GDP-M in predicting HRD levels and sensitizing DNA-damaging drugs

Abstract

The application discloses application of guanosine diphosphate mannose (GDP-M) or a key enzyme GMPPA thereof in the upstream in preparation of a product for predicting a homologous recombination repair deficiency (HRD) level of triple-negative breast cancer. The application also discloses a method for treating triple-negative breast cancer by supplementing GDP-M and / or a GMPPA inhibitor to increase sensitivity to a DNA damage drug.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to the application of guanosine diphosphate mannose in predicting homologous recombination repair defects and enhancing the sensitivity of DNA-damaging drugs. Background Technology

[0002] Homologous recombination repair (HRR) is a high-fidelity repair mechanism for double-strand breaks in DNA, requiring the participation of numerous genes. When DNA damage cannot be repaired normally through the homologous recombination repair pathway, it is considered a homologous recombination deficiency (HRD).

[0003] Triple-negative breast cancer (TNBC) is a subtype of breast cancer that is negative for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2. DNA-damaging drug therapy is an option for precision treatment of certain subtypes of triple-negative breast cancer. DNA-damaging drugs include platinum-based drugs and poly(ADP-ribose) polymerase 1 (PARP) inhibitors.

[0004] While DNA-damaging drugs have shown some success in treating TNBC in clinical practice, drug resistance still exists. To further improve the efficacy of DNA-damaging drugs, current strategies include precise screening of sensitive populations, such as those with BRCA1 or BRCA2 mutations; and combination therapy, such as using them in combination with anti-angiogenic drugs, cell cycle checkpoint inhibitors, or immune checkpoint inhibitors.

[0005] Studies have found that tumors with homologous recombination repair (HRR) respond better to DNA-damaging drugs compared to tumors without HRD. Current techniques for predicting HRD deficiency include mutation detection in HRR-related genes (including ATM, BRCA1, BRCA2, BARD1, BRIP1, CDK12, CHEK1, CHEK2, FANCL, PALB2, RAD51B, RAD51C, RAD51D, and RAD54L) and HRD scoring. HRR-related gene mutation detection is primarily performed using next-generation sequencing, while HRD scoring is mainly based on whole-genome sequencing and copy number microarray analysis. In addition, methods for assessing HRD include immunofluorescence-based methods such as the RAD51 score.

[0006] However, the detection of mutations in genes related to homologous recombination repair relies on next-generation sequencing technology, which is technically demanding, time-consuming, and costly. Furthermore, detecting only one or a few genes cannot comprehensively reflect the overall genomic alterations occurring in the HRR pathway, making it insufficient to accurately identify patients sensitive to DNA-damaging drugs. The cutoff values ​​for HRD scores are primarily based on data from Western populations, lacking sufficient clinical research evidence for their application in the Chinese population, and HRD score testing has not yet been standardized in China. Currently, it is impossible to clearly define the patient population sensitive to DNA-damaging drugs based on score values. Moreover, HRD score testing requires whole-genome sequencing or copy number variation microarray detection technology, which is costly, time-consuming, and involves significant patient trauma during sample collection.

[0007] Developing new predictive biomarkers for HRD and drug sensitization mechanisms for DNA damage is of significant clinical importance. Summary of the Invention

[0008] To address the aforementioned technical problems, this invention has discovered novel HRD biomarkers and their application in DNA damage sensitizing drugs.

[0009] Specifically, the first aspect of the present invention provides the application of guanosine diphosphate mannose (GDP-M) or GDP-M upstream key enzyme GDP-mannose pyrophosphorylase (GMPPA) as a biomarker in the preparation of tumor homologous recombination repair deficiency (HRD) level prediction products.

[0010] In some embodiments, the tumor is breast cancer. Preferably, the breast cancer is triple-negative breast cancer (TNBC).

[0011] In some embodiments, homologous recombination repair deficiency (HRD) levels are predicted by detecting the levels of guanosine diphosphate mannose (GDP-M) or GDP-mannose pyrophosphorylase (GMPPA) in breast cancer patient samples; preferably, the samples are tissue samples or blood samples.

[0012] In some embodiments, the GDP-M is detected using targeted metabolomics; the GMPPA is detected using immunohistochemical staining; preferably, the targeted metabolomics method is triple quadrupole liquid chromatography-mass spectrometry.

[0013] In some embodiments, the detection threshold for GDP-M is 4 μg / ml, with values ​​above the threshold indicating homologous recombination repair defect (HRD); the threshold for GMPPA is 20%, with values ​​below 20% indicating homologous recombination repair defect (HRD).

[0014] A second aspect of the present invention provides a kit for predicting tumor homologous recombination repair deficiency (HRD) levels, the kit comprising reagents for detecting GDP-M or GMPPA levels and, optionally, instructions for use. Preferably, the tumor is breast cancer; more preferably, the breast cancer is triple-negative breast cancer (TNBC).

[0015] The third aspect of this invention provides the use of guanosine diphosphate mannose (GDP-M) and / or GDP-mannose pyrophosphorylase (GMPPA) inhibitors in the preparation of sensitizing agents for the treatment of tumors with DNA damage drugs.

[0016] The fourth aspect of this invention provides the application of guanosine diphosphate mannose (GDP-M) and / or GDP-mannose pyrophosphorylase (GMPPA) inhibitors in combination with DNA damage drugs in the preparation of tumor therapeutic drugs.

[0017] According to the third or fourth aspect of the present invention, wherein the tumor is breast cancer, preferably, the breast cancer is triple-negative breast cancer (TNBC).

[0018] According to the application described in the third or fourth aspect of the present invention, the DNA-damaging drug includes platinum-based drugs and PARP inhibitors. Preferably, the platinum-based drug is cisplatin. Preferably, the PARP inhibitor is selected from olaparib, fluzoparib, niraparib, and pamiparib.

[0019] The advantages of this invention over the prior art are:

[0020] The level of homologous recombination repair deficiency (HRD) can be predicted by detecting GDP-M or GMPPA. Compared with traditional methods, the implementation process is convenient, time-saving, and cost-effective. GDP-M or GMPPA are single indicators, simple to operate, and have low requirements for laboratory technology, which is conducive to clinical application. Predicting HRD based on GDP-M or GMPPA content overcomes the shortcomings of current conventional HRD scoring methods, such as high cost and long testing time.

[0021] This invention also provides a novel DNA damage drug sensitization regimen for triple-negative breast cancer: supplementing with GDP-M and / or GMPPA inhibitors to sensitize against DNA-damaging drugs. This invention reveals the effect of GDP-M or GMPPA on homologous recombination repair (HRD), and further enhances the efficacy of platinum-based drugs and PARP inhibitors by supplementing with GDP-M and / or GMPPA inhibitors. Supplementing with GDP-M and / or GMPPA inhibitors can effectively enhance HRD at the metabolic level by inhibiting BRCA2 expression, and effectively enhance the efficacy of DNA damage drugs. This provides a new option for sensitizing DNA damage therapy in triple-negative breast cancer patients. Attached Figure Description

[0022] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0023] Figure 1 The correlation between GDP-M and HRD was identified using untargeted and targeted metabolomics. Figure 1 A. Non-targeted metabolomics analysis of breast cancer tissue showed that GDP-M was significantly upregulated in basal-like subtype breast cancer with high HRD scores; Figure 1 B. Using triple quadrupole liquid chromatography-mass spectrometry (LC-MS) technology, we targeted and quantitatively detected GDP-M content in breast tumor tissues and adjacent tissues with different HRD scores, where PT represents adjacent tissues.

[0024] Figure 2 The addition of GDP-M indicates an increase in HRD levels. Figure 2 A. Western blot analysis of the expression of DNA double-strand break marker γH2AX in TNBC cell lines (MDA-MB-231, HCC1806 and BT-549) after the addition of GDP-M; Figure 2 B. The proportion of U2OS cells positive for green fluorescent protein (GFP) after the addition of GDP-M and its upstream and downstream metabolites was detected by flow cytometry. This value reflects the cell's ability to repair homologous recombination under the condition of DNA double-strand break damage. Among them, GDP-F: guanosine diphosphate fucose; Mannose: mannose; I-Scel: DNA endonuclease.

[0025] Figure 3 Interference with key upstream enzymes of GDP-M affects HRD levels. Figure 3 A, the regulatory role of upstream key enzymes on GDP-M; Figure 3 B, Silencing key upstream enzymes of GDP-M promotes cisplatin-induced DNA double-strand breaks, where CDDP: cisplatin; Figure 3 C. Silencing key upstream enzymes of GDP-M leads to a decrease in the HRR capacity of the U2OS cell line.

[0026] Figure 4 GDP-M sensitizes DNA-damaging drugs in in vitro cell experiments. Figure 4 A. Supplementing with GDP-M reduces the half-maximal inhibitory concentration (IC50) of DNA damage drugs, where IC50 is the half-maximal inhibitory concentration, reflecting the drug's effectiveness. Figure 4B, The addition of GDP-M sensitized the efficacy of DNA-damaging drugs in cloning plate experiments, including CDDP (cisplatin) and Olaparib.

[0027] Figure 5 Preclinical models have confirmed that GDP-M supplementation can sensitize DNA-damaging drugs. Figure 5 A. Organoid viability was detected by a 3D culture cell viability assay kit after culturing 16 fresh TNBC tumor tissues under corresponding conditions (control group, GDP-M single treatment group, cisplatin single treatment group, and GDP-M and cisplatin combined treatment group) for one week. Figure 5 B. Quantitative fluorescence cell viability assay results showed that exogenous supplementation with GDP-M and cisplatin significantly inhibited organoid cell viability. Figure 5 The combination of C, GDP-M and cisplatin significantly inhibited organoid growth compared with cisplatin alone; Figure 5 D、 Figure 5 E, Figure 5 F. Animal experiments showed that GDP-M has a synergistic effect with platinum-based drugs; Figure 5 G, Figure 5 H, Figure 5 I, GDP-M and PARP inhibitors have a synergistic effect. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] Unless otherwise defined, the technical or scientific terms used herein shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains. Unless otherwise specified, the reagents, instruments, equipment, and methods used in this invention are all commercially available reagents, instruments, equipment, and methods conventionally available in this technical field.

[0030] Example 1 identifies the correlation between GDP-M and HRD using non-targeted and targeted metabolomics.

[0031] Non-targeted metabolomics: Using non-targeted polarity detection and lipidomics techniques, FUSCC TNBC metabolomics analysis extracted relative quantitative information of 594 polar metabolites and 1944 lipid metabolites. Based on large-sample metabolomics data, combined with previous genomic, transcriptomic, and clinical cohort information collected by the applicant, metabolic heterogeneity in TNBC was further analyzed, and potential metabolic molecules with HRR-inhibiting functions were screened. Metabolites upregulated in Basal-like subtypes and high HRD-score tumors were screened, and subsequent functional validation experiments identified the HRR-inhibiting metabolite GDP-M. Results showed that the metabolic molecule GDP-M was present at higher levels in high HRD-score tumors, indicating a positive correlation between GDP-M and HRD levels (e.g., ...). Figure 1 A).

[0032] Targeted metabolomics: Samples containing PAM50 classification information were collected from the FUSCC TNBC database for targeted quantitative detection. This further confirmed that GDP-M is present in higher levels in tumors with high HRD scores (e.g., Figure 1 B).

[0033] Both non-targeted and targeted metabolomics studies showed that GDP-M was positively correlated with HRD in TNBC.

[0034] Example 2: Adding GDP-M increases HRD level

[0035] GDP-M supplementation promotes cisplatin-induced DNA double-strand breaks: Functional experiments primarily focused on the effect of exogenous supplementation of this metabolite (GDP-M) on cisplatin (CDDP)-induced DNA double-strand breaks. γH2AX represents phosphorylated histone H2AX tryptophan, which increases in expression after DNA double-strand breaks and is recruited to the damaged DNA site, serving as a characteristic biomarker of DNA double-strand breaks. Western blotting experiments confirmed that exogenous addition of 50 μM GDP-M promoted cisplatin-induced DNA double-strand breaks, and the expression of cisplatin-induced γH2AX was significantly increased in the GDP-M group (e.g., ...). Figure 2 A).

[0036] GDP-M supplementation leads to a decrease in HRR capacity in U2OS cell lines: A DR-GFP reporter system was constructed using U2OS cell lines to characterize the HRR capacity of tumor cells. The fluorescence intensity of GFP was directly proportional to the HRR capacity of the cells. The mechanism of this reporter system involves first integrating a reporter substrate plasmid (DR-GFP) carrying a type I restriction endonuclease (I-SceI)-recognized DNA sequence into the U2OS cell line. Transfection with transiently expressed I-SceI restriction endonuclease directly cleaves the recognized DNA sequence, causing a DNA double-strand break. The DR-GFP plasmid contains the green fluorescent protein gene fragment iGFP. When a DNA double-strand break occurs, if homologous recombination repair occurs, the iGFP fragment produces biologically active GFP, which can be detected by flow cytometry. Exogenous addition of GDP-M, its upstream metabolite mannose, and its downstream metabolite GDP-fucose revealed that GDP-M has a unique inhibitory effect on HRR (e.g., ...). Figure 2 B).

[0037] The results of Example 2 above confirm that GDP-M has the effect of increasing HRD levels.

[0038] Example 3: Interference with key upstream enzymes of GDP-M affects HRD levels.

[0039] To confirm the regulatory role of the upstream key enzyme in GDP-M: a stable cell line stably transfected with shRNA silencing the upstream key enzyme (GMPPA) was constructed, and its GDP-M content was measured. To obtain a cell line stably expressing GMPPA shRNA, each lentiviral expression vector was transfected into HEK-293T cells, and two plasmid mixtures were packaged using Neofect DNA transfection reagent (Tengyi Biotech, #TF201201). Viral supernatant was collected 48 hours after transfection. Tumor cells in the logarithmic growth phase were digested with trypsin and processed at 5 × 10⁶ cells per well. 4Cells were seeded at a density of 1,000 cells per well in 24-well plates. Each well was infected with a mixture of 5 μL of interfering lentivirus, 0.5 ml of serum-free medium, and 0.5 μL of 8 μg / ml polybrene (Sigma, #H9268). Cells were then screened for one week with 2 μg / ml puromycin (Sangon Biotech, #A610593-0025). Nonsense-shRNA was used as a negative control (shRNA negative control, shNC). The shRNA targeting sequences are as follows: shNC, TTCTCCGAACGTGTCACGT (SEQ ID NO: 1); shGMPPA#1, GCCAGATTACGTGCATCTCA (SEQ ID NO: 2, also known as sh#1); shGMPPA#2, GGAACTCGCTTCAGACCTTTG (SEQ ID NO: 3, also known as sh#2).

[0040] The levels of GDP-M in the group with silenced upstream key enzymes were significantly upregulated compared to the control group, confirming that upstream key enzymes have a negative regulatory effect on GDP-M (e.g., Figure 3 A).

[0041] Silencing a key upstream enzyme of GDP-M promotes cisplatin-induced DNA double-strand breaks: Immunoblotting experiments showed that silencing the expression of a key upstream enzyme of GDP-M promotes the expression of γH2AX, a marker of cisplatin-induced DNA double-strand breaks. The basic experimental method is as follows: Figure 3 B.

[0042] Silencing a key upstream enzyme of GDP-M leads to a decrease in HRR capacity in U2OS cell lines: Silencing the expression of a key upstream enzyme of GDP-M in U2OS cell lines lowers HRR efficiency, which is consistent with the inhibitory effect of exogenous addition of GDP-M (50 μM). The basic principle is that silencing the key upstream enzyme of GDP-M can endogenously increase GDP-M levels, achieving the same inhibitory effect on HRR efficiency as exogenous addition of GDP-M (50 μM). Figure 3 C).

[0043] The results in Example 3 above confirm that silencing the key upstream enzyme of GDP-M has the effect of increasing HRD levels.

[0044] Example 4: Supplementing GDP-M with DNA damage sensitizing agents in in vitro cell experiments

[0045] GDP-M supplementation reduced the half-maximal inhibitory concentration (IC50) of DNA damage drugs: The effect of GDP-M (100 μM) on the half-maximal inhibitory concentrations of MDA-MB-231 cell-targeting small molecule inhibitors and CDDP was determined using the CCK8 assay. The conclusion was that GDP-M significantly reduced the IC50 of DNA damage drugs, but did not significantly affect the IC50 of other drugs. Figure 4 A).

[0046] GDP-M sensitized the efficacy of DNA-damaging drugs in clonal plate assays: clonal plate assays demonstrated a synergistic effect of GDP-M with platinum-based drugs and the PARP inhibitor (Oliparib), with the combination therapy significantly inhibiting clonal formation in various TNBC cell lines compared to the drug-only therapy. Figure 4 B).

[0047] The results of Example 4 confirm that GDP-M supplementation sensitizes DNA damage drugs in in vitro cell experiments.

[0048] Example 5: Preclinical model confirms the effectiveness of GDP-M-sensitizing drugs for DNA damage.

[0049] In organoid models, supplementation with GDP-M-sensitizing DNA-damaging drugs: Compared to tumor cell lines, tumor organoid models can better preserve tumor heterogeneity and more closely resemble in vivo tumor growth characteristics. Organoids were cultured from 16 fresh TNBC tumor tissues collected clinically (e.g., Figure 5 A). Organoids were divided into four groups for experiments: a control group, a GDP-M-only group, a cisplatin-only group, and a GDP-M and cisplatin combination group, with four organoids in each group. After one week of culture under appropriate conditions, organoid viability was assessed using a 3D cell viability assay kit. Quantitative real-time cell viability assays showed that exogenous supplementation with GDP-M and cisplatin significantly inhibited organoid cell viability (e.g., ...). Figure 5 B), the combination of GDP-M and cisplatin significantly inhibited organoid growth compared to cisplatin alone (e.g., Figure 5 C).

[0050] In animal experiments, GDP-M supplementation was used to sensitize DNA-damaging drugs: Animal experiments showed that exogenous GDP-M supplementation or silencing GMPPA expression enhanced the efficacy of platinum-based drugs. LM2 GMPPA shRNA knockdown cells (shGMPPA#1) and LM2 shNC cells were obtained through lentiviral infection. The shRNA target sequences are as follows: shNC (SEQ ID NO: 1); shGMPPA#1 (SEQ ID NO: 2).

[0051] Specifically, 6-8 week old BALB / c nude mice were selected and divided into the following 6 groups: shNC, shNC supplemented with GDP-M (100 mg / kg), shNC administered with cisplatin (2 mg / kg), shNC (2 mg / kg) supplemented with GDP-M (100 mg / kg) combined with cisplatin (2 mg / kg), shGMPPA, and shGMPPA administered with cisplatin. The effects of GDP-M supplementation alone, cisplatin supplementation alone, GDP-M supplementation combined with cisplatin, and GMPPA knockdown on the efficacy of cisplatin were observed. Animal experimental results showed that GDP-M has a synergistic effect with platinum-based drugs (e.g., ...). Figure 5 D、 Figure 5 E, Figure 5 F). Furthermore, to investigate whether exogenous supplementation of GDP-M or silencing of GMPPA expression enhances the efficacy of PARP inhibitors, tumorigenesis experiments were conducted in nude mice with similar groupings. The results showed a synergistic effect between GDP-M and PARP inhibitors (e.g., ...). Figure 5 G, Figure 5 H, Figure 5 I).

[0052] Example 5 above demonstrated the effectiveness of GDP-M supplementation in sensitizing DNA-damaging drugs through a preclinical model.

[0053] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered illustrative and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the scope of the invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

[0054] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This description is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. Guanosine diphosphate mannose (GDP) M) or GDP Application of the upstream key enzyme GDP-mannose pyrophosphorylase (GMPPA) as a biomarker in the preparation of products predicting the level of tumor homologous recombination repair deficiency (HRD).

2. The application according to claim 1, characterized in that, The tumor is breast cancer.

3. The application according to claim 2, characterized in that, The breast cancer mentioned is triple-negative breast cancer (TNBC).

4. The application according to claim 2, characterized in that, By detecting guanosine diphosphate mannose (GDP) in breast cancer patient samples The levels of homologous recombination repair deficiency (HRD) can be used to predict the level of homologous recombination repair deficiency (HRD).

5. The application according to claim 4, characterized in that, The sample is a tissue sample or a blood sample.

6. The application according to claim 4, characterized in that, Using targeted metabolomics to analyze the GDP M was detected; the GMPPA was detected using immunohistochemical staining.

7. The application according to claim 6, characterized in that, The targeted metabolomics method is triple quadrupole liquid chromatography. Mass spectrometry technique.

8. The application according to claim 6 or 7, characterized in that, GDP The detection threshold for M is 4 μg / ml, and a value above the threshold indicates homologous recombination repair defect (HRD); the threshold for GMPPA is 20%, and a value below 20% positive staining area indicates homologous recombination repair defect (HRD).

9. Guanosine diphosphate mannose (GDP) Application of M) and / or GDP mannose pyrophosphorylase (GMPPA) inhibitors in the preparation of sensitizing agents for the treatment of tumors with DNA damage drugs.

10. Guanosine diphosphate mannose (GDP) Application of M) and / or GDP mannose pyrophosphorylase (GMPPA) inhibitors in combination with DNA damage drugs in the preparation of tumor therapeutic drugs.

11. The application according to claim 9 or 10, characterized in that, The tumor is breast cancer.

12. The application according to claim 11, characterized in that, The breast cancer mentioned is triple-negative breast cancer (TNBC).

13. The application according to claim 11, characterized in that, The DNA damage-causing drugs include platinum-based drugs and PARP inhibitors.

14. The application according to claim 13, characterized in that, The platinum-based drug in question is cisplatin.

15. The application according to claim 13, characterized in that, The PARP inhibitor is selected from olaparib, fluzoparib, niraparib, or pamiparib.

Images