Use of lipofermata in the preparation of products for the prevention and treatment of osteoporosis

Abstract

The application provides an application of Lipofermata in preparation of a product for preventing and treating osteoporosis. The pharmacological experiment of the application shows that Lipofermata can significantly prevent and treat and improve the reduction of bone mass caused by estrogen reduction, and shows that Lipofermata has the effect of preventing and treating osteoporosis, and therefore can be used for preventing and treating osteoporosis. The application not only provides a new therapeutic use of Lipofermata, but also provides a new drug for preventing and treating osteoporosis.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical applications and relates to new uses of Lipofermata, specifically the application of Lipofermata in the preparation of products for the prevention and treatment of osteoporosis. Background Technology

[0002] Skeleton is the most important supporting organ in the human body and is constantly undergoing regeneration and reconstruction. The dynamic balance and coupling between osteoblast-mediated bone formation and osteoclast-mediated bone resorption is the foundation for maintaining normal bone mass and bone physiological function. Osteoclasts originate from bone marrow mononuclear cells in hematopoietic stem cell lines. Under the influence of relevant stimulating factors, they fuse and differentiate into multinucleated giant cells, which are the only cells in the human body with bone resorption function, playing a crucial role in maintaining bone remodeling and bone metabolism balance. Overactivation of osteoclasts disrupts the balance between bone tissue remodeling and resorption, which is an important cause of osteoporosis and other bone metabolic diseases.

[0003] Inhibiting bone resorption is one of the main clinical approaches to osteoporosis. Commonly used drugs include bisphosphonates, calcitonin, RANKL (receptor activator of nuclear factor-κB ligand) monoclonal antibodies (denosumab), and strontium salts. These drugs typically inhibit osteoclast differentiation and osteoclast activity by regulating calcium and phosphorus metabolism and competitively binding to RANKL. However, the clinical application of these drugs still faces many challenges and limitations, such as unclear long-term efficacy, the risk of atypical fractures and mandibular osteonecrosis with long-term use, increased cardiovascular risk, and gastrointestinal adverse reactions.

[0004] Lipofermata is a fatty acid transporter 2 (FATP2) inhibitor. Existing research indicates that lipofermata can prevent lipid transport into melanoma cells and reduce melanoma growth and invasion. Furthermore, experimental studies have shown that lipofermata can improve renal fibrosis caused by ureteral obstruction through lipid metabolism reprogramming. However, the role of lipofermata in preventing and treating osteoporosis has not yet been reported in the current technology. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of the prior art by providing the application of Lipofermata in the preparation of products for the prevention and treatment of osteoporosis. This is because Lipofermata can exert effects such as lipid metabolism reprogramming and inhibiting osteoclast differentiation, thereby preventing or alleviating osteoporosis.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is to provide the application of Lipofermata in the preparation of products for the prevention and treatment of osteoporosis.

[0007] In the above technical solution, osteoporosis can be a bone metabolic disease characterized by reduced bone mass, destruction of bone tissue fibrous structure, and consequently increased bone fragility and susceptibility to fractures, caused by the decline in estrogen after menopause in women. It can also be osteoporosis caused by other factors such as aging, chronic inflammation, hormone drugs, or obesity.

[0008] Furthermore, Lipofermata is the sole active ingredient.

[0009] Furthermore, the products include pharmaceuticals with Lipofermata as the active ingredient.

[0010] Furthermore, Lipofermata can be used alone or in the form of a pharmaceutical composition comprising a therapeutically effective amount of Lipofermata, a pharmaceutically acceptable salt or its prodrug, and a pharmaceutically effective carrier.

[0011] Furthermore, the pharmaceutical carrier includes excipients such as starch or water (one or more); lubricants such as glycerin or magnesium stearate (one or more); disintegrants such as microcrystalline cellulose; fillers such as starch or lactose (one or more); binders such as pregelatinized starch, dextrin, cellulose derivatives, alginate, gelatin, or polyvinylpyrrolidone (one or more); osmotic pressure regulators such as glucose, sucrose, sorbitol, or mannitol (one or more); diluents such as water; disintegrants such as agar, calcium carbonate, or sodium bicarbonate (one or more); absorption enhancers such as quaternary ammonium compounds; surfactants such as hexadecyl alcohol; adsorbents such as kaolin or soap clay (one or more); lubricants such as talc, calcium stearate, magnesium stearate, or polyethylene glycol (one or more); additionally, other excipients such as flavoring agents or sweeteners may be added to the pharmaceutical composition.

[0012] Furthermore, Lipofermata can be administered in the form of a pharmaceutically acceptable salt, specifically a phosphate salt. The most preferred salt form is the phosphate salt.

[0013] This invention confirms the novel activity and uses of Lipofermata. Pharmacological experiments on the preventive and therapeutic effects of Lipofermata on osteoporosis in ovariectomized mice showed that Lipofermata can significantly prevent and treat bone loss caused by estrogen deficiency, indicating its role in preventing and treating osteoporosis. Therefore, it can be used to prepare drugs for the prevention and treatment of osteoporosis. This invention not only provides a new therapeutic use for Lipofermata but also provides a new drug for the prevention and treatment of osteoporosis. Attached Figure Description

[0014] Figure 1 This refers to the preventive and therapeutic effects of Lipofermata on osteoporosis caused by estrogen deficiency.

[0015] Figure 2 This refers to the inhibitory effect of Lipofermata on the fusion and differentiation of macrophages into osteoclasts.

[0016] Figure 3 This refers to the inhibitory effect of Lipofermata on the expression of genes related to osteoclast differentiation.

[0017] Figure 4 This is the inhibitory effect of Lipofermata on the expression of proteins related to osteoclast differentiation. Detailed Implementation

[0018] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the description of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0019] As used in this invention, the term "acceptable" means that a prescription component or active ingredient does not have an excessively harmful effect on the health of a general therapeutic target.

[0020] As used herein, the term "prevention" includes preventing, alleviating, suppressing, or improving symptoms or conditions of a disease; suppressing the development of complications; suppressing the development of a disease or symptom, such as controlling the progression of a disease or condition; reducing a disease or symptom; alleviating a disease or symptom; reducing complications arising from a disease or symptom; or preventing or treating signs arising from a disease or symptom. As used herein, a compound or pharmaceutical composition, when administered, can improve a disease, symptom, or condition, particularly by improving its severity, delaying onset, reducing disease progression, or shortening the duration of the condition. Whether administered regularly or intermittently, continuously or intermittently, it can be attributed to or related to the administration.

[0021] As used herein, the term "pharmaceutically acceptable" means a substance, such as a carrier or diluent, that does not diminish the biological activity or properties of a compound and is relatively non-toxic, meaning that, when administered to an individual, it will not cause unwanted biological effects or interact harmfully with any of its constituent components. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate-buffered saline, glucose, glycerol, or ethanol, and combinations thereof. In many cases, the composition preferably includes one or more isotonic agents, such as sugars, mannitol, sorbitol, polyols of sorbitol, or sodium chloride. Pharmaceutically acceptable carriers may also contain small amounts of admixtures, such as wetting agents or emulsifiers, preservatives, or buffers.

[0022] In terms of specific use, Lipofermata described in this invention can be used alone or in combination with many other chemical substances. Regardless of whether these chemical substances are biologically active or have therapeutic functions, including adjuvant functions such as synergistic amplification, antagonism, or mitigation of the side effects of Lipofermata, these chemical substances include one or more of pharmaceutically acceptable carriers, foods, natural products, chemically synthesized drugs, and human medicines; preferably, they include one or more of pharmaceutically acceptable carriers or foods; more preferably, pharmaceutically acceptable carriers.

[0023] The Lipofermata used in the following examples is a yellow powder with a content >99.89% and is of pharmaceutical grade. The following invention process only briefly describes the experimental contents that are of significant importance in this invention.

[0024] Example 1: The preventive and therapeutic effects of Lipofermata on osteoporosis caused by estrogen deficiency.

[0025] (I) Animal grouping and handling

[0026] Healthy 12-week-old female C57BL / 6 mice, weighing 20-25g, were provided by the Laboratory Animal Center of Sir Run Run Shaw Hospital, affiliated with Zhejiang University School of Medicine. Animals were fed and observed for 2 weeks before the experiment and then randomly divided into 4 groups: a sham-operated group (n=6) receiving intraperitoneal injection of phosphate-buffered saline; an ovariectomy group (n=6) receiving intraperitoneal injection of phosphate-buffered saline; a low-dose Lipofermata group (n=6) receiving Lipofermata 0.5mg / kg intraperitoneally three times a week; and a high-dose Lipofermata group (n=6) receiving Lipofermata 2mg / kg intraperitoneally three times a week. Lipofermata was dissolved in phosphate-buffered saline to prepare a 2.0g / L solution for intraperitoneal injection. Administration was three times a week from the day of surgery until the end of the 8th week post-surgery.

[0027] (II) Ovariectomy in Laboratory Animals

[0028] For each group of experimental mice, surgical procedures were performed after intraperitoneal anesthesia with pentobarbital. The sham-operated group underwent sham surgery without removal of both ovaries. For the ovariectomy group, the low-dose Lipofermata group, and the high-dose Lipofermata group, the ovaries were removed via a dorsal skin approach, entering the peritoneum at the mid-lumbar spine level. The peritoneum and skin were then sutured closed layer by layer. Postoperatively, the mice received the corresponding intraperitoneal medication.

[0029] (III) Bone Mass Testing

[0030] Eight weeks post-surgery, mice in all groups were euthanized, and tissue samples were harvested and fixed bilaterally in 4% paraformaldehyde at room temperature for two days. Micro-CT scans with a resolution of 9 micrometers were performed on the left femur of each group of mice after fixation, with the following parameters: voltage 70 kV, current 80 μA. 130 layers originating from the growth plate region were selected as the region of interest for data analysis and parallel three-dimensional reconstruction. Analytical parameters included the relative bone volume of trabeculae.

[0031] (iv) Statistical Processing

[0032] Data are expressed as mean plus or minus standard deviation. Statistical analysis was performed using SPSS 19 software, with P < 0.05 considered statistically significant.

[0033] (V) Experimental Results

[0034] See Figure 1Eight weeks after ovariectomy in 12-week-old female mice, the relative bone volume of trabeculae in the ovariectomy group was significantly lower than that in the sham-operated group. Furthermore, mice treated with different doses of Lipofermata showed significantly higher relative femoral trabeculae volume compared to the ovariectomy group. This demonstrates that Lipofermata has a significant preventive and therapeutic effect on estrogen-deficient osteoporosis, and that Lipofermata exhibits a clear dose-response relationship in preventing estrogen-deficient osteoporosis. Figure 1 In this study, group 0 was the sham surgery group, group 1 was the oophorectomy group, group 2 was the low-dose Lipofermata group, and group 3 was the high-dose Lipofermata group; compared with group 1, p < 0.0001.

[0035] (VI) Experimental Conclusions

[0036] Lipofermata can prevent and treat osteoporosis caused by estrogen deficiency, which is mainly characterized by bone loss.

[0037] Example 2: Inhibitory effect of Lipofermata on osteoclast-induced differentiation in vitro

[0038] (I) Extraction of mouse bone marrow-derived macrophages

[0039] Healthy 6-week-old male C57BL / 6 mice were provided by the Laboratory Animal Center of Sir Run Run Shaw Hospital, affiliated with Zhejiang University School of Medicine. The mice were euthanized, and the bilateral femurs and tibias and fibulas were dissected. The bone marrow cavity was flushed with phosphate-buffered saline (PBFS). The resulting cell mixture was filtered through a 0.4-micron filter, centrifuged, and then seeded into 96-well culture plates in α-MEM medium containing 10 ng / mL macrophage colony-stimulating factor (MCSF) and 10% fetal bovine serum (FBS).

[0040] (II) Osteoclast Induction

[0041] After the extracted mouse bone marrow-derived macrophages adhered to the culture medium, the medium was replaced with osteoclast induction medium containing 25 ng / mL MCSF and 50 ng / mL RANKL, and simultaneously treated with 0.625, 1.25, 2.5, and 5 μmol / L Lipofermata. The medium was changed every 2 days.

[0042] (III) Osteoclast staining

[0043] After 5 days of osteoclast induction, macrophages were fixed with 4% paraformaldehyde at room temperature for 10 minutes, washed 3 times with phosphate buffer, stained with tartrate-resistant acid phosphatase (TRAP), and observed under a microscope.

[0044] (IV) Experimental Results

[0045] See Figure 2 Five days after osteoclast induction, macrophages that were not treated with Lipofermata differentiated into a large number of fused, multinucleated osteoclasts, while macrophages treated with Lipofermata differentiated into significantly fewer mature osteoclasts. In this case, the higher the concentration of Lipofermata, the fewer osteoclasts were formed, showing a concentration-dependent inhibition.

[0046] (V) Experimental Conclusions

[0047] Lipofermata can inhibit osteoclast differentiation in vitro and has the effect of preventing and treating osteoporosis.

[0048] Example 3: Lipofermata inhibits the expression of genes related to osteoclast differentiation.

[0049] (I) Extraction of mouse bone marrow-derived macrophages

[0050] Healthy 6-week-old male C57BL / 6 mice were provided by the Laboratory Animal Center of Sir Run Run Shaw Hospital, affiliated with Zhejiang University School of Medicine. The mice were euthanized, and the bilateral femurs and tibias and fibulas were dissected. The bone marrow cavity was flushed with phosphate-buffered saline (PBFS). The resulting cell mixture was filtered through a 0.4-micron filter, centrifuged, and then seeded into 12-well plates in α-MEM medium containing 10 ng / mL macrophage colony-stimulating factor (MCSF) and 10% fetal bovine serum (FBS).

[0051] (II) Osteoclast Induction

[0052] After the extracted mouse bone marrow-derived macrophages adhered to the culture vessel, the osteoclast induction medium containing 25 ng / mL MCSF and 50 ng / mL RANKL was replaced, and the cells were treated with 2.5 μmol / L Lipofermata for 2 days.

[0053] (III) Extraction of ribonucleic acid (RNA) and detection by quantitative polymerase chain reaction (qPCR).

[0054] Two days after osteoclast induction, macrophages were used to extract RNA according to the instructions of the Kangwei Century Ultrapure RNA Extraction Kit (Catalog No. CW0581). The process was as follows: 1 mL of TRizon Reagent was added to each well and mixed. The mixture was inverted and allowed to stand for 5 minutes at room temperature. Then, 200 μL of chloroform was added, and the mixture was inverted and allowed to stand for 5 minutes. The cells were centrifuged at 12000 rpm for 10 minutes at 4°C. The supernatant was then mixed with 70% ethanol at a 1:1 volume ratio and passed through a silica-based adsorption column. After washing the column several times, RNA was eluted with enzyme-free water (RNase-free water). Reverse transcription was performed using the Kangwei Century Reverse Transcription Kit (Catalog No. CW2569). The reverse transcription product was diluted 1:20 with DEPC water and detected by qPCR using the Yisheng qPCR reagent (Catalog No. 11201ES03). The primer sequences used are shown in Table 1.

[0055] Table 1 Primer sequences involved in the detection of relevant osteoclast gene expression by real-time PCR

[0056] sequence name sequence upstream primers for quantitative real-time PCR of mouse NFATc1 gene CCCGTCACATTCTGGTCCAT Mouse NFATc1 gene real-time PCR downstream primers CAAGTAACCGTGTAGCTGCACAA upstream primers for quantitative real-time PCR of mouse c-fos gene GCTCACAGTAGCCACGCTT Mouse c-fos gene fluorescent quantitative PCR downstream primers AACGCCGAGAGATTTCATCCA upstream primers for quantitative real-time PCR of mouse ACP5 gene AAGAGATCGCCAGAACCGTG Mouse ACP5 gene fluorescent quantitative PCR downstream primers TTCCAGCCAGCACATACCAG

[0057] (IV) Experimental Results

[0058] See Figure 3 Two days after osteoclast induction, macrophages without Lipofermata treatment highly expressed osteoclast differentiation-related genes, such as activated T cell nuclear factor 1 (NFATc1), proto-oncogenes, AP-1 transcription factor subunit (c-fos), and tartrate-resistant acid phosphatase 5 (acp5), using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control gene. Treatment with different concentrations of Lipofermata increased the expression of osteoclast differentiation-related genes in macrophages compared to the uninduced group, but decreased gene expression compared to the osteoclast-only induction group. Figure 3 In the study, group 0 was the unstimulated macrophage group, group 1 was the osteoclast-induced macrophage group, and group 2 was the osteoclast-induced group treated with 5 μmol / L Lipofermata. Compared with group 1, p < 0.0001.

[0059] (V) Experimental Conclusions

[0060] Lipofermata can inhibit the expression of osteoclast differentiation genes in vitro, thus playing a role in preventing and treating osteoporosis.

[0061] Example 4: Lipofermata inhibits the expression of proteins related to osteoclast differentiation.

[0062] (I) Extraction of mouse bone marrow-derived macrophages

[0063] Healthy 6-week-old male C57BL / 6 mice were provided by the Laboratory Animal Center of Sir Run Run Shaw Hospital, affiliated with Zhejiang University School of Medicine. The mice were euthanized, and the bilateral femurs and tibias and fibulas were dissected. The bone marrow cavity was flushed with phosphate-buffered saline (PBFS). The resulting cell mixture was filtered through a 0.4-micron filter, centrifuged, and then seeded into 12-well plates in α-MEM medium containing 10 ng / mL macrophage colony-stimulating factor (MCSF) and 10% fetal bovine serum (FBS).

[0064] (II) Osteoclast Induction

[0065] After the extracted mouse bone marrow-derived macrophages adhered to the culture vessel, the osteoclast induction medium containing 25 ng / mL MCSF and 50 ng / mL RANKL was replaced, and the cells were treated with 0.625, 1.25, 2.5, and 5 μmol / L Lipofermata for 2 days.

[0066] (III) Protein extraction and Western blotting detection.

[0067] Two days after osteoclast induction, macrophages were used to extract protein according to the instructions of BIO-RAD 4x Laemmli Sample Buffer (catalog number #161-0737). The steps are as follows: Add 20 μL TRizon Reagent, 60 μL ddH2O, and 1 μL LDTT to each well, mix well, lyse at room temperature for 5 minutes, and let stand for 5 minutes. Scrape the mixture into 1.5 mL EP tubes and centrifuge at 100°C for 10 minutes in a metal bath. 1. Assemble a 1.5 mm glass plate with a shorter glass plate, clamp it in the glass plate interlayer of the electrophoresis apparatus without gaps, and fix it to the gel casting rack. 2. Prepare a 10% separating gel solution as needed (5.9 mL ddH2O, 5 mL polyacrylamide, 3.8 mL pH = 8.8 Tris-HCl, 150 μL 10% SDS), then add 150 μL 10% ammonium persulfate and 15 μL LDTT, and gently mix. 1. Quickly add the separating gel solution along the edge of the glass plate using a plastic pipette, stopping at the appropriate position. Then add isopropanol or anhydrous ethanol to seal the separating gel and let it stand at room temperature for 20-30 minutes. 2. Discard the isopropanol or anhydrous ethanol and wash the filter paper. 3. Prepare the stacking gel solution (4 mL ddH2O, 1 mL polyacrylamide, 1 mL pH=6.8 Tris-HCl, 80 μL 10% SDS), then add 60 μL 10% ammonium persulfate and 7.5 μL TEMED, mix well, and add to the glass plate interlayer. Insert a 1.5 mm 15-well comb into the middle of the glass plate and let it stand at room temperature for 20-30 minutes. 4. Gently remove the comb, being careful not to damage the sample wells. Add 1× electrophoresis buffer to the electrophoresis tank until the appropriate liquid level is reached. 5. Carefully add the protein sample in equal volumes to the sample wells using a pipette. Add an equal volume of 1× loading buffer to the blank wells to prevent sample diffusion between adjacent lanes. Finally, add the protein marker. 6. Connect the power supply to the positive and negative terminals. First, electrophoresis to the separating gel at a constant voltage of 80V, then adjust the voltage to 120V and continue electrophoresis until the bromophenol blue is close to the bottom of the gel. Stop electrophoresis at the appropriate time. 7. Turn off the power and remove the glass plate. Carefully remove the gel plate from the glass plate and place it on filter paper soaked in transfer buffer. Cover it with a PVDF membrane soaked in methanol, completely removing any air bubbles between the gel and the membrane. Clamp it with the transfer clamps and place it on the transfer apparatus with the electrodes facing out. Connect the power supply to a constant current of 300mA for 95 minutes. 8. After the transfer is complete, remove the PVDF membrane, face up, and place it in 5% skim milk for 1-2 hours, gently shaking. 9. Then wash the skim milk with TBST and incubate with the corresponding primary antibody (dilution ratio 1:1000) at 4°C overnight. 10. Wash with TBST 5 times, 7 minutes each time. 11. Incubate the HRP-labeled secondary antibody corresponding to the primary antibody at room temperature for 1 hour, then wash five times with TBST for 7 minutes each time. 12. Detect the protein bands using ECL chemiluminescence buffer.

[0068] (IV) Experimental Results

[0069] See Figure 4 Two days after osteoclast induction, macrophages without Lipofermata treatment, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control gene, highly expressed osteoclast differentiation-related proteins, such as activated T cell nuclear factor 1 (NFATc1), proto-oncogenes, AP-1 transcription factor subunit (c-Fos), and tartrate-resistant acid phosphatase 5 (ACP5). After treatment with different concentrations of Lipofermata, the expression of osteoclast differentiation-related proteins in macrophages decreased compared to the osteoclast-induced group alone, and the expression of these proteins decreased with increasing Lipofermata concentration.

[0070] (V) Experimental Conclusions

[0071] Lipofermata can inhibit the expression of osteoclast differentiation proteins in vitro, thus playing a role in preventing and treating osteoporosis.

[0072] Example 5: Preparation of Lipofermata Tablets

[0073] Preparation process: Hydroxypropyl methylcellulose is dissolved in an appropriate amount of water to prepare a 5% solution. Lactose is dissolved in the hydroxypropyl methylcellulose solution as a binder solution. Lipofermata is ground and passed through a 100-mesh sieve, then mixed with microcrystalline cellulose and granulated using the binder. The obtained granules are then mixed with magnesium stearate until homogeneous, and compressed into tablets using a tableting machine to obtain Lipofermata tablets.

[0074] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.

Claims

1. The use of Lipofermata in the preparation of drugs for the prevention and treatment of osteoporosis.

2. The application according to claim 1, characterized in that, Lipofermata is the sole active ingredient in the drug.

3. The application according to claim 1, characterized in that, Lipofermata may be used alone or in the form of a pharmaceutical composition comprising a therapeutically effective amount of Lipofermata or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

4. The application according to claim 3, characterized in that, The pharmaceutically acceptable salt is a phosphate.

Images