Molecular marker of pepper nuclear male sterility and its application

By detecting specific DNA fragments in the pepper genome and performing PCR amplification using primer pairs P-04-575F and P-04-575R, the problem of male fertility detection in peppers was solved, enabling rapid and accurate identification of pepper fertility and ensuring the purity of pepper hybrids.

CN116926224BActive Publication Date: 2026-06-05CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210336273.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-31
Publication Date
2026-06-05
Estimated Expiration
2042-03-31

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively detecting male fertility in peppers, especially in nucleus male-sterile lines, making it difficult to guarantee hybrid purity.

Method used

This study provides a molecular marker for male sterility in chili peppers. PCR amplification is used to detect whether a specific DNA fragment (sequence 3) is present in the chili pepper genomic DNA. Primers P-04-575F and P-04-575R are used for amplification. A 212bp DNA fragment indicates male fertility, while no amplification indicates male sterility.

Benefits of technology

It enables rapid and accurate identification of male fertility in chili peppers, and is applicable to the correct identification of 281 fertile and 273 sterile chili pepper plants in a population of 554 plants. It has strong applicability and is suitable for ensuring hybrid purity in chili pepper breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses a pepper cell nucleus male sterility molecular marker and application thereof. The pepper cell nucleus male sterility molecular marker disclosed by the application is a DNA fragment corresponding to sequence 3 in a sequence list in a pepper genome, and the pepper genome contains or does not contain the DNA fragment of sequence 3 in the sequence list. Experiments prove that in a pepper 20Q5066AB population of 554 strains, there are 281 fertile strains, all of which are fertile in field fertility identification and all contain the DNA fragment shown in sequence 3 in the sequence list; there are 273 sterile strains, all of which are male sterile in field fertility identification and all do not contain the DNA fragment shown in sequence 3 in the sequence list. It is shown that the pepper male sterility molecular marker of the application can be used for identifying pepper male sterility, has very strong applicability, and can be used for fertility rapid identification in practical breeding application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically molecular markers for male sterility in pepper cell nuclei and their applications. Background Technology

[0002] Chili peppers are annual or perennial herbaceous plants belonging to the genus *Capsicum* in the family Solanaceae. Widely cultivated globally, they are a vegetable crop of significant economic value worldwide and a vital condiment in people's diets.

[0003] Both nuclear male sterility (GMS) and cytoplasmic male sterility (CMS) exist in peppers. CMS fertility is controlled by both cytoplasmic and nuclear genes, allowing for the development of 100% male-sterile lines, which is convenient for hybrid seed production. However, it has fewer paternal restoration genes, and male sterility is often unstable, affecting hybrid purity. GMS fertility is controlled only by nuclear genes, and common inbred lines can fully restore hybrid fertility. Paternal sources are widely available in breeding, and sterility is stable, making it easier to ensure hybrid purity during seed production. Therefore, GMS is more convenient to utilize and has broad application prospects.

[0004] To date, scholars both domestically and internationally have discovered approximately 20 male sterility genes in pepper cells. Among these, the sterility genes discovered and utilized by domestic scholars are msc-1 and msc-2 (Wang and Bosland, 2006), but the relationships between most of these genes remain unclear. Currently, researchers both domestically and internationally have located or developed linkage markers for seven ms genes (Table 1). ms10 and ms3 are located on chromosome 1, but their alleles are unknown. ms8 is located on chromosome 4, and these three genes have not yet been cloned. ms1 and msc-2 are located on chromosome 5, and sequence analysis indicates that they are the same gene, both encoding a PHD-finger transcription factor, homologous to Arabidopsis thaliana AtMS1; ms... w It was also located on chromosome 5, and its alleles with ms1 and msc-2 are unknown; msc-1 was located on chromosome 2, encoding a bHLH transcription factor that is homologous to Arabidopsis thaliana AtDYT1.

[0005] The male sterility genes msc-1 and msc-2 in chili peppers, which were cloned by researchers in the early stages, are natural mutants found in lantern-shaped chili peppers. They are easy to transfer and utilize in lantern-shaped chili peppers, but difficult to transfer and utilize in horn-shaped and cow-horn-shaped chili peppers. Therefore, developing molecular markers for male sterility in chili peppers is beneficial for breeding more new chili pepper varieties.

[0006] Table 1. MS genes in pepper GMS that have been located or developed with linkage markers

[0007]

[0008] Summary of the Invention

[0009] The technical problem to be solved by this invention is how to detect male fertility in chili peppers.

[0010] To solve the above-mentioned technical problems, the present invention first provides the application of chili pepper male sterility molecular markers or substances that detect said chili pepper male sterility molecular markers in the detection or auxiliary detection of chili pepper male fertility;

[0011] The molecular marker for male sterility in chili peppers is a DNA fragment in the chili pepper genome that corresponds to sequence 3 in the sequence listing. The chili pepper genome may or may not contain the DNA fragment of sequence 3 in the sequence listing.

[0012] In the above applications, the substance used to detect the molecular marker for male sterility in chili peppers may include (or may be): primer pairs capable of amplifying DNA fragments containing sequence 3 in the sequence listing, or primer pairs capable of amplifying DNA fragments or partial fragments of sequence 3 in the sequence listing, or primers and / or probes capable of specifically recognizing DNA fragments of sequence 3 in the sequence listing.

[0013] In the above applications, the primer pair may consist of two single-stranded DNA sequences as shown in sequences 1 and 2 in the sequence listing.

[0014] The present invention also provides a method for detecting male fertility in chili peppers, the method comprising: detecting whether the genomic DNA of the chili pepper to be tested contains the DNA fragment shown in sequence 3; the chili pepper to be tested containing the DNA fragment shown in sequence 3 is or a candidate for male fertile chili pepper; and the chili pepper to be tested not containing the DNA fragment shown in sequence 3 is or a candidate for male sterile chili pepper.

[0015] The present invention also provides a method for detecting male fertility in chili peppers, the method comprising: using the genomic DNA of the chili pepper to be tested as a template, performing PCR amplification using the primer pair to obtain a PCR product; detecting the sequence of the PCR product, wherein the chili pepper to be tested containing the DNA fragment shown in sequence 3 is or a candidate for male fertile chili pepper, and the chili pepper to be tested not containing the DNA fragment shown in sequence 3 is or a candidate for male sterile chili pepper.

[0016] The present invention also provides a method for detecting male fertility in chili peppers, the method comprising: using the genomic DNA of the chili pepper to be tested as a template, performing PCR amplification using the primer pair to obtain PCR products; detecting the size of the PCR products, wherein the chili pepper to be tested containing a DNA fragment of size 212 bp is or a candidate for male fertile chili pepper, and the chili pepper to be tested not containing a fragment of size 212 bp is or a candidate for male sterile chili pepper.

[0017] In the above method, the PCR amplification system using the primer pair can be as follows: 2 μl genomic DNA, 5 μl Mix (Kangwei Century, CW0682), 0.5 μl each of forward and reverse primers (10 μM / L), and 12 μl sterile water.

[0018] In the above method, the conditions for PCR amplification using the primer pair can be: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 45 s, 33 cycles; 72℃ extension for 5 min.

[0019] The substance used to detect the molecular marker of male sterility in chili peppers is also within the scope of protection of this invention.

[0020] The application of the substance used to detect the molecular marker of male sterility in peppers in the preparation of products for detecting or assisting in the detection of male fertility in peppers is also within the scope of protection of this invention.

[0021] The application of the chili pepper male sterility molecular marker or the substance used to detect the chili pepper male sterility molecular marker in chili pepper breeding is also within the scope of protection of this invention.

[0022] In this invention, male sterility in chili peppers can be defined as male sterility of the chili pepper cell nucleus.

[0023] Experiments showed that in a population of 554 pepper plants (20Q5066AB), 281 plants were fertile, and all were fertile in field fertility tests. The amplification products of P-04-575F and P-04-575R both contained the DNA fragment shown in sequence 3 of the sequence listing. There were 273 sterile plants, and all were male-sterile in field fertility tests. The amplification products of P-04-575F and P-04-575R did not contain the DNA fragment shown in sequence 3 of the sequence listing. This indicates that the male-sterile molecular marker of this invention can be used to identify male sterility in peppers, has strong applicability, and can be used for rapid fertility identification in practical breeding applications. Attached Figure Description

[0024] Figure 1 The results show the PCR amplification products from the fertile and sterile pools. A-pool: sterile pool; B-pool: fertile pool.

[0025] Figure 2 The results of identification of 48 chili pepper samples using the molecular marker P-04-575 are presented.

[0026] Figure 3 This is the result of field fertility assessment. Detailed Implementation

[0027] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, and instruments used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0029] Example 1: P-04-575 is a molecular marker associated with male sterility in peppers.

[0030] 1. Targeting the construction of the target audience

[0031] This embodiment uses the male-sterile dual-purpose line population 20Q5066AB of pepper as the experimental material. The construction method of this population is as follows: (1) Using the sterile plants that appeared in the F2 generation obtained by self-pollination of 'Bruinsma Wonder' as the female parent and the self-pollination line 17C609 as the male parent, crosses were performed to obtain F1. Self-pollination was performed to obtain F2 generation. Then, the sterile plants that separated from the F2 generation were used as the female parent and 17C609 was used as the male parent for 6 consecutive backcrosses to obtain BC6F2 generation; (2) In the BC6F2 generation, 10 pairs of sibling crosses were performed (i.e., using the male-sterile plants in the population as the female parent and the male-fertile plants as the male parent). All fertile offspring were removed. The fertility of the offspring always maintained a segregation ratio of 1:1, and the main agronomic traits of the population were basically stable, that is, a new male-sterile dual-purpose line 20Q5066AB was bred. The population size of 20Q5066AB was 554 plants.

[0032] Reference for 'Bruinsma Wonder': Wang Deyuan, Yang Fengmei, Li Ying, Wang Hengming. Research progress on male sterility gene in pepper kernel. China Vegetables, 2008(9):40-43.

[0033] Inbred line 17C609: recorded in Table S2 of the following literature: Wu L, Wang P, Wang Y, Cheng Q, Lu Q, Liu J, Li T, Ai Y, Yang W, Sun L, Shen H. Genome-Wide Correlation of 36 Agronomic Traits in the 287 Pepper (Capsicum) Accessions Obtained from the SLAF-seq-Based GWAS. Int J Mol Sci. 2019 Nov 13;20(22):5675.

[0034] 2. Obtaining the molecular marker P-04-575

[0035] Polymorphism screening of the developed SSR and indel markers was performed using fertile and sterile pools of 20Q5066AB. After screening, the molecular marker P-04-575 was found to exhibit stable polymorphism between fertile and sterile pools, such as... Figure 1 As shown, PCR amplification of genomic DNA from fertile and sterile pools was performed using primer pairs composed of P-04-575F and P-04-575R, respectively. The amplification product from the fertile pool contained a 212 bp fragment (its sequence is sequence 3 in the sequence listing), while the amplification product from the sterile pool did not contain this 212 bp fragment. The primer sequences are shown below:

[0036] P-04-575F: 5'-GAAGAGGACTTTCCCCAACTCAT-3' (Sequence 1 in the sequence listing);

[0037] P-04-575R: 5'-TTCCGATGTTTAATTGTCAGAAAA-3' (Sequence 2 in the sequence list).

[0038] Amplified product sequence: GAAGAGGACTTTCCCCAACTCATGGCCCAGACCTTAACTGGGCGTGGATACCATGGCTTATGAGAAGGAGGATTGCCCAAGCCTTATAAGGAGACCAAAGACCCTTTCCTCTTTAAGATATTTAACAATAACTATGAAAGAAAATTGACATCCACACA AAAGTGAGTGAAGTCATGTTTTAGAAAATATTTTCTGACAATTAAACATCGGAA (Sequence 3 in the sequence listing).

[0039] The PCR reaction system (20 μl) consisted of: 2 μl genomic DNA, 5 μl Mix (Kangwei Century, CW0682), 0.5 μl each of forward and reverse primers (10 μM / L), and 12 μl sterile water.

[0040] PCR amplification reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 45 s, 33 cycles; 72℃ extension for 5 min.

[0041] The amplification products were detected using 1.5% agarose gel at 120V for 25 minutes.

[0042] In the 20Q5066AB population of 554 plants, 281 plants were fertile, and all of them were found to be fertile in field fertility tests. Figure 3 The amplification products of P-04-575F and P-04-575R both contained the DNA fragment shown in sequence 3 of the sequence listing; a total of 273 sterile plants were identified, and all of them showed male sterility in field fertility testing. Figure 3 The amplification products of P-04-575F and P-04-575R do not contain the DNA fragment shown in sequence 3 of the ordered list.

[0043] 3. Genetic linkage analysis

[0044] The genotypes of 554 individual plants in the dual-use line population were analyzed using the polymorphic molecular marker P-04-575 obtained through screening. Combined with the field fertility identification results of individual plants in the population, the genetic linkage map of the nuclear sterility gene in pepper cells was drawn using JoinMap4.0 software. The results showed that the molecular marker P-04-575 co-segregated with the sterility gene.

[0045] Example 2: Application of molecular marker P-04-575

[0046] 1. Test materials

[0047] This embodiment utilizes 48 chili pepper inbred lines and varieties with known genotypes (MsMs) (Table 2) to validate the molecular marker P-04-575. All inbred lines and varieties used were male-fertile and were obtained from the College of Horticulture, China Agricultural University.

[0048] Table 2. 48 chili pepper inbred lines and varieties

[0049]

[0050]

[0051] 2. Test Methods

[0052] The genomic DNA of the above-mentioned test materials was detected using primer pairs composed of P-04-575F and P-04-575R. The PCR amplification system and procedure were the same as in Example 1.

[0053] 3. Test Results

[0054] The results are shown in Table 2. AA indicates that the amplification products of both P-04-575F and P-04-575R contain the DNA fragment shown in sequence 3 of the sequence listing. Genotyping of 48 pepper inbred lines and varieties with known genotypes (MsMs) was performed using the molecular marker P-04-575 (Table 2). Figure 2 The results showed that the P-04-575 marker had 100% consistency with its known genotypes and phenotypes, indicating that this marker is highly applicable and can be used for rapid fertility identification in practical breeding applications.

[0055] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. <110> China Agricultural University <120> Molecular markers of male sterility in pepper cells and their applications <160> 3 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence <400> 1 gaagaggact ttccccaact cat 23 <210> 2 <211> twenty four <212> DNA <213> Artificial sequence <400> 2 ttccgatgtt taattgtcag aaaa 24 <210> 3 <211> 212 <212> DNA <213> Artificial sequence <400> 3 gaagaggact ttccccaact catggcccag accttaactg ggcgtggata ccatggctta 60 tgagaaggag gattgcccaa gccttataag gagaccaaag accctttcct ctttaagata 120 tttaacaata actatgaaag aaaattgaca tccacacaaa agtgagtgaa gtcatgtttt 180 agaaaatatt ttctgacaat taaacatcgg aa 212

Claims

1. Application of molecular markers for male sterility in pepper in detecting male fertility; The molecular marker for male sterility in chili peppers is a DNA fragment in the chili pepper genome corresponding to sequence 3 in the sequence listing. Chili peppers containing the DNA fragment shown in sequence 3 are male-fertile chili peppers, while chili peppers not containing the DNA fragment shown in sequence 3 are male-sterile chili peppers.

2. Application of substances that detect molecular markers of male sterility in peppers in the detection of male fertility in peppers; The molecular marker for male sterility in chili peppers is a DNA fragment in the chili pepper genome corresponding to sequence 3 in the sequence listing. Chili peppers containing the DNA fragment shown in sequence 3 are male-fertile chili peppers, while chili peppers not containing the DNA fragment shown in sequence 3 are male-sterile chili peppers.

3. The application according to claim 2, characterized in that: The substance used to detect the molecular marker for male sterility in chili peppers includes primer pairs capable of amplifying DNA fragments containing sequence 3 in the sequence listing.

4. The application according to claim 2, characterized in that: The substance used to detect the molecular marker for male sterility in chili peppers includes primer pairs capable of amplifying the DNA fragment shown in sequence 3 of the sequence listing.

5. The application according to claim 2, characterized in that: The substances used to detect the molecular marker of male sterility in chili peppers include primers and / or probes that can specifically recognize the DNA fragment shown in sequence 3 of the sequence listing.

6. The application according to claim 3 or 4, characterized in that: The primer pair consists of two single-stranded DNA molecules, as shown in sequences 1 and 2 in the sequence listing.

7. Methods for detecting male fertility in chili peppers include: The test involves detecting whether the genomic DNA of the pepper to be tested contains the DNA fragment shown in sequence 3. Peppers containing the DNA fragment shown in sequence 3 are male-fertile peppers, while peppers not containing the DNA fragment shown in sequence 3 are male-sterile peppers.

8. Methods for detecting male fertility in chili peppers include: Using the genomic DNA of the pepper to be tested as a template, PCR amplification was performed using the primer pair described in claim 6 to obtain the PCR product; The sequence of the PCR product was detected. The peppers containing the DNA fragment shown in Sequence 3 were male-fertile peppers, and the peppers not containing the DNA fragment shown in Sequence 3 were male-sterile peppers.

9. Methods for detecting male fertility in chili peppers include: Using the genomic DNA of the pepper to be tested as a template, PCR amplification was performed using the primer pair described in claim 6 to obtain the PCR product; The size of the PCR product was determined. Peppers containing a 212bp DNA fragment were identified as male-fertile peppers, while peppers not containing a 212bp fragment were identified as male-sterile peppers.

10. The use of the substance for detecting the molecular marker of male sterility in chili peppers as described in any one of claims 2-6 in the preparation of a product for detecting male fertility in chili peppers.

11. The application of the chili pepper male sterility molecular marker as described in claim 1 or the substance for detecting the chili pepper male sterility molecular marker as described in any of claims 2-6 in the breeding of male-fertile or male-sterile chili peppers.