A primer pair and kit for detecting American eel adenomas virus
By designing specific primer pairs and kits combined with PCR technology, the problem of difficult diagnosis of adenomavirus in the American eel was solved, rapid and accurate detection was achieved, the risk of viral infection was reduced, and effective prevention and control measures were provided.
Patent Information
- Application Number
- CN202310765027.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-27
- Publication Date
- 2025-01-07
- Estimated Expiration
- 2043-06-27
AI Technical Summary
There is a lack of effective viral disease prevention and control measures in American eel farming, especially the "hemorrhagic gill rot" epidemic, which is difficult to distinguish from symptoms caused by bacteria and parasites, resulting in diagnosis difficulties and economic losses.
Design and provide specific primer pairs and kits for detecting American eel adenomavirus (AEAdoV). Combined with PCR technology, specific primer pairs and reaction conditions are detected to ensure a fast and accurate diagnosis.
It realizes rapid and accurate detection of AEAdoV, reduces the risk of hidden transmission of viral infection, provides early prevention and control measures, and has high detection specificity, avoiding cross-reaction with other viruses.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to a primer pair and a kit for detecting American eel adenomas virus. Background Art
[0002] Fujian Province is a major province for eel farming, and the output value of eels occupies an important position in the aquatic product trade in Fujian Province. Since 2015, American eels have become the main species of eels farmed in Fujian Province. The pathogens of eel diseases include viruses, bacteria, parasites, etc., among which there is a lack of effective prevention and control measures for viral diseases. When such diseases break out, they often show a trend of large-scale regional transmission, causing huge economic losses to the farming industry. "Hemorrhagic gill rot" is a relatively common infectious disease in farmed American eels in recent years. It is highly contagious, lasts for a long time, and has a high cumulative mortality rate. The apparent symptoms of sick eels with this disease are not obvious, and the main pathological changes are densely covered with pinpoint-sized hemorrhages on the gill filaments. In our previous research, we isolated a new virus from the "hemorrhagic gill rot" diseased eels, named American Eel Adomavirus (AEAdoV). This is the first time in the world that AEAdoV has been isolated and identified.
[0003] AEAdoV is a non-enveloped linear double-stranded DNA virus belonging to the order Rowavirales, family Adomaviridae, subfamily Beta-adomaviruses. Studies have shown that AEAdoV and other members of the subfamily Beta-adomaviruses encode superfamily 3 helicases (S3H) genes, and are genetically most closely related to marbled eel adomavirus (MEAdoV), and more distantly related to other adomaviruses.
[0004] The clinical symptoms of "hemorrhagic gill rot" caused by AEAdoV are similar to those of "gill rot" caused by bacteria and parasites, and are difficult to distinguish clinically. PCR-based molecular biological detection is convenient, fast, highly specific, and highly accurate, and is commonly used for the diagnosis of viral diseases. The present invention intends to provide a PCR primer pair, a kit, and a detection method for detecting AEAdoV based on the genome sequence characteristics of AEAdoV, which provides a new means for rapid and accurate diagnosis of AEAdoV, and is conducive to early detection of viral infection and taking active prevention and control measures as soon as possible. Summary of the invention
[0005] The purpose of the present invention is to provide a primer pair and a kit for detecting American eel adenomas virus.
[0006] To achieve the above object, the present invention adopts the following technical solution:
[0007] A primer pair for detecting American eel adenomatous virus (AEAdoV), the nucleotide sequence of the primer pair is as follows: AEAdoVFW: 5'-CACGCCTTCTCACAGATCCA-3',
[0008] AEAdoVRW:5'-TGGCGTACTCTATCGAGCCT-3'.
[0009] The invention discloses an application of the above primer pair in preparing a product for detecting American eel adenomas virus.
[0010] A kit containing the above primer pair.
[0011] Furthermore, the above kit also includes a positive control DNA.
[0012] Further, the positive control DNA is a recombinant plasmid comprising the following nucleotide sequence: CACGCCTTCTCACAGATCCACGGGCGCTCGTATTTGCTGCACTATGCAGTTCACTTACCACGGTCGACACGGAGACTGGGCTCTCTTTATTCCAGCCGCCTTTTTGGCCTGCAAAAGATGACCCGGTGTTCGCTGACAAGCTTGACCTTTTGACCGCTAGAATGTTTGCCCTTGACACTGATGCAGTTGACGCACATTTGGAAGGTATGGATGATGCGTTTGGGCCTCCTGACCCCGTTCTGAAGCCGATCACTGAGGATAGGCCGGGACGCAGGAGGCTCGATAGAGTACGCCA.
[0013] A PCR method for detecting American eel adenomas virus for non-disease diagnosis purposes, which uses the genomic DNA of the sample to be detected as a template and uses the primer pair as claimed in claim 1 to carry out a PCR reaction.
[0014] Furthermore, the program of the above PCR reaction is: 95°C for 5 minutes; 95°C for 30 seconds, 56°C for 30 seconds, 72°C for 20 seconds, 30 cycles; 72°C for 7 minutes.
[0015] Furthermore, the system of the above PCR reaction is: 1 μL of template, 12.5 μL of 2×TaqMasterMix, 1 μL each of AEAdoV FW and AEAdoVRW, and ddH2O is added to make up to 25 μL.
[0016] Furthermore, 10 μL of the PCR product was electrophoresed using 1.5% agarose gel electrophoresis. If the electrophoresis result showed an amplified band at the 295 bp position, it indicated that AEAdoV was present in the diseased sample. If no amplified band was visible at the above position, it indicated that the above virus was not present in the diseased sample. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 This is the amplification result of AEAdoVFW / RW on American eel adenoma virus. Lane M: DL600 standard molecular weight marker; Lane 1: American eel adenoma virus; Lane 2: negative control.
[0018] Figure 2 This is the specific detection result of AEAdoVFW / RW. Lane M: DL600 standard molecular weight marker; Lane 1: American eel adenomas virus; Lane 2: positive control; Lane 3: frog iris virus; Lane 4: eel herpes virus; Lane 5: white spot syndrome virus; Lane 6: koi herpes virus; Lane 7: negative control.
[0019] Figure 3 This is the sensitivity test result of AEAdoVFW / RW. Lane M: DL600 standard molecular weight marker; Lane 1: 10 8 Copies / μL; Lane 2: 10 7 Copies / μL; Lane 3: 10 6 Copies / μL; Lane 4: 10 5 Copies / μL; Lane 5: 10 4 Copies / μL; Lane 6: 10 3 Copies / μL; Lane 7: 10 2 Copies / μL; Lane 8: 10 1 Copies / μL; Lane 9: 10 0 copies / μL; Lane 10: negative control.
[0020] Figure 4 These are the clinical sample test results of AEAdoVFW / RW. DETAILED DESCRIPTION
[0021] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.
[0022] Example 1 Establishment of a method for detecting anguilla adenomatous virus
[0023] (1) Primer design and optimization
[0024] The American eel adenomatous virus (AEAdoV) was isolated and identified, and its genome was sequenced and analyzed for homology. Four pairs of primers were designed in the conserved region, and the size of the amplified product was set at about 300 bp. The AEAdoV genomic DNA isolated and cultured from cells was used as a template for PCR amplification, and the amplified product was analyzed by gel electrophoresis to screen out the highly specific primer pair AEAdoVFW / RW. After sequencing, AEAdoVFW / RW amplified the nucleotide fragment shown below for AEAdoV: CACGCCTTCTCACAGATCCACGGGCGCTCGTATTTGCTGCACTATGCAGTTCACTTACCACGGTCGACACGGAGACTGGGCTCCTTTATTCCAGCCGCCTTTTTGGCCTGCAAAAGATGACCCGGTGTT CGCTGACAAGCTTGACCTTTTGACCGCTAGAATGTTTGCCCTTGACACTGATGCAGTTGACGCACATTTGGAAGGTATGGATGATGCGTTTGGGCCTCCTGACCCCGTTCTGAAGCCGATCACTGAGGATAGGCCGGGACGCAGGAGGCTCGATAGAGTACGCCA.
[0025] Among them, the AEAdoVFW / RW nucleotide sequence is as follows:
[0026] AEAdoVFW:5'-CACGCCTCTCACAGATCCA-3',
[0027] AEAdoVRW:5'-TGGCGTACTCTATCGAGCCT-3'.
[0028] The PCR reaction system was: 1 μL AEAdoV genomic DNA template, 12.5 μL 2×TaqMasterMix, 1 μL AEAdoVFW / RW, and ddH2O was added to make up to 25 μL.
[0029] The PCR reaction conditions were as follows: 95°C for 5 minutes; 95°C for 30 seconds, 56°C for 30 seconds, 72°C for 20 seconds, 30 cycles; 72°C for 7 minutes.
[0030] Take 10 μL of PCR product, run it through 1.5% agarose gel electrophoresis, and observe and take pictures with a gel imaging system. The results show ( Figure 1 ), AEAdoVFW / RW can successfully detect American eel adenoma virus, and the present invention successfully establishes a PCR detection method for American eel adenoma virus.
[0031] Example 2 Specific detection of American eel adenomas virus
[0032] In order to investigate the specificity of the present invention, this example uses American eel adenomas virus (AEAdoV), frog iris virus (RGV), eel herpes virus (AngHV), white spot syndrome virus (WSSV), koi herpes virus (KHV) group DNA as templates, and sets negative and positive controls, and performs PCR amplification according to the reaction conditions and system in Example 1.
[0033] Among them, the negative control was ddH2O.
[0034] Among them, the positive control is: as in Example 1, AEAdoVFW / RW is used to perform PCR amplification on AEAdoV genomic DNA, the PCR product is cut and recovered and purified, and connected to the pCE2-TA / Blunt plasmid (preserved by the Institute of Biotechnology, Fujian Academy of Agricultural Sciences) to obtain a positive control.
[0035] The results show that Figure 2 ), AEAdoVFW / RW only amplified specific bands for American eel adenomatous virus and positive control, and other samples were negative. This proves that the present invention has good specificity and has no cross reaction with other pathogens.
[0036] Example 3 Sensitivity test of American eel adenomatous virus
[0037] As in Example 1, AEAdoVFW / RW was used to perform PCR amplification on AEAdoV genomic DNA, the PCR product was cut and recovered and purified, and ligated to pCE2-TA / Blunt plasmid to obtain a positive control, which was diluted 10 times, and the diluted sample was used as a template for PCR reaction. The concentration of the positive control template was from high to low: 10 8 Copies / μL~10 0 copies / μL, 9 gradients in total.
[0038] The results show that Figure 3 ), the detection limit of American eel adenomas virus is 10 2 copies / μL.
[0039] Example 4 Detection experiment of clinical samples
[0040] The PCR detection method constructed in Example 1 was used to detect 24 clinical samples.
[0041] The results show that Figure 4 ), of which 17 were AEAdoV positive and 7 were AEAdoV negative.
[0042] Although the above embodiments have been described, once the technical personnel in the field know the basic creative concepts, they can make other changes and modifications to these embodiments. Therefore, the above description is only an embodiment of the present invention, and it does not limit the patent protection scope of the present invention. Any equivalent structure or equivalent process transformation made by using the contents of the specification and drawings of the present invention, or directly or indirectly used in other related technical fields, is also included in the patent protection scope of the present invention.
Claims
1. A primer pair for detecting American eel adenomatous virus, characterized in that: The nucleotide sequence of the primer pair is as follows: AEAdoV FW: 5'-CACGCCTCTCACAGATCCA-3', AEAdoV RW: 5'-TGGCGTACTCTATCGAGCCT-3'.
2. Use of the primer pair as claimed in claim 1 in preparing a product for detecting American eel adenomatous virus.
3. A kit comprising the primer pair according to claim 1.
4. The kit according to claim 3, characterized in that: The kit also includes a positive control DNA.
5. The kit according to claim 4, characterized in that: The positive control DNA is a recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO.
3.
6. A PCR method for detecting anguilla adenomatous virus for non-disease diagnosis purposes, characterized in that: The genomic DNA of the sample to be detected is used as a template and a PCR reaction is performed using the primer pair as claimed in claim 1.
7. The PCR method according to claim 6, characterized in that: The PCR reaction program was: 95°C for 5 minutes; 95°C for 30 seconds, 56°C for 30 seconds, 72°C for 20 seconds, 30 cycles; 72°C for 7 minutes.
8. The PCR method according to claim 6, characterized in that: The PCR reaction system is: 1 μL of template, 12.5 μL of 2×Taq Master Mix, 1 μL each of AEAdoV FW and AEAdoV RW, and ddH2O is added to make up to 25 μL.