A method for detecting Ag + Reagents and their application in C-reactive protein detection
By combining gold nanoparticles (AuNPs) with nucleic acid aptamers, the problems of long detection time and insufficient sensitivity of CRP are solved, achieving high sensitivity and specificity for the detection of C-reactive protein, which is suitable for rapid detection of clinical samples.
Patent Information
- Application Number
- CN202310259106.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-16
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2043-03-16
Smart Images

Figure BDA0004130575660000111 
Figure BDA0004130575660000121 
Figure HDA0004130575680000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioanalytical chemistry, specifically relating to a method for detecting Ag. + The reagents and their application in the detection of C-reactive protein. Background Technology
[0002] C-reactive protein (CRP) is an acute-phase reactive protein produced by the liver that reacts with polysaccharides from various pathogens. CRP concentrations in the serum of healthy individuals are very low (<1.0 μg / mL in 90% of normal individuals). However, its blood concentration rises sharply in cases of acute myocardial infarction, trauma, infection, inflammation, surgery, and tumor infiltration. CRP is a sensitive indicator of bacterial infection and the most effective indicator for differentiating between bacterial and viral infections. In recent years, further research has revealed a close correlation between elevated serum high-sensitivity CRP (hs-CRP) concentrations (0.1-3 μg / mL) and coronary heart disease and peripheral vascular disease, with a predictive value higher than traditional coronary heart disease risk factors. hs-CRP is increasingly valued in the diagnosis and treatment of cardiovascular diseases as an inflammatory marker and a marker for atherosclerosis and thrombosis.
[0003] Currently reported methods for detecting CRP include electrochemiluminescence, fluorescence, chemiluminescence, and surface plasmon resonance, but these methods suffer from drawbacks such as long detection times and insufficient sensitivity. Furthermore, CRP is an acute-phase reactive protein; the longer the sample is stored, the more CRP degrades. Therefore, establishing a simple, rapid, sensitive, and accurate new method for measuring CRP is of great significance for clinical disease diagnosis and treatment monitoring. Summary of the Invention
[0004] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a method for detecting Ag. + The reagent.
[0005] This invention also proposes a method for detecting Ag. + The method.
[0006] The present invention also proposes a reagent for detecting C-reactive protein.
[0007] The present invention also proposes a detection kit for C-reactive protein.
[0008] The present invention also proposes applications of the above-mentioned detection reagents or kits.
[0009] This invention also proposes a method for detecting C-reactive protein. According to one aspect of the invention, a method for detecting Ag is provided. + The reagents include gold nanoparticles (AuNPs).
[0010] In some embodiments of the present invention, the final concentration of the AuNPs is 0-350 pM.
[0011] In some embodiments of the present invention, the final concentration of the AuNPs is 175 pM.
[0012] In some embodiments of the present invention, the reagent further includes an adsorption carrier, a colloidal protectant, an adsorption indicator, a pH adjuster, and a masking agent.
[0013] In some embodiments of the present invention, the adsorption carrier comprises silver halide precipitate.
[0014] In some embodiments of the present invention, the silver halide precipitate includes one of AgCl, AgBr, and AgI.
[0015] In some embodiments of the present invention, the final concentration of the adsorbent carrier is 0-20 mg / mL.
[0016] In some embodiments of the present invention, the final concentration of the adsorbent carrier is 11.65 mg / mL.
[0017] In some embodiments of the present invention, the colloidal protective agent is starch.
[0018] In some embodiments of the present invention, the final concentration of the colloidal protective agent is 0-1.0%.
[0019] In some embodiments of the present invention, the final concentration of the colloidal protective agent is 0.5%.
[0020] In some embodiments of the present invention, the adsorption indicator includes eosin or fluorescein.
[0021] In some embodiments of the present invention, the final concentration of the adsorption indicator is 0-18 μM.
[0022] In some embodiments of the present invention, the final concentration of the adsorption indicator is 15 μM.
[0023] In some embodiments of the present invention, the pH adjuster is HNO3.
[0024] In some embodiments of the present invention, the final concentration of the pH adjuster, HNO3, is 0-6.34 mM.
[0025] In some embodiments of the present invention, the final concentration of the pH adjuster, HNO3, is 6.18 mM.
[0026] In some embodiments of the present invention, the masking agent includes Hg. 2+Sodium citrate and BSA.
[0027] In some embodiments of the present invention, the masking agent comprises Hg at a final concentration of 0-280 nM. 2+ Sodium citrate (0-10 nM) and BSA (0-200 ng / mL)
[0028] In some embodiments of the present invention, the masking agent comprises Hg at a final concentration of 240 nM. 2+ 5 nM sodium citrate and 80 ng / mL BSA.
[0029] According to a second aspect of the present invention, a method for detecting Ag is proposed. + The method includes the following steps: detection using the above-mentioned reagents.
[0030] According to a third aspect of the present invention, a detection reagent for C-reactive protein is provided, the detection reagent comprising the above-described reagent for Ag + The reagents and nucleic acid aptamers used for the test.
[0031] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1.
[0032] In some embodiments of the present invention, the nucleic acid aptamer has a hairpin structure.
[0033] In some embodiments of the present invention, the hairpin structure is prepared by adding metal ions to a solution containing nucleic acid aptamers. The present invention adds Ag. + The purpose is to cause mismatches between the C bases of the nucleic acid aptamer.
[0034] In some embodiments of the present invention, the Ag + The concentration is 0.1 nM.
[0035] In some embodiments of the present invention, the solution further includes a buffer solution.
[0036] In some embodiments of the present invention, the buffer solution is a MOPS buffer or a HEPES buffer.
[0037] In some embodiments of the present invention, the concentration of MOPS is 10 mM and the pH is 7.6.
[0038] In some embodiments of the present invention, the MOPS buffer contains NaNO3 and Mg(NO3)2.
[0039] In some embodiments of the present invention, the concentration of NaNO3 in the MOPS buffer is 100 mM.
[0040] In some embodiments of the present invention, the concentration of Mg(NO3)2 in the MOPS buffer is 2.5 mM.
[0041] In some embodiments of the present invention, the buffer solution is a HEPES buffer solution.
[0042] In some embodiments of the present invention, the HEPES buffer solution has a concentration of 20 mM and a pH of 7.35.
[0043] In some embodiments of the present invention, the HEPES buffer contains NaNO3, Mg(NO3)2, KNO3 and Ca(NO3)2.
[0044] In some embodiments of the present invention, the concentration of NaNO3 is 120 mM, the concentration of Mg(NO3)2 is 0.1 mM, the concentration of KNO3 is 5 mM, and the concentration of Ca(NO3)2 is 0.1 mM.
[0045] In some embodiments of the present invention, the concentration of the nucleic acid aptamer is 0.5-5 μM.
[0046] In some embodiments of the present invention, the concentration of the nucleic acid aptamer is 1 μM.
[0047] According to a fourth aspect of the present invention, a kit for detecting C-reactive protein is provided, the kit comprising the reagents used in the above-described C-reactive protein detection method.
[0048] According to a fifth aspect of the present invention, a method for detecting C-reactive protein and the application of the above-described kit are provided, wherein the application is in the detection of C-reactive protein.
[0049] In a sixth aspect of the present invention, a method for detecting C-reactive protein is provided, the method comprising the following steps: detecting the protein using the above-described C-reactive protein detection reagent or the above-described kit.
[0050] In some embodiments of the present invention, the detection is performed under conditions of an excitation wavelength of 308-365 nm and an emission wavelength of 450-600 nm.
[0051] In some embodiments of the present invention, the detection is performed using an enzyme-linked immunosorbent assay (ELISA) reader.
[0052] According to some embodiments of the present invention, at least the following beneficial effects are achieved: the present invention, by adding AuNPs, makes Ag... + The detection limit was increased by 955 times; and it was used for Ag + The detection reagents contain nucleic acid aptamers (containing Ag) added. +The induced C-cell mismatch base pair method, used for C-reactive protein (CRP) detection, exhibits extremely high sensitivity and specificity for CRP, enabling the detection of CRP concentrations as low as 2 pg / mL. It has the potential for further application in the detection of other low-concentration disease biomarkers in blood. The CRP detection method of this invention utilizes eosin and Ag... + This method, achieved by combining aptamers and AuNPs, shows a strong linear correlation (r = 0.9969) between CRP levels in human serum and the decrease in fluorescence intensity of eosin in solution, with a wide linear range. The detection range in a 1 / 10,000 serum matrix is 0.01-40 ng / mL (equivalent to 0.1-400 μg / mL CRP in serum), with a detection limit of 2 pg / mL (0.02 μg / mL in serum). The method exhibits good reproducibility, high accuracy (90-107% recovery rate in human serum), and good specificity. Furthermore, this method is suitable for clinical sample detection, showing good correlation with latex-enhanced immunoturbidimetric assays (r = 0.986). It requires fewer reagents and samples, does not require biological antibodies, is low-cost, and has high sensitivity. CRP detection in serum samples can be achieved in 37 minutes, and it is easily industrialized and automated, enabling simultaneous detection of large numbers of samples. Attached Figure Description
[0053] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:
[0054] Figure 1 This is a graph showing the optimized detection results of HNO3 concentration and masking agent concentration in Example 1 of the present invention; wherein, A is the detection result graph of HNO3 at different concentrations, and B is the detection result graph of Hg at different concentrations. 2+ The test results are shown in Figure C, where C represents the test results for sodium citrate at different concentrations, and D represents the test results for BSA at different concentrations.
[0055] Figure 2 The above are the detection results of the optimized detection reagent concentration in Example 1 of the present invention. In this example, A is the detection result of different concentrations of AgI, B is the detection result of different concentrations of eosin, C is the detection result of different concentrations of starch, and D is the detection result of different concentrations of AuNPs.
[0056] Figure 3 The above diagram shows the detection results of the precipitate type optimization in Example 1 of the present invention. In this diagram, A is the detection result diagram of AgI as the adsorbent carrier, B is the detection result diagram of AgBr as the adsorbent carrier, C is the detection result diagram of AgCl as the adsorbent carrier, and D is the comparison result diagram of the fluorescence intensity of different adsorbent carriers.
[0057] Figure 4 This is a comparison graph of the detection results with and without AuNPs in the experimental examples of this invention, where A represents the detection results without AuNPs, Ag...+ The correlation results between concentration and fluorescence intensity changes are shown in Figure B. Without AuNPs, Ag... + The correlation between the natural logarithm of concentration and the change in fluorescence intensity is plotted, where C represents the concentration of Ag in the presence of AuNPs. + The correlation diagram between the concentration and fluorescence intensity changes is shown in Figure D, where D represents the concentration of Ag in the presence of AuNPs. + A graph showing the correlation between the natural logarithm of concentration and the change in fluorescence intensity;
[0058] Figure 5 The fluorescence spectra of the test examples of this invention are those with and without 0.1 ng / mL CRP.
[0059] Figure 6 This is a graph showing the specific detection results in the experimental examples of this invention;
[0060] Figure 7 Figure A shows the linear detection results in the experimental examples of this invention. Figure B shows the correlation results between CRP concentration and the change in eosin fluorescence intensity, and the linear detection results between the natural logarithm of CRP concentration and the change in eosin fluorescence intensity.
[0061] Figure 8 This is a graph showing the reproducibility test results in the experimental examples of this invention;
[0062] Figure 9 This is a comparison chart showing the results between the hospital standard method and the present method for clinical patient samples in the experimental examples of this invention. Detailed Implementation
[0063] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0064] Example 1
[0065] This embodiment provides a method for Ag + The reagents used in the detection include pH adjuster (HNO3) and masking agent (Hg). 2+ Sodium citrate and BSA) and sample detection reagents (silver halide, adsorption indicator, colloidal protectant and AuNPs).
[0066] Based on the above for Ag + The reagents used in the detection further established a method for detecting C-reactive protein, the specific process of which is as follows:
[0067] Sample pretreatment: HNO3 and masking agent (Hg) are added. 2+ The sample was mixed with sodium citrate, BSA, and serum, and 60 μL of the sample to be tested was added. The total sample volume was 562 μL. After mixing, the pretreated sample was obtained.
[0068] In addition, the sample pretreatment step can selectively add AgNO3 with a final concentration of 0.1 nM.
[0069] Sample detection: The pretreated sample (450 μL), starch, eosin, AuNPs and AgI were mixed (total sample volume 1.2 mL), incubated for 5 min, centrifuged at 13000 r / min for 2 min, and 100 μL of supernatant was taken into a 96-well plate for detection by an ELISA reader with an excitation wavelength of 308 nm and an emission wavelength of 545 nm.
[0070] 1. Optimization of reagent concentrations used in the method
[0071] (1) Optimization of pH adjuster concentration
[0072] In 0.01% serum matrix, the concentration of HNO3 (0–6.34 mM) was optimized based on the difference between the fluorescence intensity (F0) of the blank sample and the fluorescence intensity (F) of the sample containing 0.1 nM AgNO3 (i.e., AgNO3 was added to the sample pretreatment solution to make the final concentration in the test sample 0.1 nM).
[0073] The specific method is as described above. The final concentrations of each component in the reaction system are as follows: HNO3 concentrations are 0, 5.82, 6.02, 6.10, 6.18, 6.26, 6.30, and 6.34 mM, respectively; 240 nM Hg... 2+ 5 nM sodium citrate, 80 ng / mL BSA, 11.65 mg / mL LAGI, 11 μM eosin, 0.65% starch and 175 pM AuNPs.
[0074] Test results as follows Figure 1 As shown in Figure A, the maximum fluorescence value is observed when the concentration of HNO3 is 6.18 mM. Therefore, a concentration of 6.18 mM of HNO3 is preferred as the reaction condition.
[0075] (2) Optimization of masking agent solution
[0076] 1) Hg in the masking agent 2+ Concentration optimization
[0077] In a 0.01% serum matrix, the fluorescence intensity of Hg was determined based on the difference between the fluorescence intensity of the blank sample and the fluorescence intensity of the 0.1 nM AgNO3 sample. 2+ Concentration optimization was performed at concentrations (0–280 nM).
[0078] The specific method is as described above. The final concentrations of each component in the reaction system are as follows: Hg 2+ The concentrations were 0, 200, 230, 240, 250, 260, 280 nM, 6.18 mM HNO3, 5 nM sodium citrate, 80 ng / mL BSA, 11.65 mg / mL AgI, 11 μM eosin, 0.65% starch, and 175 pM AuNPs.
[0079] Test results as follows Figure 1 As shown in Figure B, it can be seen from the figure that in Hg 2+ The maximum fluorescence value is observed at a final concentration of 240 nM; therefore, Hg is preferred. 2+ The final concentration was 240 nM as the reaction condition.
[0080] 2) Optimization of sodium citrate concentration in masking agent
[0081] In 0.01% serum matrix, the concentration of sodium citrate (0–10 nM) was optimized based on the difference between the fluorescence intensity of the blank sample and the fluorescence intensity of the 0.1 nM AgNO3 sample.
[0082] The specific method is as described above. The final concentrations of each component in the reaction system are as follows: sodium citrate concentrations are 0, 2, 3, 4, 5, 7, 8, and 10 nM; HNO3 concentration is 6.18 mM; and Hg concentration is 240 nM. 2+ 80 ng / mL BSA, 11.65 mg / mL AgI, 11 μM Eosin, 0.65% starch and 175 pM AuNPs.
[0083] Test results as follows Figure 1 As shown in Figure C, the maximum fluorescence value is observed when the concentration of sodium citrate is 5 nM. Therefore, a sodium citrate concentration of 5 nM is preferred as the reaction condition.
[0084] 3) Optimization of BSA concentration in masking agent
[0085] The concentration of BSA (0–200 ng / mL) was optimized based on the difference between the fluorescence intensity of the blank sample and the fluorescence intensity of the 0.1 nM AgNO3 sample in 0.01% serum matrix.
[0086] The specific method is as described above. The final concentrations of each component in the reaction system are as follows: BSA concentrations of 0, 8, 40, 64, 80, 120, 160, and 200 ng / mL; 6.18 mM HNO3; and 240 nM Hg. 2+5 nM sodium citrate, 11.65 mg / mL AgI, 11 μM eosin, 0.65% starch and 175 pM AuNPs.
[0087] Test results as follows Figure 1 As shown in Figure D, the maximum fluorescence value is observed when the BSA concentration is 80 ng / mL. Therefore, a BSA concentration of 80 ng / mL is preferred as the reaction condition.
[0088] In summary, the masking agent includes Hg at a final concentration of 240 nM. 2+ 5 nM sodium citrate, 80 ng / mL BSA.
[0089] (3) Optimization of sample detection reagents
[0090] 1) Optimization of AgI concentration
[0091] In 0.01% serum matrix, the concentration of AgI (0–20 mg / mL) was optimized based on the difference between the fluorescence intensity of the blank sample and the fluorescence intensity of the 0.1 nM AgNO3 sample.
[0092] The specific method is as described above. The final concentrations of each component in the reaction system are as follows: AgI concentrations of 0, 5, 10, 11.65, 15, 17.5, and 20 mg / mL; 6.18 mM HNO3; and 240 nM Hg. 2+ 5 nM sodium citrate, 80 ng / mL BSA, 11 μM eosin, 0.65% starch and 175 pM AuNPs.
[0093] Test results as follows Figure 2 As shown in Figure A, it can be seen from the figure that the maximum fluorescence value is achieved when the concentration of AgI is 11.65 mg / mL. Therefore, the preferred reaction condition is an AgI concentration of 11.65 mg / mL.
[0094] 2) Optimization of Eosin Concentration
[0095] In 0.01% serum matrix, the concentration of eosin (0-18 μM) was optimized based on the difference between the fluorescence intensity of the blank sample and the fluorescence intensity of the 0.1 nM AgNO3 sample.
[0096] Sample testing: The pretreated sample (containing HNO3 with a final concentration of 6.18 mM and Hg with a final concentration of 240 nM) was tested. 2+The following solutions were prepared: sodium citrate (final concentration 5 nM), BSA (final concentration 80 ng / mL), serum (final concentration 0.01%), starch (final concentration 0.65%), eosin (final concentrations of 0, 5, 11, 14, 15, 16, and 18 μM), AuNPs (final concentration 175 pM), and AgI (final concentration 11.65 mg / mL). The total sample volume was 1.2 mL. The mixture was incubated for 5 min, centrifuged at 13000 rpm for 2 min, and 100 μL of the supernatant was transferred to a 96-well plate for microplate reading. The excitation wavelength was 308 nm, and the emission wavelength was 545 nm.
[0097] Test results as follows Figure 2 As shown in Figure B, the maximum fluorescence value is observed when the final concentration of eosin is 15 μM. Therefore, a final concentration of 15 μM for eosin is preferred as the reaction condition.
[0098] 3) Starch concentration optimization
[0099] The starch concentration (0–1%) was optimized in the presence of 0.1 nM AgNO3 in 0.01% serum matrix.
[0100] Sample pretreatment: Masking agents (HNO3, Hg) are added. 2+ A mixture of sodium citrate, BSA, and serum was added, followed by 60 μL of the test sample, bringing the total sample volume to 562 μL. After mixing, the mixture was incubated for 30 min to allow the aptamers to bind to the target. + Release the sample to obtain the pretreated sample.
[0101] Sample detection: 450 μL of the pretreated sample (containing HNO3 at a final concentration of 6.18 mM and Hg at a final concentration of 240 nM in the test sample) was placed in the test sample. 2+ The following solutions were prepared: sodium citrate (final concentration 5 nM), BSA (final concentration 80 ng / mL), serum (final concentration 0.01%), starch (final concentrations of 0, 0.25%, 0.4%, 0.5%, 0.65%, 0.75%, and 1%), eosin (final concentration 15 μM), AuNPs (final concentration 175 pM), and AgI (final concentration 11.65 mg / mL) to obtain the test sample. The total volume of the test sample was 1.2 mL. The mixture was incubated for 5 min, centrifuged at 13000 r / min for 2 min, and 100 μL of the supernatant was transferred to a 96-well plate for detection using a microplate reader. The excitation wavelength was 308 nm and the emission wavelength was 545 nm.
[0102] Test results as follows Figure 2 As shown in C in the figure, it can be seen from the figure that the maximum fluorescence value is found when the starch concentration is 0.5%. Therefore, a starch concentration of 0.5% is preferred as the reaction condition.
[0103] 4) AuNPs concentration optimization
[0104] The concentration of AuNPs (0–350 pM) was optimized in the presence of 0.1 nM AgNO3 in 0.01% serum matrix.
[0105] Sample pretreatment: Masking agents (HNO3, Hg) are added. 2+ A mixture of sodium citrate, BSA, and serum was added, followed by 60 μL of the test sample, bringing the total sample volume to 562 μL. After mixing, the mixture was incubated for 30 min to allow the aptamers to bind to the target. + Release the sample to obtain the pretreated sample.
[0106] Sample detection: 450 μL of the pretreated sample (containing HNO3 at a final concentration of 6.18 mM and Hg at a final concentration of 240 nM in the test sample) was placed in the test sample. 2+ The following solutions were prepared: sodium citrate (final concentration 5 nM), BSA (final concentration 80 ng / mL), serum (final concentration 0.01%), starch (final concentration 0.5%), eosin (final concentration 15 μM), AuNPs (final concentrations of 0, 87.5, 140, 175, 210, 245, 262.5, and 350 pM), and AgI (final concentration 11.65 mg / mL). The total sample volume was 1.2 mL. The solution was incubated for 5 min, centrifuged at 13000 r / min for 2 min, and 100 μL of the supernatant was transferred to a 96-well plate for microplate reading. The excitation wavelength was 308 nm, and the emission wavelength was 545 nm.
[0107] Test results as follows Figure 2 As shown in D in the figure, it can be seen from the figure that the maximum fluorescence value is found when the concentration of AuNPs is 175 pM. Therefore, the preferred reaction condition is a concentration of AuNPs of 175 pM.
[0108] 5) Optimization steps for adsorption carrier types
[0109] The concentrations of adsorbents (11.65 mg / mL AgI, 11.65 mg / mL AgBr, 11.65 mg / mL AgCl) were optimized in 0.01% serum matrix with and without 0.1 nM AgNO3.
[0110] Sample pretreatment: Masking agents (HNO3, Hg) are added. 2+ A mixture of sodium citrate, BSA, and serum was added, followed by 60 μL of the test sample, bringing the total sample volume to 562 μL. After mixing, the mixture was incubated for 30 min to allow the aptamers to bind to the target. + Release the sample to obtain the pretreated sample.
[0111] Sample detection: 450 μL of the pretreated sample (containing HNO3 at a final concentration of 6.18 mM and Hg at a final concentration of 240 nM) was tested. 2+ The following solutions were prepared: sodium citrate (final concentration 5 nM), BSA (final concentration 80 ng / mL), serum (final concentration 0.01%), starch (final concentration 0.5%), eosin (final concentration 15 μM), AuNPs (final concentration 175 pM), and adsorbents (AgI, AgBr, AgCl, etc., final concentration 11.65 mg / mL) were mixed to obtain the test sample. The total volume of the test sample was 1.2 mL. The mixture was incubated for 5 min, centrifuged at 13000 r / min for 2 min, and 100 μL of the supernatant was transferred to a 96-well plate for detection using a microplate reader. The excitation wavelength was 308 nm and the emission wavelength was 545 nm.
[0112] Test results as follows Figure 3 As shown in the figure, AgI has the best effect.
[0113] In summary, the sample detection reagents included: starch at a final concentration of 0.5%, eosin at 15 μM, AuNPs at 175 pM, and AgI at 11.65 mg / mL.
[0114] Example 2
[0115] This embodiment provides a method for detecting C-reactive protein, using the method described in Example 1 for Ag. + The reagents used for testing contain C-Ag + -C hairpin structure nucleic acid aptamers were used to detect C-reactive protein.
[0116] Among them, C-Ag was modified + The preparation method of the -C hairpin structure nucleic acid aptamer is as follows: Dilute 100 μM of CRP aptamer modified with C bases at both ends to 1 μM with 10 mM MOPS (10 mM MOPS, 100 mM NaNO3, 2.5 mM Mg(NO3)2, pH = 7.6) buffer, heat at 95 °C for 10 min, then turn off the heat source and slowly cool to room temperature. Mix 400 μL of 10 mM MOPS, 96 μL of 5 μM MgNO3, and 80 μL of 1 μM Apt, and incubate in the dark for 1 h to obtain the C-Ag-containing nucleic acid aptamer. + -C hairpin structure nucleic acid aptamer solution, store at 4°C protected from light for later use.
[0117] The nucleic acid aptamer (CRP Apt) sequence used for CRP detection is as follows: TCCCCCCGAAGGGGATTCGAGGGGTGATTGCGTGCTCCATTTGGTCCCCCCA (SEQ ID NO.1).
[0118] The specific process for C-reactive protein detection is as follows:
[0119] Sample pretreatment: Masking agent (HNO3, Hg) 2+ Sodium citrate, BSA, serum) and C-Ag + After mixing the -C hairpin aptamer, 60 μL of the test sample was added, bringing the total sample volume to 562 μL. The solution was mixed thoroughly and incubated for 30 min to allow the aptamer to bind to the target and release Ag. + The sample to be tested was obtained.
[0120] Sample testing: The above-obtained test sample, starch, eosin, AuNPs, and AgI were mixed (the final concentrations of each component were 6.18 mM HNO3, 240 nM Hg, etc.). 2+ The sample was incubated with 5 nM sodium citrate, 80 ng / mL BSA, 0.5% starch, 15 μM eosin, 175 pM uNPs, 11.65 mg / mL LAGI (total sample volume 1.2 mL) for 5 min, centrifuged at 13000 r / min for 2 min, and 100 μL of the supernatant was transferred to a 96-well plate for microplate reading. The excitation wavelength was 308 nm and the emission wavelength was 545 nm.
[0121] Test case
[0122] 1. Highly sensitive Ag + Detection method
[0123] This experimental example tested Ag in Example 1. + The detection sensitivity is determined using the following method:
[0124] Regular Ag + Sample pretreatment methods for testing:
[0125] Ag to be tested + Preparation of standard solutions: HNO3 and Ag of different concentrations were mixed... + Mix (1, 5, 10, 50, 100, 500, 1000, 5000 nM) to maintain a total sample volume of 562 μL;
[0126] Regular Ag + Detection method: First, mix starch, eosin, and AgI solution thoroughly, then mix it with Ag... + The HNO3 solution was mixed to a final total volume of 1.2 mL. The final concentrations of each component were 0.5% starch, 15 μM eosin, 11.65 mg / mL AgI, 6.18 mM HNO3, and the target concentrations of AgNO3 (1, 5, 10, 50, 100, 500, 1000, 5000 nM). Ag + The results of the correlation detection between concentration and fluorescence difference are as follows: Figure 4As shown in A and B.
[0127] High-sensitivity Ag + Sample pretreatment methods for testing:
[0128] Ag to be tested + The preparation method for the standard solution is the same as above;
[0129] High-sensitivity Ag + Detection method: First, mix starch, eosin, AuNPs, and AgI solution thoroughly, then mix it with Ag... + The HNO3 solution was mixed, and the final total volume was 1.2 mL. The final concentrations of each component were 0.5% starch, 15 μM eosin, 11.65 mg / mL AgI, 6.18 mM HNO3, and seven different concentrations of AgNO3 (0.1, 0.5, 1, 5, 10, 50, 100 pM). + The results of the correlation detection between concentration and fluorescence difference are as follows: Figure 4 As shown in C and D.
[0130] The test results showed that the addition of AuNPs could significantly improve Ag + Detection sensitivity.
[0131] 2. Feasibility verification of the C-reactive protein detection method
[0132] The impact of the presence or absence of CRP on test results
[0133] The experimental methods and reagents were the same as in Example 2. The difference between the experimental group and the control group was that the test sample in the experimental group was CRP with a concentration of 0.1 ng / mL, while the control group was an equal volume of buffer solution.
[0134] Test results as follows Figure 5 As shown, the fluorescence signal response value is lower in the presence of CRP than in the control group where only CRP is present, which demonstrates the feasibility of this method for detecting CRP.
[0135] 3. Specificity test
[0136] The experimental methods and reagents were the same as in Example 2. The difference between the experimental and control groups was that the experimental group added 0.1 ng / mL CRP, control group 1 added 40 μg / mL HSA (human serum albumin), control group 2 added 10 ng / mL IL-6 (interleukin-6), control group 3 added 10 ng / mL GPC-3 (phosphatidylinositol proteoglycan-3), control group 4 added 10 ng / mL AFP (alpha-fetoprotein), and control group 5 added 10 ng / mL Her-2 (human epidermal growth factor receptor 2). The experiment was repeated three times.
[0137] Test results as follows Figure 6 As shown in the figure, it can be seen that only when CRP is present can a significant change in the signal be caused. The results indicate that this method has good specificity and is not affected by human serum albumin, interleukin-6, phosphatidylinositol proteoglycan 3-alpha-fetoprotein and human epidermal growth factor receptor 2.
[0138] 4. Linear detection
[0139] The test methods and reagents were the same as in Example 2. The test samples were CRP solutions with concentrations of 0.01, 0.1, 1, 10, 20, and 40 ng / mL, respectively.
[0140] Linear detection results, such as Figure 7 As shown in the figure, this method has a good linear relationship, with r = 0.9969 and a linear range of 0.01-40 ng / mL. It can be accurately used for the detection of CRP, achieving the detection of CRP at concentrations of 0.01-40 ng / mL.
[0141] 5. Repeatability test
[0142] The test method and reagents were the same as in Example 2. The test sample was a CRP solution with a concentration of 0.1 ng / mL. Repeat detection was performed on days 1-6, and the test was repeated 3 times.
[0143] Test results as follows Figure 8 As shown in the figure, this method has good reproducibility, with an intraday RSD of 2.62% and an interday RSD of 1.86%, and can be accurately used for CRP detection.
[0144] 6. Clinical testing
[0145] One hundred clinical patients' serum samples were taken as test samples (samples were taken from inpatient serum of Southern Medical University Southern Hospital). The test methods and reagents were the same as in Example 2. The correlation was calculated by comparing this method with known clinical test results (results obtained by latex-enhanced immunoturbidimetric assay). The steps were the same as sample pretreatment and sample detection.
[0146] Test results as follows Figure 9 As shown in the figure, this method is applicable to clinical samples and exhibits good correlation with the clinical method (immunoturbidimetric assay) (r = 0.986). This method requires fewer reagents and samples, is low in cost, and has high sensitivity, enabling the detection of CRP in serum samples within 37 minutes.
[0147] 7. Recovery rate test
[0148] Serum samples were collected from two healthy volunteers. The experimental method and reagents were the same as in Example 3. C-reactive protein (CRP) was added to the test samples at concentrations of 5, 15, 30, 50, 150, and 300 μg / mL, respectively. Recovery rate = (measured concentration - initial concentration) / added concentration × 100%.
[0149] Table 1. Determination of recovery rate in serum samples
[0150]
[0151]
[0152] The test results are shown in Table 1. As can be seen from the table, the recovery rate of this method is 90-107%, which can accurately detect C-reactive protein in serum.
[0153] Aptamers (Apts) are oligomeric DNA or RNA molecules screened from nucleic acid libraries using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology. They possess the ability to specifically recognize targets. Apts have a unique and stable three-dimensional structure, allowing them to bind to different targets with high affinity and high specificity through spatial conformational complementarity. This binding mechanism is similar to antibody-antigen binding, making them a special type of "chemical antibody." Compared to traditional protein recognition element antibodies, Apts offer numerous advantages, including high affinity, strong specificity, flexible screening conditions, a wide target range, low cost, small molecular weight, ease of synthesis and modification, low immunogenicity, and good stability. Related studies have shown that metal ions, such as Ag, can cause DNA mismatches. + It can cause mismatches between C bases, Hg 2+ It can cause mismatches between T bases. The combination of metal ions and Apt can be used for the detection of various biomarkers. Ag + The adsorption of halides onto adsorption indicators is the basis of the fajans method in argentometric chromatography. When Ag... + When in excess, the adsorption indicator reacts with Ag. + The adsorption of the indicator onto the surface of the silver salt colloidal particles reduces the amount of free adsorbed indicator in the solution. This property is utilized in this method to... + A new method for detecting CRP in solution was established for bridges.
[0154] Ag + There are various detection methods, one of which is the adsorption indicator method, which is based on the principle of excess Ag in solution. +The complex with silver halide precipitate adsorbs the indicator, causing it to change from a free state to a precipitate, and the solution color changes accordingly. However, due to its low detection sensitivity, it is rarely used for the detection of trace components. This project reports for the first time an improvement in the detection of Ag by adding AuNPs to the solution system. + The method for detecting sensitivity is based on the fact that gold and silver are in the same group of the periodic table and have similar properties. When Ag in solution... + When excessive AuNPs are adsorbed by silver halide precipitate, a co-precipitation effect occurs. The high specific surface area of AuNPs leads to the adsorption of a large amount of eosin, thereby increasing the change in the amount of eosin in the solution and increasing the detection sensitivity. Since fluorescence analysis is more sensitive than visual detection, this invention determines Ag by detecting the fluorescence intensity of free indicator in solution. + content.
[0155] This document describes the embodiments of the present invention in detail with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.
Claims
1. A method for detecting Ag + The reagent is characterized by, The reagent includes nano-gold; The final concentration of the gold nanoparticles is 87.5-350 pM; The reagents also include an adsorption carrier, a colloidal protectant, an adsorption indicator, a pH adjuster, and a masking agent; the adsorption carrier comprises silver halide precipitate; the silver halide precipitate comprises one of AgCl, AgBr, and AgI; the colloidal protectant is starch; the adsorption indicator comprises eosin or fluorescein; the pH adjuster is HNO3; the final concentration of the adsorption carrier is 5-20 mg / mL; the final concentration of the colloidal protectant is 0.25-1.0%; the final concentration of the adsorption indicator is 5-18 μM; the final concentration of the pH adjuster is 5.82-6.34 mM; and the masking agent comprises Hg at a final concentration of 200-280 nM. 2+ Sodium citrate of 2-10 nM and BSA of 8-200 ng / mL.
2. A method for detecting Ag + The method is characterized by, The reagent described in claim 1 was used for detection.
3. A reagent for detecting C-reactive protein, characterized in that, Includes the reagent and nucleic acid aptamer as described in claim 1.
4. The detection reagent according to claim 3, characterized in that, The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
5. The detection reagent according to claim 3, characterized in that, The nucleic acid aptamer has a hairpin structure, and the preparation method of the hairpin structure includes: adding metal ions to a solution containing the nucleic acid aptamer; the metal ion is Ag. + .
6. A kit for detecting C-reactive protein, characterized in that, Includes the detection reagent as described in any one of claims 3-5.
7. The use of at least one of the detection reagents according to any one of claims 3-5 and the kit according to claim 6 in the detection of C-reactive protein.
8. A method for detecting C-reactive protein, characterized in that, The method includes the following steps: detection is performed using the detection reagent according to any one of claims 3-5 or the kit according to claim 6.
Citation Information
Patent Citations
Method for detecting Ag<+>
CN110819695A