Use of ythdc1 inhibitors in the preparation of a medicament for preventing preterm birth
By using a YTHDC1 inhibitor to regulate its expression in placental trophoblasts, the problem of the lack of effective interventions for preterm birth was solved, achieving the effect of delaying preterm birth and reducing the risk of preterm birth.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE INTERNATIONAL PEACE MATERNITY & CHILD HEALTH HOSPITAL OF CHINA WELFARE INSTITUTE
- Filing Date
- 2023-08-21
- Publication Date
- 2026-04-14
AI Technical Summary
Current technologies lack effective specific interventions to prevent and treat preterm birth, which leads to neonatal complications and adverse long-term outcomes. YTHDC1 expression levels in preterm placentas are significantly higher than in term placentas, and it is involved in trophoblast dysfunction.
YTHDC1 inhibitors, including small molecule compounds that specifically inhibit YTHDC1, interfering molecules, gene editing reagents, and antibodies, are used to specifically regulate YTHDC1 expression in placental trophoblasts through RNA interference technology, affecting their proliferation, apoptosis, and migration abilities, and prolonging the time to delivery.
By reducing placental YTHDC1 expression, the occurrence of preterm birth was delayed, providing a possibility for clinical treatment of preterm birth, significantly prolonging the delivery time in animal models, and reducing the risk of preterm birth.
Smart Images

Figure CN116898975B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to the application of YTHDC1 inhibitors in the preparation of drugs for preventing and treating premature birth. Background Technology
[0002] Premature birth, defined as delivery between 28 and 37 weeks of gestation, is the leading cause of neonatal death, accounting for approximately 35% of all neonatal deaths worldwide, posing a serious threat to children's health. Premature birth can cause various neonatal complications, including asphyxia, respiratory distress syndrome, brain injury, bronchopulmonary dysplasia, retinopathy of prematurity, and feeding intolerance. Furthermore, premature birth can lead to adverse long-term outcomes for offspring, such as increased risk of cognitive, social-emotional, and learning disabilities in adulthood. The smaller the gestational age, the higher the risk of developmental defects, motor, cognitive, and socio-emotional developmental disorders. Currently, prevention and treatment methods for premature birth mainly include progesterone therapy, cervical cerclage, and cervical pessaries, but effective specific interventions are still lacking. Therefore, finding specific and effective treatments for premature birth is of significant clinical importance.
[0003] RNAm 6 The A modification involves inserting a methyl group at the 6th nitrogen atom of adenine, and it is the most abundant RNA modification in eukaryotes. 6 A modification is mainly mediated by methyltransferases, demethylases, and reading proteins. YTHDC1 is m 6 A is an important type of reading protein, belonging to the YTH domain family, mainly using m 6 YTHDC1 regulates RNA splicing, selective polyadenylation, nuclear export, and chromatin-related regulation of RNA degradation in an A-dependent manner. Numerous studies have confirmed that YTHDC1 plays a crucial role in many biological processes and disease progression, participating in the development of various diseases such as leukemia, inflammatory bowel disease, lung cancer, liver cancer, bladder cancer, and breast cancer. YTHDC1 also participates in the development of spermatogonia in male mice and the maturation of oocytes in female mice. However, previous research reports on the involvement of YTHDC1 in the occurrence and development of preterm birth have not been found. The inventors' previous research found that compared with term placentas, the expression level of YTHDC1 was significantly increased in preterm placental samples, and YTHDC1 was localized in placental trophoblasts. Abnormal trophoblast function is closely related to the occurrence of preterm birth; therefore, it is hypothesized that YTHDC1 plays an important role in the occurrence and development of preterm birth.
[0004] RNA interference (RNAi) is a method of post-transcriptional gene silencing using short double-stranded RNA composed of nucleotides. It can efficiently and specifically block the expression of target genes in vivo and has become a commonly used technique in recent years for studying gene function and finding treatments for diseases. Animal siRNA employs special chemical modifications, which greatly improves its serum stability while maintaining its high activity, resulting in good safety, high cost-effectiveness, and closer applicability to clinical applications. Because siRNA acts directly on specific RNA targets, it has high disease targeting specificity and has been widely used in diseases such as breast cancer, lung cancer, liver cancer, and colorectal cancer. However, there are currently no reports of siRNA being used in the treatment of premature birth. Summary of the Invention
[0005] To overcome the shortcomings of the prior art, the present invention provides the application of YTHDC1 inhibitors in the preparation of drugs for preventing and treating preterm birth, wherein the drug uses the YTHDC1 gene as a target for placental trophoblast cells.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] The first aspect of the present invention is to provide the use of YTHDC1 inhibitors in the preparation of medicaments for the prevention and treatment of preterm birth.
[0008] Furthermore, the aforementioned YTHDC1 inhibitor is selected from one or more of the following:
[0009] Small molecule compounds that specifically inhibit YTHDC1;
[0010] Interfering molecules that specifically interfere with the expression of the YTHDC1 gene;
[0011] Gene editing reagents that specifically knock out the YTHDC1 gene;
[0012] Antibodies or ligands that specifically bind to the protein encoded by the YTHDC1 gene.
[0013] Furthermore, the aforementioned YTHDC1 inhibitor is siRNA.
[0014] Furthermore, the target gene sequence of the above-mentioned siRNA is SEQ ID No.3 to SEQ ID No.5, preferably SEQ ID No.3 or SEQ ID No.5.
[0015] A second aspect of the present invention is to provide a medicament for preventing premature birth, comprising a YTHDC1 inhibitor.
[0016] Furthermore, the aforementioned YTHDC1 inhibitor is selected from one or more of the following:
[0017] Small molecule compounds that specifically inhibit YTHDC1;
[0018] Interfering molecules that specifically interfere with the expression of the YTHDC1 gene;
[0019] Gene editing reagents that specifically knock out the YTHDC1 gene;
[0020] Antibodies or ligands that specifically bind to the protein encoded by the YTHDC1 gene.
[0021] Furthermore, the above-mentioned YTHDC1 inhibitor is siRNA, and its target gene sequence is preferably SEQ ID No. 3 to SEQ ID No. 5, more preferably SEQ ID No. 3 or SEQ ID No. 5.
[0022] A third aspect of the present invention is to provide the use of YTHDC1 inhibitors in the preparation of medicaments that inhibit the proliferation, migration and invasion of placental trophoblasts and promote apoptosis of placental trophoblasts.
[0023] Furthermore, the aforementioned YTHDC1 inhibitor is selected from one or more of the following:
[0024] Small molecule compounds that specifically inhibit YTHDC1;
[0025] Interfering molecules that specifically interfere with the expression of the YTHDC1 gene;
[0026] Gene editing reagents that specifically knock out the YTHDC1 gene;
[0027] Antibodies or ligands that specifically bind to the protein encoded by the YTHDC1 gene.
[0028] Furthermore, the above-mentioned YTHDC1 inhibitor is siRNA, and its target gene sequence is preferably SEQ ID No. 3 to SEQ ID No. 5, more preferably SEQ ID No. 3 or SEQ ID No. 5.
[0029] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:
[0030] This invention addresses the significant increase in human YTHDC1 gene expression in preterm placental tissue compared to term placenta. It involves constructing a stable overexpression cell line targeting the human YTHDC1 gene and designing specific siRNAs to specifically increase or decrease YTHDC1 expression in human placental trophoblast cells, thereby promoting or inhibiting cell proliferation, apoptosis, migration, and invasion. Furthermore, in animal models, injection of an in vivo biological agent that interferes with YTHDC1 gene expression reduces YTHDC1 expression in the placenta, prolonging labor and thus delaying preterm birth. This invention provides a potential avenue for the development of clinically applicable drugs for the treatment of preterm birth based on the YTHDC1 gene, demonstrating significant application value and promising prospects. Attached Figure Description
[0031] Figure 1 The results of validating the interference and overexpression efficiency of YTHDC1 in feeder cells are shown. Figures A and B show the mRNA expression levels of YTHDC1 in HTR8 / Svneo and JAR cells under different treatment groups, respectively; Figures D and E show the protein expression levels of YTHDC1 in HTR8 / Svneo and JAR cells under different treatment groups, respectively; Figures C and F show the mRNA and protein expression levels of YTHDC1 in control and overexpression-treated JAR cells, respectively.
[0032] Figure 2 The cell growth curves are shown after knockdown (Figure A, B) or overexpression (Figure C) of the YTHDC1 gene.
[0033] Figure 3 The results of cell proliferation experiments after knocking down YTHDC1 expression are shown. Figure A shows that DNA synthesis in HTR-8 / SVneo cells was significantly reduced after YTHDC1 knockdown compared to the control group. Figure B shows that DNA synthesis in JAR cells was significantly reduced after YTHDC1 knockdown compared to the control group. Figure C shows the quantitative results of HTR-8 / SVneo and JAR cells.
[0034] Figure 4 The flow cytometry results of apoptosis after knockdown of YTHDC1 expression are shown in Figure A and the corresponding statistical graph (Figure B).
[0035] Figure 5 The results of cell migration (Figure A) and invasion (Figure B) after YTHDC1 knockdown;
[0036] Figure 6 The results of cell migration and invasion experiments after overexpression of YTHDC1 (Figure A) and the corresponding statistical graphs (Figures B and C);
[0037] Figure 7Figure 1 shows the experimental results of the effect of YTHDC1 knockdown on the time of labor onset in a preterm animal model; Figure A is a schematic diagram of the in vivo intervention experiment in animals; Figure B shows the protein expression level of YTHDC1 in the mouse placenta; Figure C shows the average delivery time of pregnant mice. Detailed Implementation
[0038] Based on previous research, the inventors discovered that the expression level of the YTHDC1 gene in preterm placental tissue was significantly higher than that in full-term placenta. Upregulating or downregulating the expression of the human YTHDC1 gene using overexpression or RNAi methods could affect the proliferation, apoptosis, migration, and invasion capabilities of placental trophoblasts. The inventors further synthesized a specific siRNA biological agent for in vivo application that specifically reduces YTHDC1 expression using a phosphorus amide solid-phase synthesis method. Animal models confirmed that this agent could reduce placental YTHDC1 expression and delay the onset of preterm birth. Based on this, the present invention was completed. This research result indicates that the YTHDC1 gene can serve as a therapeutic target for preterm birth.
[0039] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings to enable a better understanding of the invention. However, the following embodiments do not limit the scope of the invention.
[0040] Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared according to conventional methods, unless otherwise specified.
[0041] Example 1: Establishment of a stable cell line overexpressing YTHDC1
[0042] 1. First, primers were designed based on the CDS sequence of the YTHDC1 gene for PCR amplification of the target gene. The specific sequences are as follows:
[0043] Forward primer YTHDC1-OE-F:
[0044] AGAAGATTCTAGAGCTAGCGATGGCGGCTGACAGTCGG (SEQ ID No. 1);
[0045] Reverse primer YTHDC1-OE-R:
[0046] GCAGATCCTTCGCGGCCGCGTTATCTTCTATATCGACCTCTCT (SEQ ID No. 2).
[0047] 2. Obtaining the target gene fragment
[0048] Total RNA was extracted from JAR cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. 500 ng of RNA was then reverse transcribed into complementary DNA (cDNA) using the reverse transcription system shown in Table 1 below. The reverse transcription program was as follows: 37℃, 20 min, 85℃, 30 s, 4℃, ∞.
[0049] Table 1 Reverse transcription reaction system
[0050] system Volume (μL) RNA 5 Reverse transcriptase (5×Evo M-MLV) 2 <![CDATA[ddH2O]]> 3 Total volume 10
[0051] The primers synthesized by Sangon Biotech (Shanghai) Co., Ltd. were dissolved in ddH2O to prepare a 10 μM solution. The 50 μL PCR reaction system is shown in Table 2 below. The PCR amplification products were obtained. The PCR reaction conditions were set as follows: 98℃, 5 min; 98℃, 10 s, 60℃, 10 s, 72℃, 2 min 30 s, 30 cycles; 72℃, 8 min; 4℃, 10 min.
[0052] Table 2 PCR reaction system
[0053]
[0054]
[0055] A 1% agarose gel was prepared, and the size of the target fragment (2184 bp) was observed by electrophoresis. The target fragment was excised under UV light. The target fragment was ligated into the pCDH-CMV-MCS-EF1-Puro vector using homologous recombinase from Nanjing Novizan Biotechnology Co., Ltd. (EcoRI and BamHI digestion). The ligation product was heat-shocked and transformed into E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C with inverted incubation. Single clones were picked and cultured in liquid LB agar containing ampicillin at 37°C with shaking for 18 h. The plasmid was extracted for double enzyme digestion identification (EcoRI and BamHI), and positive clones were sequenced for verification. The positive target plasmid was amplified in E. coli.
[0056] Lentiviral preparation was carried out by transfecting 293T cells with the target plasmid using liposomes. The medium was changed 8 hours after transfection, and the lentivirus was harvested 48 hours later. The fresh viral solution was used to infect JAR feeder cell lines. 4 μg / mL polybrene was added half an hour in advance to improve the infection efficiency. Positive cells were screened with puromycin 72 hours after infection until the cells stopped dying.
[0057] Example 2: Verification of YTHDC1 interference and overexpression efficiency in HTR-8 / SVneo and JAR feeder cell lines
[0058] 1. Cell transfection
[0059] The day before transfection, 6-well plates were prepared. Transfection was performed the next day when cells reached 60%-80% confluency. Serum-free medium was divided into two 150 μL portions. One portion was treated with 5 μL of siRNA (siNC or siRNA, with specific target gene sequences shown in Table 3 below), and the other with 5 μL of Lipofectamine RNA iMAX (Thermo Fisher) transfection reagent. After mixing and incubation for 5 min, the two portions were combined. After standing for 20 min, the old medium was discarded, and the mixture was added to the cells. RNA was extracted at 24 h and protein at 48 h after incubation for RT-qPCR and Western Blot analysis to verify transfection efficiency.
[0060] Table 3 siRNA target gene sequences
[0061] name target genes Gene ID target sequence siRNA1 YTHDC1 NM_001031732.4 CAAGGAGTGTTATCTTAAT(SEQ ID No.3) siRNA2 YTHDC1 NM_001031732.4 GGGAAATGATTATGACACT(SEQ ID No.4) siRNA3 YTHDC1 NM_001031732.4 GTATCAGGTCATTCATAAA(SEQ ID No.5)
[0062] 2. RT-qPCR to identify YTHDC1 RNA expression levels
[0063] Total RNA was extracted from cells 24 hours after transfection, and 500 ng of RNA was reverse transcribed into complementary DNA (cDNA) according to the reverse transcription system in Table 1 above.
[0064] Table 4 shows the RT-qPCR reaction system as follows:
[0065] system Volume (μL) cDNA 1 SYBR (2× including ROX) 10 upstream primer 0.5 Downstream primer 0.5 <![CDATA[ddH2O]]> 8 Total volume 20
[0066] Then, mix the reaction system components in Table 4 and add them to a 384-well plate; perform the PCR reaction under the following conditions, with the following thermal cycling parameters: 50℃, 2 min; 95℃, 2 min; 95℃, 10 min; 95℃, 15 s, 60℃, 1 min; for a total of 40 cycles. Simultaneously, read the absorbance values and construct a melting curve. Using 2- ΔΔCt The expression level of YTHDC1 mRNA was calculated using analytical methods.
[0067] RT-qPCR analysis revealed that the expression level of YTHDC1 mRNA in the siRNA1 and siRNA3 transfection groups was significantly lower than that in the control group, with an interference efficiency of over 70%, confirming that YTHDC1 mRNA was successfully knocked down in cells (see [link to RT-qPCR]). Figure 1 In the following experiments (A, 1B), siRNA1 is named siYTHDC1-1 and siRNA3 is named siYTHDC1-2.
[0068] 3. Western blot analysis of YTHDC1 protein expression level
[0069] Cells transfected for 48 h were lysed using RIPA lysis buffer. Protein samples were separated by SDS-PAGE and transferred to a PVDF membrane. The PVDF membrane was blocked with TBS containing 5% skim milk powder at room temperature for 1 h, and then incubated overnight with the corresponding primary antibody at 4°C. The next day, the membrane was washed with TBST for 30 min, and then incubated with the corresponding horseradish peroxidase-labeled secondary antibody at 37°C for 1 h. After washing with TBST for 30 min, the immunoreaction bands were detected using enhanced chemiluminescent substrate, and the band intensity was quantified using Image-Pro Plus software.
[0070] Western blotting analysis revealed a significant decrease in the grayscale value of YTHDC1 protein in the siRNA-transfected group compared to the control group, confirming successful knockdown of YTHDC1 protein (see [link to analysis]). Figure 1 D, 1E).
[0071] 4. Similarly, the overexpression effect of the YTHDC1 gene in JAR cells infected with the above-mentioned lentivirus was evaluated. RT-qPCR and Western Blot analysis of YTHDC1 expression levels in JAR cells showed that both the mRNA and protein levels of YTHDC1 in the infected group were significantly higher than those in the control group, confirming the successful construction of a stable YTHDC1 overexpression cell line (see...). Figure 1 C, 1F).
[0072] Example 3 Cell Proliferation Experiment
[0073] 1. CCK-8 experiment:
[0074] The principle behind WST-8, used to determine cell proliferation capacity, is as follows: In the presence of an electron coupling reagent, WST-8 [chemical name: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonylbenzene)-2H-tetrazole monosodium salt] can be reduced by dehydrogenases in mitochondria to generate a highly water-soluble orange-yellow formazan product. The intensity of its color is directly proportional to cell proliferation, and can indirectly reflect the number of live cells.
[0075] Procedure: Take HTR-8 / SVneo and JAR cells in the corresponding logarithmic growth phase, digest them with 0.25% trypsin, and prepare single-cell suspensions using the corresponding complete culture medium containing 10% serum. Calculate the required cell number (HTR-8 / SVneo: DMEM / F12 medium, 2 × 10⁶ cells / year). 3 / well; JAR: DMEM medium, 1.5 × 10⁶ 3 Seeds were seeded into 96-well plates (100 μL / well) and incubated at 37°C with 5% CO2 for 5 days. Detection was performed on days 1, 3, and 5: the supernatant was discarded, and 10% CCK-8 solution was prepared using the appropriate complete culture medium. After incubation at 37°C for 2 hours, the absorbance (OD) value was measured.450 Draw the growth curve.
[0076] The results show that YTHDC1 knockdown inhibited the proliferation of trophoblast cells (see...). Figure 2 A, 2B), while overexpression promoted the proliferation of trophoblast cells (see A, 2B). Figure 2 C).
[0077] 2. EdU (5-ethynyl-2'-deoxyuridine) incorporation experiment:
[0078] EdU is a thymidine nucleoside analog that can replace thymidine nucleoside and be incorporated into replicating DNA molecules during cell proliferation. The detection of cellular DNA replication activity based on the conjugation reaction between EdU and dyes can reflect the cell's proliferative capacity.
[0079] Procedure: 48 h after transfection of HTR-8 / SVneo and JAR cells with siRNA, the cells were digested with 0.25% trypsin at a concentration of 1×10⁻⁶. 4 Cells were seeded into 12-well plates (500 μL / well) and incubated overnight at 37°C with 5% CO2. After 24 h, EdU solution (final concentration 50 μM) was added and incubated at 37°C for 2 h. The culture medium was discarded, and the cells were washed twice with PBS for 5 min each time. 300 μL / well of 4% paraformaldehyde was added for fixation at room temperature for 30 min. The fixative was discarded, and 300 μL / well of 2 mg / mL glycine was added. The cells were incubated on a shaker for 5 min. The glycine solution was discarded, and the cells were washed once with PBS for 5 min. 300 μL of 0.5% Trion X-100 permeabilizer was added, and the cells were incubated at room temperature for 10 min. The permeabilizer was discarded, and the cells were washed once with PBS for 5 min. 300 μL / well of... After incubating the staining reaction solution in the dark at room temperature on a shaker for 30 min, discard the staining reaction solution. Add 300 μL / well of permeabilizer, wash twice on a shaker for 5 min each time, in the dark, discard the permeabilizer, and wash once with PBS for 5 min each time. Add 300 μL / well of 1×Hoechst 33342 staining solution, incubate in the dark at room temperature for 30 min, discard the staining solution, wash three times with PBS for 5 min each time, in the dark, and store at 4℃. Take pictures and count the samples using a fluorescence microscope.
[0080] The results showed that EdU incorporation in YTHDC1 knockdown cells was significantly reduced compared to the control group (see...). Figure 3 A, 3B, 3C).
[0081] Example 4 Apoptosis Experiment
[0082] Forty-eight hours after transfection of HTR-8 / SVneo and JAR cells with siRNA, the culture supernatant was collected, and the cultured cells were washed once with pre-chilled PBS, digested with 0.25% trypsin, and a single-cell suspension was prepared. Cells were collected into centrifuge tubes, and the pre-collected culture supernatant was added. The cells were centrifuged at 1000g for 3 min. The supernatant was discarded, and the cells were washed once with 5 mL of pre-chilled PBS, centrifuged at 1000g for 5 min, and repeated once. Then, 100 μL of 1× binding buffer was added to resuspend the cells. 5 μL of Annexin V-FITC and 10 μL of PI staining solution were added to sample tubes, and the mixture was gently mixed. Control tubes were also prepared (negative control, FITC-stained control, and PI-stained control), with sample treatments of no dye, 5 μL of FITC only, and 10 μL of PI only, respectively. All samples were incubated at 37°C in the dark for 30 min, then 400 μL of 1× binding buffer was added, mixed well, and placed on ice. The apoptosis level was detected by flow cytometry within 1 h, and apoptosis distribution map and statistical graph were plotted.
[0083] The results show that apoptosis was significantly increased in YTHDC1 knockdown cells compared to the control group (see...). Figure 4 A, 4B).
[0084] Example 5 Cell Migration and Invasion Assay
[0085] 1. Cell migration experiment:
[0086] Add 600 μL of complete culture medium containing 10% serum to a 24-well plate, and place a Transwell chamber (8.0 μm pore size) into each well. Take the required number of cells (HTR-8 / SVneo: 8 × 10⁶). 4 / hole; JAR: 5×10 4 The cells were resuspended in the appropriate serum-free medium and seeded into Transwell chambers. After 24 hours, the Transwell chambers were removed, and unmigrated cells were wiped off the inside of the chambers with PBS-moistened cotton swabs. The chambers were then fixed in wells pre-filled with 600 μL of 4% formaldehyde fixative for 20 min. After fixation, the Transwell chambers were placed in ethanol solution pre-filled with 600 μL of 1% crystal violet and incubated at room temperature for 20 min. The chambers were then removed, washed three times with ddH2O, and air-dried. Five fields of view were randomly selected from the "top left," "bottom left," "top right," "bottom right," and "center" orientations, and the values of the five fields of view were taken for statistical analysis.
[0087] Migration assay results showed that, compared with the control group, YTHDC1 knockdown significantly inhibited the migration of trophoblast cells (see...). Figure 5 A), while overexpression promotes trophoblast migration (see A). Figure 6 A, 6B).
[0088] 2. Cell invasion experiment:
[0089] Place the Transwell chambers in 24-well plates, add 60 μL of Matrigel diluted 1:4 to each well, and incubate at 37°C for 2 hours. Subsequent procedures are the same as those for the cell migration experiment described above.
[0090] Invasion assay results showed that, compared with the control group, YTHDC1 knockdown significantly inhibited the invasion of trophoblast cells (see...). Figure 5 B), while overexpression promotes trophoblast invasion (see B). Figure 6 A, 6C).
[0091] Example 6 Animal Intervention Experiment
[0092] 1. Preparation of laboratory animals:
[0093] SPF-grade 6-8 week old C57BL / 6J mice were purchased from Shanghai Lingchang Biotechnology Co., Ltd., and housed in an SPF-grade animal facility. They were provided with free access to food and water, and the environment was kept at a constant temperature of 22–26℃ and a constant humidity of 55–65%.
[0094] 2. Establishment of a preterm birth model:
[0095] After two weeks of acclimatization, C57BL / 6J mice weighing approximately 20g were selected and housed together at a male:female ratio of 1:2. The day a vaginal plug was observed was designated as day 0.5 of gestation (E0.5). At day E15.5, both groups of pregnant mice were subcutaneously injected with mifepristone RU486 (Sigma, M8046) at a dose of 10mg / kg / mouse.
[0096] 3. In vivo intervention experiments:
[0097] according to Figure 7 A. Two groups of pregnant mice were randomly divided into an experimental group and a control group. On day E13.5 (first time), the pregnant mice in both groups were injected intravenously with 10 nmol siYTHDC1 (target gene sequence AGCAGAAAGAAACCAAGGA, SEQ ID No. 6) or siNC (both dissolved in 200 μL of physiological saline, freshly prepared before use). On day E15.5 (second time, injected 1 hour after RU486 injection), the mice were again injected intravenously with 10 nmol siYTHDC1 or siNC. The parturition time of the mice after RU486 treatment was recorded. The parturition time of the pregnant mice was defined as the time from RU486 injection to the birth of the first fetus. The pregnant mice were sacrificed, and the placenta was collected. Tissue proteins were extracted, and the expression level of YTHDC1 protein was detected by Western blotting.
[0098] Figure 7B shows that the expression level of YTHDC1 in the placenta of mice in the experimental group (siYTHDC1) was significantly lower than that in the control group (siNC), confirming the effectiveness of in vivo interference; Figure 7 C showed that the average delivery time of pregnant mice in the control group was 15.86±1.75h, while that in the experimental group was 19.67±4.80h (P=0.024), indicating that the delivery time of pregnant mice in the experimental group was significantly longer than that in the control group.
[0099] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.
Claims
1. The application of YTHDC1 inhibitors in the preparation of drugs for preventing and treating preterm birth, characterized in that, The YTHDC1 inhibitor is siRNA, and the target gene sequence of the siRNA is SEQ ID No. 3 to SEQ ID No.
5.
2. The application according to claim 1, characterized in that, The target gene sequence of the siRNA is SEQ ID No. 3 or SEQ ID No. 5.