Eukaryotic expression vector of pig nono protein and construction method and application thereof

Abstract

The present application belongs to the technical field of protein engineering, and relates to application of a nucleotide sequence in sequence 1 in a sequence list or a pig NONO protein eukaryotic expression vector in preparation of a medicine for inhibiting proliferation of a porcine reproductive and respiratory syndrome virus (PRRSV). The eukaryotic expression vector constructed in the present application can significantly highly express sNONO protein, significantly inhibit proliferation of PRRSV, and can be applied to research on sNONO antiviral effect.

Description

Technical Field

[0001] This invention belongs to the field of protein engineering technology, and more specifically, relates to a eukaryotic expression vector for porcine NONO protein, its preparation method, and its application. Background Technology

[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) belongs to the genus Arterivirus of the family Arteriviridae. It is an enveloped, single-stranded, positive-sense RNA virus. PRRSV infection in pigs causes porcine reproductive and respiratory syndrome (PRRS), a highly contagious disease. Its characteristic manifestations include sows returning to estrus, abortion, stillbirths or weak piglets, piglet mortality, and varying degrees of respiratory symptoms in pigs of all ages. It can also damage the pig's immune system, leading to mixed or secondary infections. Currently, commercially available attenuated vaccines are available for PRRS, but the risks of genetic recombination and virulence reversion remain. Developing antiviral agents to inhibit PRRSV proliferation could provide new ideas and methods for the prevention and control of this disease.

[0003] NONO (Non-POU domain-containing octamer-binding protein) is an octanucleotide-binding protein that does not contain a POU domain. It is a member of the Drosophila behavior / humansplicing (DBHS) family of proteins, also known as p54nrb. NONO proteins participate in various biological processes, such as gene transcription regulation, mRNA precursor splicing, nuclear retention of defective RNA, DNA damage repair, and tumorigenesis.

[0004] Recent studies have shown that after HIV infects host cells, the NONO protein can promote a cGAS-regulated antiviral response, thereby inhibiting HIV replication and proliferation. PRRSV is an RNA virus, and whether the porcine NONO (sNONO) protein inhibits PRRSV replication and proliferation has not been reported in any studies. Summary of the Invention

[0005] The purpose of this invention is to combine existing research progress on host resistance to PRRSV and provide a eukaryotic expression vector containing the antiviral protein sNONO, a construction method, and the application of sNONO protein in inhibiting the proliferation of PRRSV in host cells.

[0006] This invention is obtained through the following steps: A porcine NONO protein eukaryotic expression vector containing the nucleotide sequence of sequence 1 in the sequence listing.

[0007] A method for constructing a eukaryotic expression vector for porcine NONO protein includes the following steps: (1) Design primers for sNONO gene amplification, the sequences of which are as follows: sNONO-F: 5'-CGCGAATTCCCACCATGGATTACAAGGATGACGACGATAAGATGCAGAGCAATAAAACT-3' sNONO-R: 5'-CGCAAGCTTTCATTAGTATCGGCGACGTTTGTTTGGA-3' The porcine NONO gene was obtained through reverse transcription, PCR amplification, and gel recovery. (2) Constructing a eukaryotic expression vector for sNONO protein The pXJ41 vector and sNONO gene were double-digested using EcoRI and HindIII to obtain vector fragment 1 and gene fragment 1. Vector fragment 1 and gene fragment 1 were ligated, and after transformation and plasmid extraction, a recombinant vector was obtained, which is the eukaryotic expression vector for porcine NONO protein.

[0008] The nucleotide sequence of gene fragment 1 is shown in Sequence 1 of the sequence listing.

[0009] The application of a nucleotide sequence in sequence 1 of the sequence listing, or the porcine NONO protein eukaryotic expression vector, or the vector constructed by the construction method, in the preparation of a drug to inhibit the proliferation of porcine reproductive and respiratory syndrome virus.

[0010] This study explores whether the novel antiviral protein sNONO can specifically inhibit PRRSV replication, providing a scientific basis for the development of anti-PRRSV drugs and offering new ideas and methods for the prevention and control of the disease.

[0011] The beneficial effects of this invention are: (1) The FLAG-sNONO eukaryotic expression vector constructed in this invention can significantly overexpress sNONO protein in PAM-KNU cells and can be applied to the study of the antiviral effect of sNONO; (2) PRRSV infection experiments demonstrated that cell lines overexpressing FLAG-sNONO significantly inhibited PRRSV proliferation compared to cell lines transfected with the empty vector pXJ41. The eukaryotic expression vector FLAG-sNONO can be used to study the anti-PRRSV effect. Attached Figure Description Figure 1 Using cDNA from PK-15 cells as a template, a FLAG-tagged sNONO gene fragment was amplified by PCR using designed sNONO-specific primers. The amplified product was detected as a specific amplified fragment of approximately 1413 bp by 1% agarose gel electrophoresis. The obtained plasmid was then verified by double digestion with EcoRI / HindIII, yielding a gene fragment of 1413 bp, consistent with the expected fragment size. Figure A shows the agarose gel identification results of the sNONO gene fragment, where M is the DL2000 Marker, 1 and 2 are the sNONO gene fragments, and 3 is the negative control. Figure B shows the double digestion identification of the constructed plasmid, where M is the DL5000 Marker, 1 is the double digestion identification of the FLAG-sNONO plasmid, and 2 is the negative control of the empty vector plasmid pXJ41. Figure 2 The FLAG-sNONO recombinant plasmid and the empty vector plasmid pXJ41 were transfected into PAM-KNU cells, and the results were verified by Western blotting (A) and indirect immunofluorescence (B). Figure 3 The FLAG-sNONO recombinant plasmid and the empty vector plasmid pXJ41 were injected into PAM-KNU cells, and samples were collected at 12 h, 24 h, 36 h and 48 h after infection with 1 MOI PRRSV, respectively, and the viral cDNA copy number (A) and viral titer (B) were measured. Figure 4 The interference efficiency of siNONO was detected by quantitative real-time PCR (A) and Western blotting (B), respectively. Figure 5 siNONO and siCtrl were transfected into PAM-KNU cells. Samples were collected at 12 h, 24 h, 36 h and 48 h after infection with 1 MOI PRRSV, and the viral cDNA copy number (A) and viral titer (B) were measured. Detailed Implementation

[0012] The technical solution of this application will be described in detail below with reference to specific embodiments.

[0013] Example 1: Construction of eukaryotic expression plasmid FLAG-sNONO 1.1 Primer Design Based on the porcine NONO gene sequence (GenBank No. GACC01000054.1), protective bases were added to the restriction sites on the pXJ41 vector. Primers were designed to amplify the porcine NONO protein-coding gene and clone it into the pXJ41 eukaryotic expression vector to construct the eukaryotic expression plasmid FLAG-sNONO with the FLAG tag.

[0014] The upstream primer for amplifying the NONO gene contains an EcoR I restriction site, and the downstream primer contains a Hind III restriction site. Their sequences are as follows: sNONO-F: 5'-CGCGAATTCCCACCATGGATTACAAGGATGACGACGATAAGATGCAGAGCAATAAAACT-3' sNONO-R: 5'-CGCAAGCTTTCATTAGTATCGGCGACGTTTGTTTGGA-3' 1.2 Construction of FLAG-sNONO recombinant plasmid RNA was extracted from PK-15 cells using the TRIzol method and reverse transcribed using the PrimeScript™ RT reagent Kit with gDNA Eraser to obtain cDNA. The cDNA obtained from reverse transcription was used as a template to amplify sNONO. The reaction mixture consisted of: 1 μL sNONO-F (10 μM), 1 μL sNONO-R (10 μM), and 5× PrimeSTAR Buffer (MgCl₂). 2+ Plus) 10 μL, 1× dNTP Mixture (2.5 mM each) 4 μL, cDNA 100 ng, PrimeSTAR HS DNA Polymerase 0.5 μL, ddH2O to make up to 50 μL.

[0015] After preparing the system, mix thoroughly and briefly incubate. Place it in a PCR instrument for amplification under the following conditions: 98 °C for 2 min; 98 °C for 30 s, 58 °C for 30 s, 72 °C for 1.5 min, 35 cycles; 72 °C for 10 min; store at 4 °C. Perform PCR products on a 1.0% agarose gel electrophoresis and recover the gel. The results are as follows: Figure 1As shown in Figure A, a specific band of the target gene sNONO, measuring 1413 bp, was amplified. The gel-recovered product and the pXJ41 vector were double-digested with EcoRI / Hind III, ligated, and transformed into DH5α competent cells. After overnight incubation at 37 °C, single colonies were picked and inoculated into LB medium containing ampicillin resistance, and incubated overnight at 37 °C and 200 r / min. The plasmid was extracted on the second day, and double-digested with EcoRI / Hind III for identification. The results are shown in Figure A. Figure 1 As shown in Figure B, a specific band of the target gene sNONO was obtained after double enzyme digestion. The correctly identified plasmid was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. Analysis of the sequencing results showed that the correctly sequenced plasmid was the successfully constructed recombinant plasmid FLAG-sNONO.

[0016] Example 2: Expression of the eukaryotic expression vector FLAG-sNONO in host cells 2.1 Western blotting identification PAM-KNU cells were cultured in 6-well plates. When the cell density reached approximately 80%, 2.5 µg of FLAG-sNONO plasmid and the empty vector plasmid pXJ41 were transfected into the cells according to the Lipofectamine® 3000 instructions. After 24 h, the 6-well plates were placed on ice, the supernatant was discarded, and the cells were washed with PBS and lysed with cell lysis buffer. After 20 min, the samples were collected into 1.5 mL EP tubes, centrifuged at 12000 r / min for 10 min at 4 °C, and the supernatant was collected and mixed with an appropriate amount of loading buffer. The mixture was then boiled for 10 min for protein expression assessment.

[0017] Samples were subjected to SDS-PAGE gel electrophoresis and transferred onto an NC membrane. Blocking was performed with 5% skim milk at room temperature for 2 h. Primary antibodies against mouse anti-FLAG and mouse anti-β-actin were used as primary antibodies, followed by overnight incubation at 4 °C. Incubation was then performed at room temperature with HRP-labeled goat anti-mouse secondary antibody for 1 h. Developing was achieved using ECL Plus luminescent buffer, and exposure was performed using a BIO-RAD gel imaging system. Results are shown below. Figure 2 As shown in Figure A, a specific band corresponding to the size of the sNONO protein was detected.

[0018] 2.3 IFA Validation PAM-KNU cells were cultured in 12-well plates. When the cell density reached approximately 80%, 1.0 µg of FLAG-sNONO plasmid and the empty vector plasmid pXJ41 were transfected into the cells. After 18 h, the supernatant was discarded, and the cells were washed with PBS, fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton 100 for 10 min, and then blocked with 3% BSA for 30 min. Mouse anti-FLAG antibody was used as the primary antibody and incubated at room temperature for 1 h. Alexa Fluor 594-labeled goat anti-mouse IgG (H+L) antibody was used as the secondary antibody and incubated at room temperature in the dark for 1 h, followed by DAPI incubation at room temperature for 10 min. The results were observed under a fluorescence microscope. Figure 2 As shown in Figure B, specific fluorescence of the target protein sNONO was detected.

[0019] Example 3: Identification of antiviral activity of sNONO overexpression 3.1 Effect of sNONO overexpression on viral copy number PAM-KNU cells were cultured in 12-well plates. When the cell density reached approximately 80%, they were transfected with the FLAG-sNONO plasmid and the empty vector plasmid pXJ41, respectively. After 24 h, they were infected with 1 MOI PRRSV. Cells and supernatants were collected at 12 h, 24 h, 36 h, and 48 h post-infection. RNA was extracted from the collected cells using the TRIzol method, and the RNA was reverse transcribed. Using the reverse-transcribed cDNA as a template and PRRSV-NF and PRRSV-NR as primers, quantitative real-time PCR was performed to detect the PRRSV copy number in the samples. A standard curve was plotted using plasmid pXJ41-N (containing the PRRSV N protein gene, preserved in our laboratory) as a template and PRRSV-NF and PRRSV-NR as primers. The results are as follows: Figure 3 As shown in Figure A, the cDNA copy number of PRRSV was significantly reduced when NONO protein was overexpressed.

[0020] The primers used for quantitative real-time PCR are: PRRSV-NF: 5'-AATAACAACGGCAAGCAGCAG-3' PRRSV-NR: 5'-CCTCTGGACTGGTTTTGTTGG-3' 3.2 Determination of viral titer MARC-145 cells were cultured in 96-well plates. When the cell density reached approximately 90%, the cell supernatant from step 3.1 was serially diluted 10-fold. -1 Up to 10 -10Discard the cell supernatant from the 96-well plate. Add the virus solution of each dilution to the 96-well plate, performing six replicates for each gradient. Observe the lesion condition daily. Once the lesion stabilizes, calculate the TCID of the virus using the Reed-Muench method. 50 The result is as follows Figure 3 As shown in Figure B, the viral titer of PRRSV was significantly reduced when NONO protein was overexpressed.

[0021] Example 4: Identification of antiviral activity of interfering with endogenous NONO 4.1 Detection of sNONO small interfering RNA synthesis and its interference efficiency Interference sequences siNONO and siCtrl were designed to target sNONO. The siRNAs were synthesized by Beijing Qingke Biotechnology Co., Ltd. The siRNA sequences are as follows: siNONO-F:5'-CCAGAAUGAAGGCUUAACUTT-3' siNONO-R:5'-AGUUAAGCCUUCAUUCUGGTT-3' PAM-KNU cells were seeded into 24-well plates. When the cell density reached 80%, the cells were cultured according to the Lipofectamine protocol. ® Following the instructions of the RNAiMAXReagent manual, siRNA was transduced into cells and cultured in a CO2 incubator for 24 h. Cell samples were then collected. RNA was extracted using the TRIzol method and reverse transcribed. Using the reverse-transcribed cDNA as a template, quantitative real-time PCR was performed using two primer pairs, sNONO and β-actin, to detect the interference efficiency of siNONO on the transcriptional level of the sNONO gene. The results are as follows: Figure 4 As shown in Figure A, after transfection with siNONO, the mRNA level of NONO in cells was significantly reduced. Cells were lysed with cell lysis buffer, centrifuged at 12000 r / min for 10 min at 4 ℃, and the supernatant was collected, mixed with an appropriate amount of loading buffer, and boiled for 10 min. This mixture was used to detect the interference efficiency of siNONO on sNONO protein levels. The results are shown in Figure A. Figure 4 As shown in Figure B, the protein level of NONO in cells was significantly reduced after transfection with siNONO.

[0022] The primers used for quantitative real-time PCR are: sNONO-F: 5'-AGCGGAGATTGCCAAAGTG-3' sNONO-R:5'-GGAAGGTTTCGGACCGTAAG-3' β-actin-F: 5'-TCTGGCACCACACCTTCT-3' β-actin-R: 5'-GATCTGGGTCATCTTCTCAC-3' 4.2 The effect of interfering with endogenous sNONO on viral copy number PAM-KNU cells were cultured in 12-well plates. When the cell density reached approximately 80%, they were transfected with siNONO and the negative control siCtrl, respectively. After 24 h, they were infected with 1 MOI PRRSV. Cells and supernatant were collected at 12 h, 24 h, 36 h, and 48 h post-infection. RNA was extracted from the collected cells using the TRIzol method and reverse transcribed. The viral copy number was detected using quantitative real-time PCR with the resulting cDNA as a template (method as described in section 3.1). Results are as follows. Figure 5 As shown in Figure A, the viral copy number increased significantly after transfection with siNONO.

[0023] 4.3 Determination of viral titer MARC-145 cells were cultured in 96-well plates. When the cell density reached approximately 90%, the cell supernatant from section 4.2 was serially diluted 10-fold. -1 Up to 10 -10 Discard the cell supernatant from the 96-well plate. Add the virus solution of each dilution to the 96-well plate, performing six replicates for each gradient. Observe the lesion condition daily. Once the lesion stabilizes, calculate the TCID of the virus using the Reed-Muench method. 50 The result is as follows Figure 5 As shown in Figure B, the viral titer increased significantly after transfection with siNONO.

[0024] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the embodiments. Any changes, modifications, combinations, substitutions, or simplifications made without departing from the spirit and principle of the present invention should be considered as equivalent substitutions and are included within the protection scope of the present invention.

Claims

1. The application of porcine NONO protein eukaryotic expression vector in the preparation of drugs to inhibit the proliferation of porcine reproductive and respiratory syndrome virus, characterized in that, The vector contains the nucleotide sequence of the sNONO gene as shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The method for constructing the porcine NONO protein eukaryotic expression vector includes the following steps: (1) Design primers for sNONO gene amplification, the sequence of which is as follows: sNONO-F: 5'-CGCGAATTCCCACCATGGATTACAAGGATGACGACGATAAGATGCAGAGCAAT AAAACT-3', sNONO-R:5'-CGCAAGCTTTCATTAGTATCGGCGACGTTTGTTTGGA-3', The gel-extracted product of the sNONO gene was obtained through reverse transcription, PCR amplification, and gel extraction. (2) Constructing a eukaryotic expression vector for porcine NONO protein The gel recovery products of the pXJ41 vector and the sNONO gene were double-digested using EcoRI and HindIII to obtain vector fragment 1 and gene fragment 1. Vector fragment 1 and gene fragment 1 were ligated, and after transformation and plasmid extraction, a recombinant vector was obtained, which is the eukaryotic expression vector of porcine NONO protein.

3. The use of porcine NONO protein eukaryotic expression vector in the preparation of a vector that reduces the viral titer of porcine reproductive and respiratory syndrome virus. Its application in pharmaceuticals is characterized by, The vector contains the nucleotide sequence of the sNONO gene as shown in SEQ ID NO.

1.

4. The application according to claim 3, characterized in that, The method for constructing the porcine NONO protein eukaryotic expression vector includes the following steps: (1) Design primers for sNONO gene amplification, the sequence of which is as follows: sNONO-F: 5'-CGCGAATTCCCACCATGGATTACAAGGATGACGACGATAAGATGCAGAGCAAT AAAACT-3', sNONO-R:5'-CGCAAGCTTTCATTAGTATCGGCGACGTTTGTTTGGA-3', The gel-extracted product of the sNONO gene was obtained through reverse transcription, PCR amplification, and gel extraction. (2) Constructing a eukaryotic expression vector for porcine NONO protein The gel recovery products of the pXJ41 vector and the sNONO gene were double-digested using EcoRI and HindIII to obtain vector fragment 1 and gene fragment 1. Vector fragment 1 and gene fragment 1 were ligated, and after transformation and plasmid extraction, a recombinant vector was obtained, which is the eukaryotic expression vector of porcine NONO protein.

Images