu Lys 225 230 235 240 Gly Leu Lys Val Arg Val Glu Lys Asp Asn Leu Ile Asp Asn Glu Leu 245 250 255 Glu Thr Tyr Val Ala Asp Ser Asp Ser Tyr 260 265 <210> 16 <211> 268 <212> PRT <213> 番茄斑驳花叶病毒(Tomato mottle virus) <400> 16 Met Ala Leu Thr Val Ser Gly Lys Val Arg Ile Ser Glu Phe Ile Asp 1 5 10 15 Leu Ser Lys Ser Glu Arg Leu Leu Pro Ser Met Phe Thr His Val Lys 20 25 30 Ser Val Ser Val Ser Lys Val Asp Lys Val Met Val Asn Glu Glu Asp 35 40 45 Ser Leu Ser Glu Val Asn Leu Leu Lys Gly Val Lys Leu Ile Asp Gly 50 55 60 Gly Tyr Val Cys Leu Ala Gly Leu Val Val Ser Gly Glu Trp Asn Leu 65 70 75 80 Pro Asp Asn Cys Arg Gly Gly Val Ser Ile Cys Leu Val Asp Lys Arg 85 90 95 Met Gln Arg Ala Asp Glu Ala Thr Leu Gly Ser Tyr Tyr Thr Gly Ala 100 105 110 Ala Lys Lys Arg Phe Gln Phe Lys Ile Val Pro Asn Tyr Ala Ile Thr 115 120 125 Thr Lys Asp Ala Glu Lys Asn Ile Trp Gln Val Leu Val Asn Ile Arg 130 135 140 Asn Val Lys Met Ala Gly Gly Phe Cys Pro Leu Ser Leu Glu Phe Val 145 150 155 160 Ser Val Cys Ile Val Tyr Lys Asn Asn Ile Lys Leu Gly Leu Arg Glu 165 170 175 Lys Ile Thr Arg Val Asp Asp Ala Gly Pro Ile Glu Leu Thr Glu Glu 180 185 190 Val Val Asp Glu Phe Met Glu Ser Val Pro Met Ser Val Arg Leu Ala 195 200 205 Lys Phe Arg Thr Lys Ser Ser Lys Arg Gly Pro Lys His Asn Ser Asn 210 215 220 Asn Thr Asn Asp Arg Lys Gly Arg Ser Asn Phe Arg Lys Lys Gln Asp 225 230 235 240 Gln Glu Ser Tyr Gly Val Ser Asp Ser Leu Asp Asn Leu Ile Glu Asp 245 250 255 Asp Thr Glu Thr Ser Val Ala Gly Ser Asp Ser Tyr 260 265 <210> 17 <211> 861 <212> PRT <213> 人工序列(artificial) <220> <223> 突变体(mutant) <400> 17 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515,520,525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565,570,575 Thr Ile Pro Server Lys PhE Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580,585,590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595,600,605 Three Arg With Glu Thr With Asp Three Asp Arg Arg Ser With Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Phe Tyr 645,650,655 Pro Asn Ile Tyr Ser Let His Pro Asn Asn Let Gln Thr Let Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Phe Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Arg 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 18 <211> 861 <212> PRT <213> artificial sequence <220> <223> mutant <400> 18 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys lie Gin Gin Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu lie Glu 100 105 110 Lys lie Lys Arg Arg Val Val Asp lie Asp Arg lie Arg Lys Thr Tyr 115 120 125 Asn lie lie Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu lie lie Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gin Ala Lys Leu Leu Asn Gin Asp Leu 165 170 175 His Tyr Gly Val Val Ser lie Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu lie Arg Asp Gin Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gin Gin Pro Arg Ala Ser Glu lie Leu 210 215 220 Leu Asp lie Ala Lys Gin lie Gly Leu Thr Glu Gin Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Trp Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Arg 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 19 <211> 861 <212> PRT <213> 人工序列(artificial) <220> <223> 突变体(mutant) <400> 19 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu His Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 20 <211> 861 <212> PRT <213>番茄(Lycopersicon esculentum) <400> 20 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly lie Pro Leu Ala lie Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro lie Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu lie Arg Ala Phe Asp Leu lie Asn Met Trp lie Ala 420 425 430 Glu Lys Phe lie Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu lie Gin 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg lie Ser Ser Cys Arg lie His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515,520,525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565,570,575 Thr Ile Pro Server Lys PhE Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580,585,590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595,600,605 Three Arg With Glu Thr With Asp Three Asp Arg Arg Ser With Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Phe Tyr 645,650,655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu Lys Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 21 <211> 861 <212> PRT <213> 人工序列(artificial) <220> <223> 突变体(mutant) <400> 21 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Asn Gly Leu Thr Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 22 <211> 861 <212> PRT <213> 人工序列(artificial) <220> <223> 突变体(mutant) <400> 22 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gin Ser Phe Pro Pro Asn Leu lie Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr lie Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe lie Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gin Leu Glu Val Leu 805 810 815 His lie His Ser Pro Cys Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg lie Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 23 <211> 861 <212> PRT <213> Artificial <220> <223> Mutant <400> 23 Met Ala Glu lie Leu Leu Thr Ser Val lie Asn Lys Ser Val Glu lie 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485,490,495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515,520,525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565,570,575 Thr Ile Pro Server Lys PhE Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580,585,590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595,600,605 Three Arg With Glu Thr With Asp Three Asp Arg Arg Ser With Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gin Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Phe Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 24 <211> 861 <212> PRT <213> Artificial <220> <223> Mutant <400> 24 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gin Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gin Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Met Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 25 <211> 861 <212> PRT <213> 人工序列(artificial) <220> <223> 突变体(mutant) <400> 25 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485 490 495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515 520 525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565 570 575 Thr Ile Pro Ser Lys Phe Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580 585 590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595 600 605 Thr Arg Leu Glu Thr Ile Asp Ile Asp Arg Arg Ser Leu Ile Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys His Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Tyr Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 26 <211> 861 <212> PRT <213> artificial sequence <220> <223> mutant <400> 26 Met Ala Glu Ile Leu Leu Thr Ser Val Ile Asn Lys Ser Val Glu Ile 1 5 10 15 Ala Gly Asn Leu Leu Ile Gln Glu Gly Lys Arg Leu Tyr Trp Leu Lys 20 25 30 Glu Asp Ile Asp Trp Leu Gln Arg Glu Met Arg His Ile Arg Ser Tyr 35 40 45 Val Asp Asn Ala Lys Ala Lys Glu Ala Gly Gly Asp Ser Arg Val Lys 50 55 60 Asn Leu Leu Lys Asp Ile Gln Glu Leu Ala Gly Asp Val Glu Asp Leu 65 70 75 80 Leu Asp Asp Phe Leu Pro Lys Ile Gln Gln Ser Asn Lys Phe Asn Tyr 85 90 95 Cys Leu Lys Arg Ser Ser Phe Ala Asp Glu Phe Ala Met Glu Ile Glu 100 105 110 Lys Ile Lys Arg Arg Val Val Asp Ile Asp Arg Ile Arg Lys Thr Tyr 115 120 125 Asn Ile Ile Asp Thr Asp Asn Asn Asn Asp Asp Cys Val Leu Leu Asp 130 135 140 Arg Arg Arg Leu Phe Leu His Ala Asp Glu Thr Glu Ile Ile Gly Leu 145 150 155 160 Asp Asp Asp Phe Asn Met Leu Gln Ala Lys Leu Leu Asn Gln Asp Leu 165 170 175 His Tyr Gly Val Val Ser Ile Val Gly Met Pro Gly Leu Gly Lys Thr 180 185 190 Thr Leu Ala Lys Lys Leu Tyr Arg Leu Ile Arg Asp Gln Phe Glu Cys 195 200 205 Ser Gly Leu Val Tyr Val Ser Gln Gln Pro Arg Ala Ser Glu Ile Leu 210 215 220 Leu Asp Ile Ala Lys Gln Ile Gly Leu Thr Glu Gln Lys Met Lys Glu 225 230 235 240 Asn Leu Glu Asp Asn Leu Arg Ser Leu Leu Lys Ile Lys Arg Tyr Val 245 250 255 Ile Leu Leu Asp Asp Ile Trp Asp Val Glu Ile Trp Asp Asp Leu Lys 260 265 270 Leu Val Leu Pro Glu Cys Asp Ser Lys Val Gly Ser Arg Met Ile Ile 275 280 285 Thr Ser Arg Asn Ser Asn Val Gly Arg Tyr Ile Gly Gly Glu Ser Ser 290 295 300 Leu His Ala Leu Gln Pro Leu Glu Ser Glu Lys Ser Phe Glu Leu Phe 305 310 315 320 Thr Lys Lys Ile Phe Asn Phe Asp Asp Asn Asn Ser Trp Ala Asn Ala 325 330 335 Ser Pro Asp Leu Val Asn Ile Gly Arg Asn Ile Val Gly Arg Cys Gly 340 345 350 Gly Ile Pro Leu Ala Ile Val Val Thr Ala Gly Met Leu Arg Ala Arg 355 360 365 Glu Arg Thr Glu His Ala Trp Asn Arg Val Leu Glu Ser Met Gly His 370 375 380 Lys Val Gln Asp Gly Cys Ala Lys Val Leu Ala Leu Ser Tyr Asn Asp 385 390 395 400 Leu Pro Ile Ala Ser Arg Pro Cys Phe Leu Tyr Phe Gly Leu Tyr Pro 405 410 415 Glu Asp His Glu Ile Arg Ala Phe Asp Leu Ile Asn Met Trp Ile Ala 420 425 430 Glu Lys Phe Ile Val Val Asn Ser Gly Asn Arg Arg Glu Ala Glu Asp 435 440 445 Leu Ala Glu Asp Val Leu Asn Asp Leu Val Ser Arg Asn Leu Ile Gln 450 455 460 Leu Ala Lys Arg Thr Tyr Asn Gly Arg Ile Ser Ser Cys Arg Ile His 465 470 475 480 Asp Leu Leu His Ser Leu Cys Val Asp Leu Ala Lys Glu Ser Asn Phe 485,490,495 Phe His Thr Ala His Asp Ala Phe Gly Asp Pro Gly Asn Val Ala Arg 500 505 510 Leu Arg Arg Ile Thr Phe Tyr Ser Asp Asn Val Met Ile Glu Phe Phe 515,520,525 Arg Ser Asn Pro Lys Leu Glu Lys Leu Arg Val Leu Phe Cys Phe Ala 530 535 540 Lys Asp Pro Ser Ile Phe Ser His Met Ala Tyr Phe Asp Phe Lys Leu 545 550 555 560 Leu His Thr Leu Val Val Val Met Ser Gln Ser Phe Gln Ala Tyr Val 565,570,575 Thr Ile Pro Server Lys PhE Gly Asn Met Thr Cys Leu Arg Tyr Leu Arg 580,585,590 Leu Glu Gly Asn Ile Cys Gly Lys Leu Pro Asn Ser Ile Val Lys Leu 595,600,605 Three Arg With Glu Thr With Asp Three Asp Arg Arg Ser With Gln Pro 610 615 620 Pro Ser Gly Val Trp Glu Ser Lys Leu Arg His Leu Cys Tyr Arg 625 630 635 640 Asp Tyr Gly Gln Ala Cys Asn Ser Cys Phe Ser Ile Ser Phe Tyr 645 650 655 Pro Asn Ile Tyr Ser Leu His Pro Asn Asn Leu Gln Thr Leu Met Trp 660 665 670 Ile Pro Asp Lys Phe Phe Glu Pro Arg Leu Leu His Arg Leu Ile Asn 675 680 685 Leu Arg Lys Leu Gly Ile Leu Gly Val Ser Asn Ser Thr Val Lys Met 690 695 700 Leu Ser Ile Phe Ser Pro Val Leu Lys Ala Leu Glu Val Leu Lys Leu 705 710 715 720 Ser Phe Ser Ser Asp Pro Ser Glu Gln Ile Lys Leu Ser Ser Tyr Pro 725 730 735 His Ile Ala Lys Leu His Leu Asn Val Asn Arg Thr Met Ala Leu Asn 740 745 750 Ser Gln Ser Phe Pro Pro Asn Leu Ile Lys Leu Thr Leu Ala Tyr Phe 755 760 765 Ser Val Asp Arg Tyr Ile Leu Ala Val Leu Lys Thr Phe Pro Lys Leu 770 775 780 Arg Lys Leu Lys Met Phe Ile Cys Lys Tyr Asn Glu Glu Lys Met Asp 785 790 795 800 Leu Ser Gly Glu Ala Asn Gly Tyr Ser Phe Pro Gln Leu Glu Val Leu 805 810 815 His Ile His Ser Pro Trp Gly Leu Ser Glu Val Thr Cys Thr Asp Asp 820 825 830 Val Ser Met Pro Lys Leu Lys Lys Leu Leu Leu Thr Gly Phe His Cys 835 840 845 Arg Ile Ser Leu Ser Glu Arg Leu Lys Lys Leu Ser Lys 850 855 860 <210> 27 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 27 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttctttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg agggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctgggaggt tctgaagctc 2160 agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagcctt ttttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc 2460 ccgaatgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca tcgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 28 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 28 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgagac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttctttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ttcctcctct ctctcctctc ctctcctctc ctggtgtttg ggagtctaaa catttgagac atcttttgtt ataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc 2160 agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagcctg gtttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaactlg aagttttgca tattcatagc 2460 ccgaatgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactla caggattcca tcgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 29 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 29 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgagac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttctttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc 2160 agttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc 2460 ccgaatgggt tgcatgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 30 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 30 atggctgaaa ttctcttac atcagtaatc aaaatctg tagaatagc tggaattta 60 ctgattcaag aaggaagcg tttatattgg ttgaagagg atatcgattg gctccagaga 120 gaatgagac acatcgatc ttatgttgac aacgcaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaacttatt gaaagatatt caagaatttgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa attcacaa tccatagt tcattattg ccttaagagg 300 agttcttttg cagatgagtt tgctatggag attgagaga taagagaag ggttgttgac 360 attgaccgaa taggaaac ttacacatc atagatacag atacaata tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatgct acaagccaaa ttacttaatc aagatttgca ttatggatt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg ttcacaaca gccaagagcg 660 agtgaaatct tactgacat tgccaacaa attggaactga cggaaatct atgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc 2160 agttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc 2460 ccgaatgggt tgaaggaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 31 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 31 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttctttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaattgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc 2160 agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc 2460 ccgaatgggt tgactgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 32 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 32 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttcttttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gtttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg agggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctgggaggt tctgaagctc 2160 agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ttgatctgga gatgtgaaat tcctgatgaa aatgtgaaat tcctgatgaa aatgtgaaat 60 ccgtgtgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 aaatga 2586 <210> 33 <211> 2586 <212> DNA <213> Artificial <220> <223> Mutant <400> 33 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgagac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttcttttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gtttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttatag gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 2040. tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataatt ttttgaaccg aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcattcc tccaaatctc atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca tttcccaaat tagaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc ccgtttgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 34 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 34 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttctttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gtttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTAA 60 GGTAATAGGC GAGAGGCTGA GGATTTGGCG GAGGACGTCC TAAATGATTT GGTTC T AGA 1380 AATCTGATTG ATGTTTGCCC AAAGGACATA TAATGGAAGA TTTCAAGTTG TCGCATACAT 1440 GACTTGTTAC ATAGTTTGTT GTGTGGACTT GGCTAAGGAA AGTAAC TTC TTCACACC GC G 1500 CATGATGCAT TTGGTGATCC CGGCAATGTT GCTAGGCTCC GAAGGATACA TTCTACTCT 1560 GACAATGTCA TGATTGAGTT CTTCCGTTCA AATCCTAAGC TTGAGAAGCT TC GTGTACTT 1620 TTCTGTTTCG CAAAAGACCC TTCCATATTT TCTCATATGG CTTATTTTGA CTTCAAATTG 1680 TTGCACACAT TG GTTG TAGT CATGTCTCAA AGTTTTCAAG CATATGTCAC TATCCCAAGC 1740 AAATTTGGGA ACATGACTTG CTTACGCTAT CTGAGATTGG AGGGGATAAT TTGTGGAAAA 1800 CTGCCAAATA GTATTGTCAA GCTCACACGT CTAGAGACCA TAGACATTC ATCGACGTA GC 1860 CTCATTCAAC CTCCTTCTGG TGTTTGGGAG TCTAAACATT TGAGACATCT TTGTTATAGA 1920 GATTATGGAC AAGCATGTAA CAGTTGCTTT TCTATAAGCT CATT TTACCC AAATATTTAC 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc 2160 agttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc 2460 ccgatggggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 35 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 35 atggctgaaa ttctcttac atcagtaatc aaaatctg tagaatagc tggaattta 60 ctgattcaag aaggaagcg tttatattgg ttgaagagg atatcgattg gctccagaga 120 gaatgagac acatcgatc ttatgttgac aacgcaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaacttatt gaaagatatt caagaatttgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa attcacaa tccatagt tcattattg ccttaagagg 300 agttcttttg cagatgagtt tgctatggag attgagaga taagagaag ggttgttgac 360 attgaccgaa taggaaac ttacacatc atagatacag atacaata tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatgct acaagccaaa ttacttaatc aagatttgca ttatggatt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg ttcacaaca gccaagagcg 660 agtgaaatct tactgacat tgccaacaa attggaactga cggaaatct atgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaattgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc 2160 agttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca 2340 tttcccaaat taagaaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat 2400 ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc 2460 ccgtatgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag 2520 ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt 2580 August 2586 <210> 36 <211> 2586 <212> DNA <213>人工序列(artificial) <220> <223>突变体(mutant) <400> 36 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttctttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gtttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaattgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttgggag tctaaacatt tgagacatct ttgttataga 1920 gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 1980 tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataaatt ttttgaaccg 2040 aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct 2100 accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc 2160 agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag 2220 ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcatttcc tccaaatctc 2280 atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca tttcccaaat tagaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc ccgtgggggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt aaatga 2586 <210> 37 <211> 18 <212> DNA <213> Orientation(artificial) <220> <223>引物(first) <400> 37 cctgccgaga aagtatcc <210> 38 <211> 18 <212> DNA <213> Orientation(artificial) <220> <223>引物(first) <400> 38 gccaacgcta tgtcctga <210> 39 <211> 21 <212> DNA <213> Orientation(artificial) <220> <223>引物(first) <400> 39 ttcctccaaa tctcatcaag c 21 <210> 40 <211> 22 <212> DNA <213> artificial <220> <223> primer <400> 40 caacaagcca agagaaaaca ca 22 <210> 41 <211> 11668 <212> DNA <213> artificial <220> <223> plasmid <400> 41 atggctgaaa ttcttcttac atcagtaatc aataaatctg tagaaatagc tggaaattta 60 ctgattcaag aaggaaagcg tttatattgg ttgaaagagg atatcgattg gctccagaga 120 gaaatgagac acattcgatc ttatgttgac aacgcaaagg ccaaggaagc tggaggtgat 180 tcaagggtca aaaacttatt gaaagatatt caagaattgg caggtgatgt ggaggatctc 240 ttagatgact tccttccaaa aattcaacaa tccaataagt tcaattattg ccttaagagg 300 agttcttttg cagatgagtt tgctatggag attgagaaga taaagagaag ggttgttgac 360 attgaccgaa taaggaaaac ttacaacatc atagatacag ataacaataa tgatgattgt 420 gttctgctgg atcggagaag attattccta catgctgatg aaacagagat catcggtttg 480 gatgatgact tcaatatgct acaagccaaa ttacttaatc aagatttgca ttatggagtt 540 gttccatag ttggcatgcc cggtctgggg aaaacaactc ttgccaagaa actttatagg 600 ctcattcgtg atcaatttga gtgttctgga ctggtctacg tttcacaaca gccaagagcg 660 agtgaaatct tacttgacat tgccaaacaa attggactga cggaacagaa aatgaaggaa 720 aatttggagg acaacctgcg atcactcttg aaaataaaaa ggtatgttat cctcctagat 780 gacatttggg atgtggaaat ttgggatgat ctgaaacttg tccttcctga atgtgattca 840 aaagtcggca gtagaatgat aatcacgtct cgaatagta atgtaggcag atacatagga 900 ggggaatcct ccctccatgc attgcaaccc ctagaatccg agaaaagctt tgaactcttt 960 accaagaaaa tctttaattt tgatgataat aatagttggg ccaatgcttc acctgacttg 1020 gtgaatattg gtagaaatat agttgggaga tgtggaggta taccgctagc catagtggtg 1080 actgcaggca tgttaagggc aagagaaaga acagaacatg cgtggaacag agtacttgag 1140 agtatgggcc ataaagttca agatggatgt gctaaggtat tggctctcag ttacaatgat 1200 ttacctattg cctcaaggcc atgtttcttg tactttggcc tttaccccga ggaccatgaa 1260 attcgtgctt ttgatttgat aaatatgtgg attgctgaga agtttatagt agtaaatagt 1320 ggtaataggc gagaggctga ggatttggcg gaggacgtcc taaatgattt ggtttctaga 1380 aacttgattc aacttgccaa aaggacatat aatggaagaa tttcaagttg tcgcatacat 1440 gacttgttac atagtttgtg tgtggacttg gctaaggaaa gtaacttctt tcacaccgcg 1500 catgatgcat ttggtgatcc cggcaatgtt gctaggctcc gaaggattac attctactct 1560 gacaatgtca tgattgagtt cttccgttca aatcctaagc ttgagaagct tcgtgtactt 1620 ttctgtttcg caaaagaccc ttccatattt tctcatatgg cttattttga cttcaaattg 1680 ttgcacacat tggttgtagt catgtctcaa agttttcaag catatgtcac tatcccaagc 1740 aaatttggga acatgacttg cttacgctat ctgagattgg aggggaatat ttgtggaaaa 1800 ctgccaaata gtattgtcaa gctcacacgt ctagagacca tagacattga tcgacgtagc 1860 ctcattcaac ctccttctgg tgtttggggag tctaaacatt tgagacatct ttgttatag gattatggac aagcatgtaa cagttgcttt tctataagct cattttaccc aaatatttac 2040. tcattgcatc ctaacaatct acaaaccttg atgtggatac ctgataatt ttttgaaccg aggttgttgc accgattgat caatttaaga aaactgggta tactgggagt gtccaattct accgttaaga tgttatcaat atttagccct gtgcttaagg cgctggaggt tctgaagctc agtttttcca gtgacccgag tgaacaaata aagttgtcat cgtatccaca tattgctaag ttgcatttga atgttaacag aacaatggcc ttgaactctc aatcattcc tccaaatctc atcaagctta ctctagccta ctttagtgta gaccgttata tactggcagt acttaagaca tttcccaaat tagaaact taaaatgttc atctgcaagt ataatgaaga aaagatggat ctctcgggcg aggcaaatgg ttatagcttt ccgcaacttg aagttttgca tattcatagc ccgaatgggt tgtctgaagt aacgtgcacg gatgatgtca gtatgcccaa attgaaaaag ctgttactta caggattcca ttgccgaatc agtttatcgg aacggcttaa aaagctgagt aaatgaacct agggtgggat atgaagatga agatgaaata tttggtgtgt caaataaaaa 2640 gcttgtgtgc ttaagtttgt gtttttttct tggcttgttg tgttatgaat ttgtggcttt 2700 ttctaatatt aaatgaatgt aagatctcat tataatgaat aaacaaatgt ttctataatc 2760 cattgtgaat gttttgttgg atctcttctg cagcatataa ctactgtatg tgctatggta 2820 tggactatgg aatatgatta aagataaggt gatatcgaat tcctgcggta cccgcttca 2880 gtttaaacta tcagtgtttg acaggatata ttggcgggta aacctaagag aaaagagcgt 2940 ttattagaat aacggatatt taaaagggcg tgaaaaggtt tatccgttcg tccatttgta 3000 tgtgcatgcc aaccacaggg ttcccctcgg gatcaaagta ctttgatcca acccctccgc 3060 tgctatagtg cagtcggctt ctgacgttca gtgcagccgt cttctgaaaa cgacatgtcg 3120 cacaagtcct aagttacgcg acaggctgcc gccctgccct tttcctggcg tttcttgtc 3180 gcgtgttttta gtcgcataaa gtagaatact tgcgactaga accggagaca ttacgccatg 3240 aacaagagcg ccgccgctgg cctgctgggc tatgcccgcg tcagcaccga cgaccaggac 3300 ttgaccaacc aacgggccga actgcacgcg gccggctgca ccaagctgtt ttccgagaag 3360 atcaccggca ccaggcgcga ccgcccggag ctggccagga tgcttgacca cctacgccct 3420 ggcgacgttg tgacagtgac caggctagac cgcctggccc gcagcacccg cgacctactg 3480 gacattgccg agcgcatcca ggaggccggc gcgggcctgc gtagcctggc agagccgtgg 3540 gccgacacca ccacgccggc cggccgcatg gtgttgaccg tgttcgccgg cattgccgag 3600 ttcgagcgtt ccctaatcat cgaccgcacc cggagcgggc gcgaggccgc caaggcccga 3660 ggcgtgaagt ttggcccccg ccctaccctc accccggcac agatcgcgca cgcccgcgag 3720 ctgatcgacc aggaaggccg caccgtgaaa gaggcggctg cactgcttgg cgtgcatcgc 3780 tcgaccctgt accgcgcact tgagcgcagc gaggaagtga cgcccaccga ggccaggcgg 3840 cgcggtgcct tccgtgagga cgcattgacc gaggccgacg ccctggcggc cgccgagaat 3900 gaacgccaag aggaacaagc atgaaaccgc accaggacgg ccaggacgaa ccgtttttca 3960 ttaccgaaga gatcgaggcg gagatgatcg cggccgggta cgtgttcgag ccgcccgcgc 4020 acgtctcaac cgtgcggctg catgaaatcc tggccggttt gtctgatgcc aagctggcgg 4080 cctggccggc cagcttggcc gctgaagaaa ccgagcgccg ccgtctaaaa aggtgatgtg 4140 tatttgagta aaacagcttg cgtcatgcgg tcgctgcgta tatgatgcga tgagtaaata 4200 aacaaatacg caaggggaac gcatgaaggt tatcgctgta cttaaccaga aaggcgggtc 4260 aggcaagacg accatcgcaa cccatctagc ccgcgccctg caactcgccg gggccgatgt 4320 tctgttagtc gattccgatc cccagggcag tgcccgcgat tgggcggccg tgcgggaaga 4380 tcaaccgcta accgttgtcg gcatcgaccg cccgacgatt gaccgcgacg tgaaggccat 4440 cggccggcgc gacttcgtag tgatcgacgg agcgccccag gcggcggact tggctgtgtc 4500 cgcgatcaag gcagccgact tcgtgctgat tccggtgcag ccaagccctt acgacatatg 4560 ggccaccgcc gacctggtgg agctggttaa gcagcgcatt gaggtcacgg atggaaggct 4620 acaagcggcc tttgtcgtgt cgcgggcgat caaaggcacg cgcatcggcg gtgaggttgc 4680 cgaggcgctg gccgggtacg agctgcccat tcttgagtcc cgtatcacgc agcgcgtgag 4740 ctacccaggc actgccgccg ccggcacaac cgttcttgaa tcagaacccg agggcgacgc 4800 tgcccgcgag gtccaggcgc tggccgctga aattaaatca aaactcattt gagttaatga 4860 ggtaaagaga aaatgagcaa aagcacaaac acgctaagtg ccggccgtcc gagcgcacgc 4920 agcagcaagg ctgcaacgtt ggccagcctg gcagacacgc cagccatgaa gcgggtcaac 4980 tttcagttgc cggcggagga tcacaccaag ctgaagatgt acgcggtacg ccaaggcaag 5040 accattaccg agctgctatc tgaatacatc gcgcagctac cagagtaaat gagcaaatga 5100 ataaatgagt agatgaattt tagcggctaa aggaggcggc atggaaaatc aagaacaacc 5160 aggcaccgac gccgtggaat gccccatgtg tggaggaacg ggcggttggc caggcgtaag 5220 cggctggggtt gtctgccggc cctgcaatg cactggaacc cccaagcccg aggaatcggc 5280 gtgacggtcg caaaccatcc ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg 5340 tggagaagtt gaaggccgcg caggccgccc agcggcaacg catcgaggca gaagcacgcc 5400 ccggtgaatc gtggcaagcg gccgctgatc gaatccgcaa agaatcccgg caaccgccgg 5460 CAGCCGCTGC GCCGTCTATT AGGAAGCCGC CCAAGGGCGA CGAGCAACCA GATTTTTTCG 5520 TTCCGATGCT CTATGACGTG GGCACCCGCG ATAGTCGCAG CATCATGGAC GTGGCCGT TT 5580 TCCGTCTGTC GAAGCGTGAC CGACGAGCTG GCGAGGTGAT CCGCTACGAG CTTCCGACG 5640 GGCACGTAGA GGTTC CGCAGGGCCGGCCGGCATGGCCAGTGTGTGGGATTACGACCTGG 5700 TACTGATGGC GGTTC CCGTCTAACCGAATCCATGAACCGATACCGGGAA GGGAAGGGAG 5760 ACAAGCCCAG CCACGTGTTC CGTCCACACG TTGCAGACGT ACTCAAGTTC TGCAGGCAGA 5820 CCGATGGCGG AAAGCAGAAA GACGACCTGG TAGAAACCTG CATTAGGTT AACACCACGC 5880 ACGTGCCC ATGCAGCGTAC GAAAGAGCCA AGAACGGCCG CCTGCTGACG GTATCCGAGG 5940 GTGAAGCCTT GATTAGCCGC TACAAGATCG TAAAGAGCGA AACCAGGCAG CCAGAGTACA 6000 TCGAGATCGA GCTAGCTGAT TGGATGTACC GCGAGATCAC AGAAGGCAGG AACCCGGACG 6060 TGCTGACGGT TCACCCCGAT TACTTTTTGA TCGATCCCAG CATCGGCCGT TTTCTCTACC 6120 GCCTGGCACG CCAGCCGCA GGCAAGGCAG AAGCCAGATG GTTGTTCAGA CGATCTACG 6180 aacgcagtgg cagcgccgga gagttcaaga agttctgttt caccgtgcgc aagctgatcg 6240 ggtcaaatga cctgccggag tacgatttga aggaggaggc ggggcaggct ggcccgatcc 6360. tagtcatgcg ctaccgcaac ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg agcagatgct agggcaaatt gccctagcag gggaaaaagg tcgaaaaggt cactttcctg tggatagcac gtacattggg aacccaaagc cgtacattgg gaaccggac ccgtacattg ggacccaaa gccgtacatt gggaaccggt cacacatgta agtgactgat ataaagaga aaaaaggcga tttttccgcc taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct ggccagcgca after gctgcaaaaa gcgcctaccc 6660 ttcggtcgct gcgctcccta cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc 6720 6780. gctcaaaaat ggctggccta cggccaggca atctaccagg gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc cccatcaag gcaccctgcc tcgcgcgttt cggtgatgac 6840. ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat GCGGAGCAGAC AAGCCCCTCA GGGCGCGTCA GC GGGGTGTTG GC GGGGTGTCG GGGCGCA 6960 GCCATGACCC AGTCACGTAG CGATAGCGGA GTGTATACTG GCTTAAC TAT GC GGTATCAG 7020 AGCAGATCGT ACTGAGAGTG CACC ATAT GC GGTGTGAAAT ACCGCACAG ATGC GTAAGGA 7080 GAAAATCCGC ATCAGGCGCT CTTCCGCTTC CTCGCTCACC T GACTCGCTG CGCTCGGTCG 7140 TTCGGCTGCG GCGAGCGGTA TCAGCTCACT CAAAGGCGGT AATACGGTTA TCCACAGAAT 7200 CAGGGGATAA CGCAGGAAGA ACATGTGAGC AAAAGGCCAG CAAAAGGCCA GGAACC GTA 7260 AAAAGGCCGC GTTGCTGGCG TTTTTCCATA GGCTCCGCCC CCCTGACGAG CATCACAAAA 7320 ATCGACGCTC AAGTCAGAGG TGGCGAAACC CGACAGGACT ATAAAGATAC CAGGC GTTTC 7380 CCCCTGG AAGCTCCCTCGT GC GCTCTCCTG TTCCGACCC T GCCGCTTACC GGATACCTGT 7440 CCGCCTTTCT CCCTTCGGGA AGC GTGGCGCTT TCTCATAGCT CACGCTGTAG GTATCTCA 7500 GTTCGGTGTAG GTCGTTCGCT CCAAGCTGGG CTGTGTGCAC GAACCCCCCG TTCAGCCCG 7560 ACC GCTGC GCCTTATCCGG TAAC TATCGTTGAGTCC AACCCGGTA GACACGACTTAT 7620 cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 7680 cagagttctt gaagtggtgg cctaactacg gctacactag area tttggtatct 7740 gcgctctgct gaagccagtt accttggaa aaagagttgg tagctcttga tccggcaaac 7800 aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 7860 7920 actcacgtta agggatttg gtcatgcatg atatatctcc caatttgtgt agggcttatt 7980 atgcacgctt aaaaataata aaagcagact tgacctgata gtttggctgt gagcaattat 8040 gtgcttagtg catctaatcg cttgagttaa cgccggcgaa gcggcgtcgg cttgaacgaa 8100 tttctagcta gacaaggtac taaaacaatt catccagtaa aataataat tttattttct 8160 cccaatcagg cttgatcccc agtaagtcaa aaaatagctc gacatactgt tcttccccga 8220 tatcctccct gatcgaccgg acgcagaagg caatgtcata ccacttgtcc gccctgccgc 8280 8340 ccaggtcgcc gtgggaaaag acaagttcct cttcgggctt ttccgtcttt aaaaaatcat 8400. acagctcgcg cggatcttta aatggagtgt cttcttccca gttttcgcaa tccacatcgg 8460 ccagatcgtt attcagtaag taatccaatt cggctaagcg gctgtctaag ctattcgtat agggacaatc cgatatgtcg atggagtgaa aggcctgat gcactccgca tacagctcga taatcttttc agggctttgt tcatcttcat actcttccga gcaaaggacg ccatcggcct 8640 cactcatgag cagattgctc cagccatcat gccgttcaaa gtgcaggacc tttggaacag gcagctttcc ttccagccat agcatcatgt cctttcccg ttccacatca taggtggtcc 8760 ctttataccg gctgtccgtc atttttaaat ataggttttc attttctccc accagcttat ataccttagc aggagacatt ccttccgtat cttttacgca gcggtatttt tcgatcagtt 8880 ttttcaattc cggtgatatt ctcattttag ccataacaag aagccatgaa aaccgccact gcgccgttac caccgctgcg ttcggtcaag gttctggacc agttgcgtga cggcagttac 9000. gctacttgca ttacagctta cgaaccgaac gaggcttatg tccactgggt tcgtgcccga attgatcaca ggcagcaacg ctctgtcatc gttacaatca acatgctacc ctccgcgaga 9120 tcatccgtgt ttcaaacccg gcagcttagt tgccgttctt ccgaatagca tcggtaacat 9180 gagcaaagtc tgccgcctta caacggctct cccgctgacg ccgtcccgga ctgatgggct 9240 gcctgtatcg agtggtgatt ttgtgccgag ctgccggtcg gggagctgtt ggctggctgg 9300 tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 9360 gacgttttta atgtactgaa ttaacgccga attgaattat cagcttgcat gcagctctcc 9420 catatggtcg actagaggcc tgccgtttta cgtttggaac tgacagaacc gcaacgttga 9480 aggagccact cagccgcggg tttctggagt ttaatgagct aagcacatac gtcagaaacc 9540 attattgcgc gttcaaaagt cgcctaaggt cactatcagc tagcaaatat ttcttgtcaa 9600 aaatgctcca ctgacgttcc ataaattccc ctcggtatcc aattagagtc tcatattcac 9660 tctcaactcg atcgaggcat gattgaacaa gatggattgc acgcaggttc tccggccgct 9720 tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg ctctgatgcc 9780 gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc 9840 ggtgccctga atgaactcca agacgaggca gcgcggctat cgtggctggc cacgacgggc 9900 gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg gctgctattg 9960 ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga gaaagtatcc 10020 atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg cccattcgac 10080 caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg tcttgtcgat 10140 caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc 10200 aaggcgcgga tgcccgacgg cgaggatctc gtcgtgaccc acggcgatgc ctgcttgccg 10260 aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg gctgggtgtg 10320 gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga gcttggcggc 10380 gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc 10440 gccttctatc gccttcttga cgagttcttc tgagcgggac tctggggttc ggactctagc 10500 tagagtcaag cagatcgttc aaacatttgg caataaagtt tcttaagatt gaatcctgtt 10560 gccggtcttg cgatgattat catataattt ctgttgaatt acgttaagca tgtaataatt 10620 aacatgtaat gcatgacgtt atttatgaga tgggttttta tgattagagt cccgcaatta 10680 tacatttaat acgcgataga aaacaaaata tagcgcgcaa actaggataa attatcgcgc 10740 gcggtgtcat ctatgttact agatctgcag gtcaacatgg tggagcacga cactctcgtc 10800 tactccaaga atatcaaaga tacagtctca gaagaccaaa gggctattga gacttttcaa 10860 caaagggtaa tatcgggaaa cctcctcgga ttccattgcc cagctatctg tcacttcatc 10920 aaaaggacag tagaaaagga aggtggcacc tacaaatgcc atcattgcga taaaggaaag 10980 gctatcgttc aagatgcctc tgccgacagt ggtcccaaag atggaccccc acccacgagg 11040 agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa agcaagtgga ttgatgtgat 11100 aacatggtgg agcacgacac tctcgtctac tccaagaata tcaaagatac agtctcagaa 11160 gaccaaaggg ctattgagac ttttcaacaa agggtaataat cgggaaacct cctcggattc 11220 cattgcccag ctatctgtca cttcatcaaa aggacagtag aaaaggaagg tggcacctac 11280 aaatgccatc attgcgataa aggaaaggct atcgttcaag atgcctctgc cgacagtggt 11340 cccaaagatg gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg 11400 tcttcaaagc aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc 11460 cactatcctt cgcaagacct tcctatat aaggaagttc atttcatttg gagaggacct 11520 cgagaattct caacacaaca tatacaaaac aaacgaatct caagcaatca agcattctac 11580 ttctattgca gcaatttaaa tcatttcttt taaagcaaaa gcaatttct gaaaatttc 11640 accatttacg aacgatagtt aattaacc 11668 <210> 42 <211> 11670 <212> DNA <213>人工序列(artificial) <220> <223>质粒(plasmid) <400> 42 acaaattgac gcttagacaa cttaataaca cattgcggac gtttttaatg tactgaatta 60 acgccgaatt gaattatcag cttgcatgca gctctcccat atggtcgact agaggcctgc 120 cgttttacgt ttggaactga cagaaccgca acgttgaagg agccactcag ccgcgggttt 180 ctggagttta atgagctaag cacatacgtc agaaaccatt attgcgcgtt caaaagtcgc 240 ctaaggtcac tatcagctag caaatatttc ttgtcaaaaa tgctccactg acgttccata 300 aattcccctc ggtatccaat tagagtctca tattcactct caactcgatc gaggcatgat 360 tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc tattcggcta 420 tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca 480 ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg aactccaaga 540 cgaggcagcg cggctatcgt ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga 600 cgttgtcact gaagcgggaa gggactggct gctattgggc gaagtgccgg ggcaggatct 660 cctgtcatct caccttgctc ctgccgagaa agtatccatc atggctgatg caatgcggcg 720 gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgaaac atcgcatcga 780 gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca 840 tcaggggctc gcgccagccg aactgttcgc caggctcaag gcgcggatgc ccgacggcga 900 ggatctcgtc gtgacccacg gcgatgcctg cttgccgaat atcatggtgg aaaatggccg 960 cttttctgga ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc 1020 gttggctacc cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt 1080 gctttacggt atcgccgctc cgattcgca gcgcatcgcc ttctatcgcc ttcttgacga 1140 gttcttctga gcgggactct ggggttcgga ctctagctag agtcaagcag atcgttcaaa 1200 cattggcaa taaagtttct taagattgaa tcctgttgcc ggtcttgcga tgattatcat 1260 ataatttctg ttgaattacg ttaagcatgt aataattaac atgtaatgca tgacgttatt 1320 tatgagatgg gtttttatga ttagagtccc gcaattatac atttaatacg cgatagaaaa 1380 caaaatatag cgcgcaaact aggataaatt atcgcgcgcg gtgtcatcta tgttactaga 1440 tctgcaggtc aacatggtgg agcacgacac tctcgtctac tccaagaata tcaaagatac 1500 agtctcagaa gaccaaaggg ctattgagac ttttcaacaa agggtaatat cgggaaacct 1560 cctcggattc cattgcccag ctatctgtca cttcatcaaa aggacagtag aaaaggaagg 1620 tggcacctac aaatgccatc attgcgataa aggaaaggct atcgttcaag atgcctctgc 1680 cgacagtggt cccaaagatg gacccccacc cacgaggac atcgtggaaa aagaagacgt 1740 tccaaccacg tcttcaaagc aagtggattg atgtgataac atggtggagc acgacactct 1800 cgtctactcc aagaatatca aagatacagt ctcagaagac caaagggcta ttgagacttt 1860 tcaacaaagg gtaatatcgg gaaacctcct cggattccat tgcccagcta tctgtcactt 1920 catcaaaagg acagtagaaa aggaaggtgg cacctacaaa tgccatcatt gcgataaagg 1980 aaaggctatc gttcaagatg cctctgccga cagtggtccc aaagatggac ccccacccac 2040 gaggagcatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg 2100 tgatatctcc actgacgtaa gggatgacgc acaatcccac tatccttcgc aagaccttcc 2160 tctatataag gaagttcatt tcatttggag aggacctcga gaattctcaa cacaacatat 2220 aaaaaaaa cgaatctca gcaatcaagc attctacttc tattgcagca attackaatca 2280 tttcttta agcaaagca atttctgaa aattttcacc atttacgaac gatagttaat 2340 taaccatggc tgaaatttctt cttacatcag taatcataa atctgtagaa atagctggaa 2400 atttactgat tcagaagga aagcgtttat attggttgaa agaggatatc gattggctcc 2460 agagagaaat gagacacatt cgatcttatg ttgacaacgc aaaggccaag gaagctggag 2520 gtgattcaag ggtcaaaaac ttattgaaag atttcaaga attggcaggt gatgtggagg 2580 atctcttaga tgactctcctt ccaaaaatttc aacaatccaa taagttcaat tattgcctta 2640 agaggagttc tttgcagat gagtttgcta tggattga gagataag agaagggttg 2700 ttgacattga ccgaatagg aaacttaca acatcataga tacagataac ataatgatg 2760 attgtgttct gctggatcgg agagattat tcctacatgc tgatgaaca gagatcatcg 2820 gtttggatga tgacttcaat atgctacaag ccaattact taatcagat ttgcattg 2880 gagttgtttc catagttggc atgcccggtc tggggaaac aactcttgcc aagaacttt 2940 ataggctcat tcgtgatcaa ttgagtgtt ctggactggt ctacgtttca caacagccaa 3000 gagcgagtga atcttactt gatatgcca aacaattgg actgacggaa cagaaatga 3060 aggaaaattt ggaggacaac ctgcgatcac tcttgaaat aaaaggtat gttatcctcc 3120 tagatgacat ttgggatgtg gaatttggg atgatctgaa acttgtcctt cctgaatgtg 3180 attcaaagt cggcagtaga atgataatca cgtctcgaaa tagtaatgta ggcagataca 3240 taggaggga atcctccctc catgcattgc aacccctaga atccgagaaa agctttgac 3300 tctttaccaa gaaaatcttt aattttgatg ataatatag ttgggccaat gcttcacctg 3360 acttggtgaa tattggtaga atatagttg ggagatgtgg aggtataccg ctagccatag 3420 tggtgactgc aggcatgtta agggcaagg aagaacaga acatgcgtgg aacagagtac 3480 ttgagagtat gggccataaa gttcagatg gatgtgctaa ggtattggct ctcagttaca 3540 atgatttacc tattgcctca aggccatgtt tctgtactt tggctttac cccgaggacc 3600 atgaaattcg tgctttgat ttgataata tgtggattgc tgagaagtttt atagtagtaa 3660 atagtggtaa taggcgagag gctgaggatt tggcggagga cgtcctaaat gatttggttt 3720 ctagaaactt gattcaactt gccaaaagga catataatgg aagaatttca agttgtcgca 3780 tacatgactt gttacatagt ttgtgtgtgg acttggctaa ggaaagtaac ttctttcaca 3840 ccgcgcatga tgcatttggt gatcccggca atgttgctag gctccgaagg attacattct 3900 actctgacaa tgtcatgatt gagttcttcc gttcaaatcc taagcttgag aagcttcgtg 3960 tactttctg ttcgcaaaa gacccttcca tattttctca tatggcttat tttgacttca 4020 aattgttgca cacattggtt gtagtcatgt ctcaaagttt tcaagcatat gtcactatcc 4080 caagcaaatt tgggaacatg acttgcttac gctatctgag attggagggg aatatttgtg 4140 gaaaactgcc aatatagtatt gtcaagctca cacgtctaga aaccatagac attgatcgac 4200 gtagcctcat tcaacctcct tctggtgttt gggagtctaa acatttgaga catctttgtt 4260 atagagatta tggacaagca tgtaacagtt gctttctctat aagctcatta tacccaaata 4320 tttactcatt gcatcctaac aatctacaaa ccttgatgtg gatacctgat aaatttttg 4380 aaccgaggtt gttgcaccga ttgatcaatt taagaaaact gggtatactg ggagtgtcca 4440 attctaccgt taagatgtta tcaatattta gccctgtgct taaggcgctg gaggttctga 4500 agctcagttt ttccagtgac ccgagtgaac aaataagtt gtcatcgtat ccacatattg 4560 ctaagttgca tttgaatgtt aacaagaaa tggccttgaa ctctcaatca tttcctccaa 4620 atctcatcaa gctactcta gcctacttta gtgtagaccg ttatatactg gcagtactta 4680 agacatttcc caaattaaga aaacttaaaa tgttcatctg caagtataat gaaaaaga 4740 tggatctctc gggcgaggca aatggttata gctttccgca acttgaagtt ttgcatattc 4800 atagcccgaa tgggttgtct gagatacgt gcacggatga tgtcagtatg cccaaattga 4860 aaaagctgtt acttacagga ttccatcgcc gaatcagttt atcggaacgg cttaaaaagc 4920 tgagtaaatg aagcttctag ggtgggatat gaagatgaag atgaaatatt tggtgtgtca 4980 aataaaaagc ttgtgtgctt aagtttgtgt tttctcttgg cttgttgtgt tatgaatttg 5040 tggctttttc taatattaaa tgaatgtaag atctcattat aatgaataaa caaatgtttc 5100 tataatccat tgtgaatgtt ttgttggatc tcttctgcag catataacta ctgtatgtgc 5160 tatggtatgg actatggaat atgattaaag ataaggtgat atcgaattcc tgcggtaccc 5220 gccttcagtt taaactatca gtgtttgaca ggatatattg gcgggtaaac ctaagagaaa 5280 agagcgttta ttagaataac ggatatttaa aagggcgtga aaaggtttat ccgttcgtcc 5340 atttgtatgt gcatgccaac cacagggttc ccctcgggat caaagtactt tgatccaacc 5400 cctccgctgc tatagtgcag tcggcttctg acgttcagtg cagccgtctt ctgaaaacga 5460 catgtcgcac aagtcctaag ttacgcgaca ggctgccgcc ctgccctttt cctggcgttt 5520 tcttgtcgcg tgttttagtc gcataaagta gaatacttgc gactagaacc ggagacatta 5580 cgccatgaac aagagcgccg ccgctggcct gctgggctat gcccgcgtca gcaccgacga 5640 ccaggacttg accaaccaac gggccgaact gcacgcggcc ggctgcacca agctgttttc 5700 cgagaagatc accggcacca ggcgcgaccg cccggagctg gccaggatgc ttgaccacct 5760 acgccctggc gacgttgtga cagtgaccag gctagaccgc ctggcccgca gcacccgcga 5820 cctactggac attgccgagc gcatccagga ggccggcgcg ggcctgcgta gcctggcaga 5880 gccgtgggcc gacaccacca cgccggccgg ccgcatggtg ttgaccgtgt tcgccggcat 5940 tgccgagttc gagcgttccc taatcatcga ccgcacccgg agcgggcgcg aggccgccaa 6000 ggcccgaggc gtgaagtttg gccccccgccc taccctcacc ccggcacaga tcgcgcacgc 6060 ccgcgagctg atcgaccagg aaggccgcac cgtgaaagag gcggctgcac tgcttggcgt 6120 gcatcgctcg accctgtacc gcgcacttga gcgcagcgag gaagtgacgc ccaccgaggc 6180 caggcggcgc ggtgccttcc gtgaggacgc attgaccgag gccgacgccc tggcggccgc 6240 cgagaatgaa cgccaagagg aacaagcatg aaaccgcacc agcacggcca ggacgaaccg 6300 tttttcatta ccgaagagat cgaggcggag atgatcgcgg ccgggtacgt gttcgagccg 6360 cccgcgcacg tctcaaccgt gcggctgcat gaaatcctgg ccggtttgtc tgatgccaag 6420 ctggcggcct ggccggccag cttggccgct gaaaccg agcgccgccg tctaaaaagg 6480 tgatgtgtat ttgagtaaaa cagcttgcgt catgcggtcg ctgcgtatat gatgcgatga 6540 gtaaataaac aaatacgcaa ggggaacgca tgaaggttat cgctgtactt aaccagaaag 6600 gcgggtcagg caagacgacc atcgcaaccc atctagcccg cgccctgcaa ctcgccgggg 6660 ccgatgttct gttagtcgat tccgatcccc agggcagtgc ccgcgattgg gcggccgtgc 6720 gggaagatca accgctaacc gttgtcggca tcgaccgccc gacgattgac cgcgacgtga 6780 aggccatcgg ccggcgcgac ttcgtagtga tcgacggagc gccccaggcg gcggacttgg 6840 ctgtgtccgc gatcaaggca gccgacttcg tgctgattcc ggtgcagcca agcccttacg 6900 acatatgggc caccgccgac ctggtggagc tggttaagca gcgcattgag gtcacggatg 6960 gaaggctaca agcggccttt gtcgtgtcgc gggcgatcaa aggcacgcgc atcggcggtg 7020 aggttgccga ggcgctggcc gggtacgagc tgcccattct tgagtcccgt atcacgcagc 7080 gcgtgagcta cccaggcact gccgccgccg gcacaaccgt tcttgaatca gaacccgagg 7140 gcgacgctgc ccgcgaggtc caggcgctgg ccgctgaaat taaatcaaaa ctcatttgag 7200 ttaatgaggt aaagagaaaa tgagcaaaag cacaaacacg ctaagtgccg gccgtccgag 7260 cgcacgcagc agcaaggctg caacgttggc cagcctggca gacacgccag ccatgaagcg 7320 ggtcaacttt cagttgccgg cggaggatca caccaagctg aagatgtacg cggtacgcca 7380 aggcaagacc attaccgagc tgctatctga atacatcgcg cagctaccag agtaaatgag 7440 caaatgaata aatgagtaga tgaattttag cggctaaagg aggcggcatg gaaaatcaag 7500 aacaaccagg caccgacgcc gtggaatgcc ccatgtgtgg aggaacgggc ggttggccag 7560 gcgtaagcgg ctgggttgtc tgccggccct gcaatggcac tggaaccccc aagcccgagg 7620 aatcggcgtg acggtcgcaa accatccggc ccggtacaaa tcggcgcggc gctgggtgat 7680 gacctggtgg agaagttgaa ggccgcgcag gccgcccagc ggcaacgcat cgaggcagaa 7740 gcacgccccg gtgaatcgtg gcaagcggcc gctgatcgaa tccgcaaaga atcccggcaa 7800 ccgccggcag ccggtgcgcc gtcgattagg aagccgccca agggcgacga gcaaccagat 7860 ttttcgtc cgatgctcta tgacgtgggc acccgcgata gtcgcagcat catggacgtg 7920 gccgttttcc gtctgtcgaa gcgtgaccga cgagctggcg aggtgatccg ctacgagctt 7980 ccagacgggc acgtagaggt ttccgcaggg ccggccggca tggccagtgt gtgggattac 8040 gacctggtac tgatggcggt ttcccatcta accgaatcca tgaaccgata ccgggaaggg aagggagaca agcccggccg cgtgttccgt ccacacgttg cggacgtact caagttctgc cggcgagccg atggcggaaa gcagaaagac gacctggtag aaacctgcat tcggttaaac accacgcacg ttgccatgca gcgtacgaag aaggccaaga acggccgcct ggtgacggta 8280 tccgagggtg aagccttgat tagccgctac aagatcgtaa agagcgaaac cggggcggccg gagtacatcg agatcgagct agctgattgg atgtaccgcg agatcacaga aggcaagaac ccggacgtgc tgacggttca ccccgattac tttttgatcg atcccggcat cggccgtttt 8460 ctctaccgcc tggcacgccg cgccgcaggc aaggcagaag ccagatggtt gttcaagacg 8520. atctacgaac gcagtggcag cgccggagag ttcaagaagt tctgtttcac cgtgcgcaag 8580. ctgatcgggt caaatgacct gccggagtac gatttgaagg aggaggcggg gcaggctggc 8640 ccgatcctag tcatgcgcta ccgcaacctg atcgagggcg aagcatccgc cggttcctaa 8700 tgtacggagc agatgctagg gcaaattgcc ctagcagggg aaaaaggtcg aaaaggtcac 8760 tttcctgtgg atagcacgta cattgggaac ccaaagccgt acattgggaa ccggaacccg 8820 tacattggga acccaaagcc gtacattggg aaccggtcac acatgtaagt gactgatata 8880 aaagagaaaa aaggcgattt ttccgcctaa aactctttaa aacttattaa aactcttaaa 8940 acccgcctgg cctgtgcata actgtctggc cagcgcacag ccgaagagct gcaaaaagcg 9000 cctacccttc ggtcgctgcg ctccctacgc cccgccgctt cgcgtcggcc tatcgcggcc 9060 gctggccgct caaaaatggc tggcctacgg ccaggcaatc taccagggcg cggacaagcc 9120 gcgccgtcgc cactcgaccg ccggcgccca catcaaggca ccctgcctcg cgcgtttcgg 9180 tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta 9240 agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg 9300 gggcgcagcc atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg 9360 gcatcagagc agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc 9420 gtaaggagaa aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc 9480 tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc 9540 acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg 9600 aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 9660 cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 9720 gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 9780 tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 9840 tatctcagtt cggtgtaggt cgttcgctcc aagctggggct gtgtgcacga accccccgtt 9900 cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 9960 gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 10020 ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt 10080 ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 10140 ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 10200 agaaaaaaag gatctcaaga agatccttg atctttctcta cggggtctga cgctcagtgg 10260 aacgaaaact cacgttaagg gattttggtc atgcatgata tatctcccaa tttgtgtagg 10320 gcttattg cacgcttaaa aataataaaa gcagacttga cctgatagtt tggctgtgag 10380 caattatgtg cttagtgcat ctaatcgctt gagttaacgc cggcgaagcg gcgtcggct 10440 gaacgaattt ctagctagac aaggtactaa aacaattcat ccagtaaaat ataatatttt 10500 atttctccc aatcaggctt gatccccagt aagtcaaaaa atagctcgac atactgttct 10560 tccccgatat cctccctgat cgaccggacg cagaaggcaa tgtcatacca cttgtccgcc 10620 ctgccgcttc tcccaagatc aataaagcca cttactttgc catctttcac aaagatgttg 10680 ctgtctccca ggtcgccgtg ggaaaagaca agttcctctt cgggctttc cgtctttaaa 10740 aaatcataca gctcgcgcgg atctttaaat ggagtgtctt cttcccagtt ttcgcaatcc 10800 acatcggcca gatcgttatt cagtaagtaa tccaattcgg ctaagcggct gtctaagcta 10860 ttcgtatagg gacaatccga tatgtcgatg gagtgaaaga gcctgatgca ctccgcatac 10920 agctcgataa tcttttcagg gctttgttca tcttcatact cttccgagca aaggacgcca 10980 tcggcctcac tcatgagcag attgctccag ccatcatgcc gttcaaagtg caggaccttt 11040 ggaacaggca gctttccttc cagccatagc atcatgtcct tttcccgttc cacatcatag 11100 gtggtccctt tataccggct gtccgtcatt tttaaatata ggttttcatt ttctcccacc 11160 agcttatata ccttagcagg agacattcct tccgtatctt ttacgcagcg gtatttttcg 11220 atcagttttt tcaattccgg tgatattctc attttagcca taacaagaag ccatgaaaac 11280 cgccactgcg ccgttaccac cgctgcgttc ggtcaaggtt ctggaccagt tgcgtgacgg 11340 cagttacgct acttgcatta cagcttacga accgaacgag gcttatgtcc actgggttcg 11400 tgcccgaatt gatcacaggc agcaacgctc tgtcatcgtt acaatcaaca tgctaccctc 11460 cgcgagatca tccgtgtttc aaacccggca gcttagttgc cgttcttccg aatagcatcg 11520 gtaacatgag caaagtctgc cgccttacaa cggctctccc gctgacgccg tcccggactg 11580 atgggctgcc tgtatcgagt ggtgattttg tgccgagctg ccggtcgggg agctgttggc 11640 tggctggtgg caggatatat tgtggtgtaa 11670 <210> 43 <211> 11670 <212> DNA <213> 人工序列(artificial) <220> <223> 质粒(plasmid) <400> 43 acaaattgac gcttagacaa cttaataaca cattgcggac gtttttaatg tactgaatta 60 acgccgaatt gaattatcag cttgcatgca gctctcccat atggtcgact agaggcctgc 120 cgttttacgt ttggaactga cagaaccgca acgttgaagg agccactcag ccgcgggttt 180 ctggagttta atgagctaag cacatacgtc agaaaccatt attgcgcgtt caaaagtcgc 240 ctaaggtcac tatcagctag caaatatttc ttgtcaaaaa tgctccactg acgttccata 300 aattcccctc ggtatccaat tagagtctca tattcactct caactcgatc gaggcatgat 360 tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc tattcggcta 420 480. tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg aactccaaga 540 cgaggcagcg cggctatcgt ggctggccac gacggggcgtt ccttgcgcag ctgtgctcga 600 cgttgtcact gaagcggga gggactggct gctattgggc gaagtgccgg ggcaggatct 660 cctgtcatct caccttgctc ctgccgagaa agtatccatc atggctgatg caatgcggcg 720 gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca 840 tcaggggctc gcgccagccg aactgttcgc caggctcaag gcgcggatgc ccgacggcga 900 ggatctcgtc gtgacccacg gcgatgcctg cttgccgaat atcatggtgg aaaatggccg 960 cttttctgga ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc 1020 gttggctacc cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt 1080 gctttacggt atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga 1140 gttcttctga gcgggactct ggggttcgga ctctagctag agtcaagcag atcgttcaa 1200 catttggcaa taaagttctt taagattgaa tcctgttgcc ggtcttgcga tgattcat 1260 ataatttctg ttgaattacg ttaagcatgt ataattac atgtaatgca tgacgttatt 1320 tatgagatgg gtttttatga ttagagtccc gcaattatac atttaacg cgatagaaaa 1380 CAAAatag cgcgcaact aggaataatt atcgcgcgcg gtgtcatcta tgttactaga 1440 tctgcaggtc aacatggtgg agcacgacac tctcgctac tccagata tcaagtac 1500 agtctcagaa gaccaaaggg ctattgagac ttttcaaca agggtatat cgggaaacct 1560 cctcggattc cattgcccag ctatctgtca cttcatcaa aggacagtag aaaggaagg 1620 tggcacctac aaatgccatc attgcgataa aggaaggct atcgttcaag atgcctctgc 1680 cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa aagagacgt 1740 tccaccacg tctcaacg aagtgattg atgtgatac atggtggagc acgacactct 1800 cgtctactcc aagaatatca aagatacagt ctcagagac caagggcta tgagacttt 1860 tcaacaaagg gtaatatcgg gaaacctcct cggattccat tgcccagcta tctgtcactt 1920 catcaaaagg acagtagaaa aggaaggtgg cacctacaaa tgccatcatt gcgataaagg 1980 aaaggctatc gttcaagatg cctctgccga cagtggtccc aaagatggac ccccacccac 2040 gaggagcatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg 2100 tgatatctcc actgacgtaa gggatgacgc acaatcccac tatccttcgc aagaccttcc 2160 tctatataag gaagttcatt tcatttggag aggacctcga gaattctcaa cacaacatat 2220 acaaaacaaa cgaatctcaa gcaatcaagc attctacttc tattgcagca atttaaatca 2280 tttcttttaa agcaaaagca attttctgaa aattttcacc atttacgaac gatagttaat 2340 taaccatggc tgaaattctt cttacatcag taatcaataa atctgtagaa atagctggaa 2400 atttactgat tcaagaagga aagcgtttat attggttgaa agaggatatc gattggctcc 2460 agagagaaat gagacacatt cgatcttatg ttgacaacgc aaaggccaag gaagctggag 2520 gtgattcaag ggtcaaaaac ttattgaaag atattcaaga attggcaggt gatgtggagg 2580 atctcttaga tgactctcctt ccaaaaatttc aacaatccaa taagttcaat tattgcctta 2640 agaggagttc tttgcagat gagtttgcta tggattga gagataag agaagggttg 2700 ttgacattga ccgaatagg aaacttaca acatcataga tacagataac ataatgatg 2760 attgtgttct gctggatcgg agagattat tcctacatgc tgatgaaca gagatcatcg 2820 gtttggatga tgacttcaat atgctacaag ccaattact taatcagat ttgcattg 2880 gagttgtttc catagttggc atgcccggtc tggggaaac aactcttgcc aagaacttt 2940 ataggctcat tcgtgatcaa ttgagtgtt ctggactggt ctacgtttca caacagccaa 3000 gagcgagtga atcttactt gatatgcca aacaattgg actgacggaa cagaaatga 3060 aggaaaattt ggaggacaac ctgcgatcac tcttgaaat aaaaggtat gttatcctcc 3120 tagatgacat ttgggatgtg gaatttggg atgatctgaa acttgtcctt cctgaatgtg 3180 attcaaagt cggcagtaga atgataatca cgtctcgaaa tagtaatgta ggcagataca 3240 taggaggga atcctccctc catgcattgc aacccctaga atccgagaaa agctttgac 3300 3360 acttggtgaa tattggtaga aatatagttg ggagatgtgg aggtataccg ctagccatag 3420 tggtgactgc aggcatgtta agggcaagag aaagaacaga acatgcgtgg aacagagtac 3480 ttgagagtat gggccataaa gttcaagatg gatgtgctaa ggtattggct ctcagttaca 3540 atgatttacc tattgcctca aggcatgtt tcttgtactt tggcctttac cccgaggacc 3600 atgaaattcg tgcttttgat ttgataaata tgtggattgc tgagaagttt atagtagtaa 3660 atagtggtaa taggcgagag gctgaggatt tggcggagga cgtcctaaat gatttggttt 3720 ctagaaactt gattcaactt gccaaaagga catataatgg aagaatttca agttgtcgca 3780 tacatgactt gttacatagt ttgtgtgtgg acttggctaa ggaaagtaac ttctttcaca 3840 ccgcgcatga tgcatttggt gatcccggca atgttgctag gctccgaagg attacattct 3900 actctgacaa tgtcatgatt gagttcttcc gttcaaatcc taagcttgag aagcttcgtg 3960 tacttttctg tttcgcaaaa gacccttcca tattttctca tatggcttat tttgacttca 4020 aattgttgca cacattggtt gtagtcatgt ctcaaagttt tcaagcatat gtcactatcc 4080 caagcaaatt tgggaacatg acttgcttac gctatctgag attggagggg aatatttgtg 4140 gaaaactgcc aatatagtatt gtcaagctca cacgtctaga aaccatagac attgatcgac 4200 gtagcctcat tcaacctcct tctggtgttt gggagtctaa acatttgaga catctttgtt 4260 atagagatta tggacaagca tgtaacagtt gctttctctat aagctcattt tacccaaata 4320 tttactcatt gcatcctaac aatctacaaa ccttgatgtg gatacctgat aaatttttg 4380 aaccgaggtt gttgcaccga ttgatcaatt taagaaaact gggtatactg ggagtgtcca 4440 attctaccgt taagatgtta tcaatattta gccctgtgct taaggcgctg gaggttctga 4500 agctcagttt ttccagtgac ccgagtgaac aaataaagtt gtcatcgtat ccacatattg 4560 ctaagttgca tttgaatgtt aacagaacaa tggccttgaa ctctcaatca tttcctccaa 4620 atctcatcaa gcttactcta gcctacttta gtgtagaccg ttatatactg gcagtactta 4680 agacatttcc caaattaaga aaacttaaaa tgttcatctg caagtataat gaagaaaaga 4740 tggatctctc gggcgaggca aatggttata gctttccgca acttgaagtt ttgcatattc 4800 atagccccgaa tgggttgtct gaagtaacgt gcacggatga tgtcagtatg cccaaattga 4860 aaaagctgtt acttacagga ttccatcgcc gaatcagttt atcggaacgg cttaaaaagc 4920 tgagtaaatg aagcttctag ggtgggatat gaagatgaag atgaaatatt tggtgtgtca 4980 aataaaaagc ttgtgtgctt aagttttgtgt tttctcttgg cttgttgtgt tatgaatttg 5040 tggctttttc tatattaaa tgaatgtaag atctcattat aatgaataaa caaatgtttc 5100 tataatccat tgtgaatgtt ttgttggatc tcttctgcag catataacta ctgtatgtgc 5160 tatggtatgg actatggaat atgattaaag ataaggtgat atcgaattcc tgcggtaccc 5220 gccttcagtt taaactatca gtgtttgaca ggatatattg gcgggtaaac ctaagagaaa 5280 agagcgttta ttagaataac ggatatttaa aagggcgtga aaaggtttat ccgttcgtcc 5340 atttgtatgt gcatgccaac cacagggttc ccctcgggat caaagtactt tgatccaacc 5400 cctccgctgc tatagtgcag tcggcttctg acgttcagtg cagccgtctt ctgaaaacga 5460 catgtcgcac aagtcctaag ttacgcgaca ggctgccgcc ctgccctttt cctggcgttt 5520 tcttgtcgcg tgttttagtc gcataaagta gaatacttgc gactagaacc ggagacatta 5580 cgccatgaac aagagcgccg ccgctggcct gctgggctat gcccgcgtca gcaccgacga 5640 ccaggacttg accaaccaac gggccgaact gcacgcggcc ggctgcacca agctgttttc 5700 cgagaagatc accggcacca ggcgcgaccg cccggagctg gccaggatgc ttgaccacct 5760 acgccctggc gacgttgtga cagtgaccag gctagaccgc ctggcccgca gcacccgcga 5820 cctactggac attgccgagc gcatccagga ggccggcgcg ggcctgcgta gcctggcaga 5880 gccgtgggcc gacaccacca cgccggccgg ccgcatggtg ttgaccgtgt tcgccggcat 5940 tgccgagttc gagcgttccc taatcatcga ccgcacccgg agcgggcgcg aggccgccaa 6000 ggcccgaggc gtgaagtttg gcccccgccc taccctcacc ccggcacaga tcgcgcacgc 6060 ccgcgagctg atcgaccagg aaggccgcac cgtgaaagag gcggctgcac tgcttggcgt 6120 gcatcgctcg accctgtacc gcgcacttga gcgcagcgag gaagtgacgc ccaccgaggc 6180 caggcggcgc ggtgccttcc gtgaggacgc attgaccgag gccgacgccc tggcggccgc 6240 cgagaatgaa cgccaagagg aacaagcatg aaaccgcacc agcacggcca ggacgaaccg 6300 tttttcatta ccgaagagat cgaggcggag atgatcgcgg ccgggtacgt gttcgagccg 6360 cccgcgcacg tctcaaccgt gcggctgcat gaaatcctgg ccggtttgtc tgatgccaag 6420 ctggcggcct ggccggccag cttggccgct gaaaccg agcgccgccg tctaaaaagg 6480 tgatgtgtat ttgagtaaaa cagcttgcgt catgcggtcg ctgcgtatat gatgcgatga 6540 gtaataaac aaatacgcaa ggggaacgca tgaaggttat cgctgtactt aaccagaaag 6600 gcgggtcagg caagacgacc atcgcaaccc atctagcccg cgccctgcaa ctcgccgggg 6660 ccgatgttct gttagtcgat tccgatcccc agggcagtgc ccgcgattgg gcggccgtgc 6720 gggaagatca accgctaacc gttgtcggca tcgaccgccc gacgattgac cgcgacgtga 6780 aggccatcgg ccggcgcgac ttcgtagtg...

Claims

1. A TM-2-2 protein variant, wherein the TM-2-2 protein variant confers resistance to at least ToBRFV infection in tomato, and The amino acid sequence of the TM-2-2 protein variant is an amino acid sequence obtained from SEQ ID No: 8 by one or a combination of the following substitutions: a. tyrosine (Y) at the position corresponding to tyrosine 767 of SEQ ID No: 8 and arginine (R) at the position corresponding to cysteine ​​848 of SEQ ID No: 8; b. phenylalanine (F) at the position corresponding to tyrosine 767 of SEQ ID No: 8 and arginine (R) at the position corresponding to cysteine ​​848 of SEQ ID No: 8; c. tryptophan (W) at the position corresponding to tyrosine 767 of SEQ ID No: 8 and arginine (R) at the position corresponding to cysteine ​​848 of SEQ ID No: 8; and d. Tyrosine (Y) at the position corresponding to tyrosine 767 of SEQ ID No: 8 and arginine (R) at the position corresponding to cysteine ​​848 of SEQ ID No: 8 and further including leucine at the position corresponding to phenylalanine 655 of SEQ ID No:

8.

2. The TM-2-2 protein variant according to claim 1, wherein the variant is one selected from the following amino acid sequences: a. tyrosine (Y) at the position corresponding to tyrosine 767 of SEQ ID No: 8 and arginine (R) at the position corresponding to cysteine ​​848 of SEQ ID No: 8; b. phenylalanine (F) or tryptophan (W) at the position corresponding to tyrosine 767 of SEQ ID No: 8 and arginine (R) at the position corresponding to cysteine ​​848 of SEQ ID No: 8; and c. Tyrosine (Y) at the position corresponding to tyrosine 767 of SEQ ID No: 8 and arginine (R) at the position corresponding to cysteine ​​848 of SEQ ID No: 8 and further including leucine at the position corresponding to phenylalanine 655 of SEQ ID No:

8.

3. A resistance gene encoding the protein variant according to any one of claims 1 to 2, which confers resistance to ToBRFV infection on tomato plants.

4. The resistance gene according to claim 3, wherein the resistance gene is shown as SEQ ID No: 4, SEQ ID No: 5, SEQ ID NO: 27 or SEQ ID No:

28.

5. A nucleic acid construct comprising a nucleotide sequence encoding the protein variant according to any one of claims 1 to 2 or comprising the resistance gene according to any one of claims 3-4.

6. nucleic acid construct according to claim 5, wherein the nucleic acid construct is under the control of a promoter.

7. nucleic acid construct according to claim 5, wherein the nucleic acid construct is a vector.

8. nucleic acid construct according to claim 5, wherein the nucleic acid construct is a plasmid.

9. nucleic acid construct according to claim 5, wherein the nucleic acid construct is a T-DNA plasmid.

10. A non-regenerative cell comprising homozygously or heterozygously the resistance gene according to any one of claims 3-4 or the nucleic acid construct according to any one of claims 5-9. The non-renewable cell of claim 10 , wherein the cell is a plant cell.

12. The non-regenerative cell according to claim 10, which comprises homozygously or heterozygously in its genomic DNA the resistance gene according to any one of claims 3-4 or the nucleic acid construct according to any one of claims 5-9.

13. A method for obtaining a transgenic tomato plant resistant to ToBRFV, the method comprising: - obtaining a construct comprising a nucleotide sequence encoding a protein variant according to any one of claims 1 to 2 or comprising a resistance gene according to any one of claims 3 to 4, - introducing said construct into tomato cells, - Regeneration of transgenic plants; - optionally multiplying the plants obtained.

14. A method for growing tomato plants resistant to ToBRFV and optionally resistant to at least one of TMV, ToMV and / or ToMMV, the method comprising: a. hybridizing a tomato plant comprising the resistance gene according to any one of claims 3-4 with an initial tomato plant lacking a resistance gene, b. Selecting a plant carrying the resistance gene in the progeny thus obtained, c. Optionally, the plant obtained in step (b) is self-pollinated once or multiple times, and the progeny are selected to obtain plants carrying the resistance gene.

15. Use of the resistance gene sequence according to any one of claims 3-4 or the construct according to any one of claims 5-9 for conferring resistance to ToMV, TMV, ToMMV and ToBRFV on tomato plants, or for obtaining transgenic tomato plants resistant to ToMV, TMV, ToMMV and ToBRFV.

16. Use of a tomato plant or seed carrying the resistance gene according to any one of claims 3 to 4 as a breeding partner in a breeding program for conferring resistance to ToMV, TMV, ToMMV and ToBRFV in tomato plants.

17. A method for increasing tomato plant yield or reducing tomato production losses in an environment infected by ToBRFV, the method comprising planting a tomato plant comprising the resistance gene according to any one of claims 3-4 in its genome.

18. A method for reducing tomato yield losses under conditions of infection by ToMV, TMV, ToMMV and / or ToBRFV, the method comprising planting a tomato plant comprising in its genome the resistance gene according to any one of claims 3-4.

19. A method for identifying, detecting and / or selecting tomato plants resistant to ToBRFV among plants resistant to TMV and ToMV, the method comprising detecting in the genome of the plant a nucleotide sequence encoding a protein variant according to any one of claims 1 to 2 or a resistance gene according to any one of claims 3-4.

Images