Fungus jp1-7 with high yield of cellulase and salt tolerance and application thereof

By isolating and identifying the salt-tolerant fungal strain JP1-7, which produces high levels of cellulase, the problem of low cellulose resource utilization has been solved, achieving efficient cellulose degradation. This strain is suitable for treating high-salinity waste and can be applied in multiple industries.

CN116948839BActive Publication Date: 2025-11-07HEBEI AGRICULTURAL UNIV. +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310690225.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-12
Publication Date
2025-11-07
Estimated Expiration
2043-06-12

AI Technical Summary

Technical Problem

Existing technologies have low utilization rates of cellulose resources, leading to resource waste and environmental pollution. Furthermore, the competition among microorganisms during straw decomposition affects crop growth.

Method used

A salt-tolerant fungus JP1-7, specifically a strain of *Pseudomonas macrostemon*, was isolated and identified. This fungus is capable of efficiently secreting cellulase in saline-alkali environments. A salt-tolerant, high-cellulase-producing bacterial agent was prepared for the treatment of high-salinity waste.

Benefits of technology

This invention provides a highly efficient method for degrading cellulose, suitable for treating high-salinity waste, with strong enzyme production capacity, applicable to industries such as textiles, food processing, and feed additives, and has good economic value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116948839B_ABST
    Figure CN116948839B_ABST
Patent Text Reader

Abstract

The application discloses a salt-tolerant high-yield cellulase fungus JP1-7 and application thereof, and belongs to the technical field of microorganisms.The application discloses a phoma macrostoma fungus JP1-7, the phoma macrostoma fungus JP1-7 has been preserved in the China General Microbiological Culture Collection Center on March 9, 2023, the preservation number is CGMCC No.40519, and the preservation address is the Institute of Microbiology, Chinese Academy of Sciences, No.3, Xili Beichen, Chaoyang District, Beijing.The fungus has the characteristics of salt tolerance, can produce cellulase in a high yield, has the ability of degrading corn stalks, and the strain of the application provides a train of thought for treating high-salinity waste containing cellulose.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a salt-tolerant fungus JP1-7 with high cellulase production and its application. BACKGROUND

[0002] Cellulose is a macromolecular polysaccharide composed of glucose linked by beta-1, 4 glycosidic bond, which is the main component of plant cell wall and accounts for more than 50% of the carbon content in the plant kingdom, and is a rich carbohydrate in nature. Cellulose is also an important renewable resource, which can be used as raw material for food, medicine and chemical production, such as production of ethanol, lactic acid and single cell protein. However, due to the presence of a large number of high-energy hydrogen bonds in cellulose, it is not easy to be degraded, and the utilization rate is low. Most of the cellulose resources are directly incinerated or landfilled, causing serious resource waste and environmental pollution problems. Therefore, the effective development and utilization of cellulose resources has become one of the current research hotspots of energy and environment in the world.

[0003] Straw decomposition is a long process, and the microorganisms growing in the soil of straw incorporated field during this period are in a competitive relationship with the next batch of crops for nutrients and water. Therefore, microorganisms that degrade straw can accelerate the degradation of cellulose and reduce the harm to the environment. Microorganisms in nature can be effective producers of cellulose, and fungi, bacteria and actinomycetes can produce cellulase under certain conditions. Bacteria degrade cellulose by first damaging the surface of biomass, then growing and producing enzymes from the outside to the inside, and gradually degrading cellulose. Fungi start to degrade from the inside, and fungal hyphae can be adsorbed at the top of cellulose, and the hyphae grow into the interior of cellulose along the top and secrete cellulose, realizing the decomposition of cellulose from the inside to the outside. Most commercial cellulose is derived from extracellular enzymes secreted by fungal strains, and according to statistics, cellulose products of Aspergillus and Trichoderma account for 20% of the world's cellulase market. Therefore, fungi with high efficiency in degrading cellulose have broad application prospects in industrial production and agricultural waste treatment. SUMMARY

[0004] The purpose of the present application is to provide a salt-tolerant fungus JP1-7 with high cellulase production and its application, in order to solve the problems existing in the prior art. A new strain of Phoma macrostoma is isolated from plant roots, which can tolerate salt and produce high cellulase.

[0005] To achieve the above purpose, the present application provides the following solutions:

[0006] Technical solution one: a Macrophoma JP1-7, which has been preserved in the China General Microbiological Culture Collection Center on March 9, 2023, with a preservation number of CGMCC No. 40519 and a preservation address of No. 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing Chaoyang District, North Chenxi Road 1st Courtyard. The bacteria are isolated from the rhizosphere of Suaeda salsa, collected from the coastal area of Huanghua City, Cangzhou City, Hebei Province.

[0007] Technical solution two: a salt-tolerant high-yield cellulase bacterial agent, comprising the Macrophoma JP1-7.

[0008] Technical solution three: a preparation method of the salt-tolerant high-yield cellulase bacterial agent, comprising inoculating the Macrophoma JP1-7 into a liquid enzyme production medium, centrifuging and culturing, centrifuging the obtained bacterial liquid at 4000 rpm for 10 min, resuspending the supernatant to obtain the salt-tolerant high-yield cellulase bacterial agent.

[0009] Further, the composition of the liquid enzyme production medium is: corn straw 10 g, dipotassium hydrogen phosphate 0.5 g, magnesium sulfate 0.5 g, sodium chloride 0.5 g, sodium nitrate 0.2 g, and distilled water 1000 mL.

[0010] Further, the centrifugation and culture after centrifugation are specifically: centrifugation at 180 rpm, and culture at 28℃ for 7 days.

[0011] Technical solution four: application of the Macrophoma JP1-7 or the salt-tolerant high-yield cellulase bacterial agent in the production of cellulase.

[0012] Further, the cellulase is used for treating high-salinity waste.

[0013] Further, the cellulase is used for hydrolyzing lignocellulose.

[0014] Further, the lignocellulose includes corn straw, corn cob, straw, rice husk, wheat straw, sorghum stalk, or sugarcane residue.

[0015] The present application discloses the following technical effects:

[0016] The Macrophoma JP1-7 with salt-tolerant high-yield cellulase provided by the present application is isolated from saline-alkali land, and it has been verified that the strain has strong cellulase production capacity at 50℃, providing an efficient degradation method for treating cellulose. Because of its salt tolerance, it has an advantage in treating high-salinity waste containing cellulose. The cellulase produced by the present application can be applied to the textile, food processing and feed additive industries, and has good economic value. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description only need to be some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0018] Figure 1 The colony picture of Phaeoacremonium aleophilum JP1-7 growing on PDA medium;

[0019] Figure 2 The mycelium picture of Phaeoacremonium aleophilum JP1-7 growing on PDA medium;

[0020] Figure 3 The inhibition zone produced by Phaeoacremonium aleophilum JP1-7 after growing on CMC-Na medium and then being stained by Congo red;

[0021] Figure 4 The inhibition zone produced by Phaeoacremonium aleophilum JP1-7 after growing on CMC-Na medium with 0.4 mol / L salt concentration and then being stained by Congo red;

[0022] Figure 5 The inhibition zone produced by Phaeoacremonium aleophilum JP1-7 after growing on CMC-Na medium with 0.8 mol / L salt concentration and then being stained by Congo red;

[0023] Figure 6 The inhibition zone produced by Phaeoacremonium aleophilum JP1-7 after growing on CMC-Na medium with 1.2 mol / L salt concentration and then being stained by Congo red;

[0024] Figure 7 The enzyme activity of cellulase produced by Phaeoacremonium aleophilum JP1-7 under the influence of different temperatures;

[0025] Figure 8 The enzyme activity of cellulase produced by Phaeoacremonium aleophilum JP1-7 under the influence of different pH. DETAILED DESCRIPTION

[0026] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0027] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, a parameter, an intermediate value of the parameter is understood to be specifically disclosed anywhere that either the upper or lower limit of the range is disclosed. Each intermediate value of the parameter is explicitly incorporated into this disclosure as an explicit separate embodiment. These intermediate values are specifically encompassed by the range of values.

[0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials which are related to the present application. In the case of conflict between the present specification and any document incorporated by reference, the present specification controls.

[0029] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in scope by the specific embodiments described herein. Rather, the intent is to embrace all alternatives, modifications and variations that fall within the scope of the present application.

[0030] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having", "contain", "containing", "characterized by" and the like can be used interchangeably.

[0031] Detailed composition of CMC-Na medium: Sodium carboxymethylcellulose 15 g, agar powder 12 g, peptone 2 g, sodium chloride 1 g, potassium phosphate dibasic 1 g, yeast extract powder 1 g, magnesium sulfate heptahydrate 0.2 g, add water to 1 L.

[0032] Example 1

[0033] 1.1 Collection and isolation of strains

[0034] The sample was collected from the surface soil layer of Suaeda salsa in a saline-alkali soil in Huanghua City, Cangzhou City, Hebei Province. The soil was dug out together with the root system of the plant, packed in a polyethylene plastic bag, and taken back to the laboratory. The root system with adhering soil was slightly air-dried, and the soil adhering to the root system was removed by tapping the root system. The root segments were cut to about 0.5 cm. The following procedures were used for surface sterilization: rinsing twice with sterile water, 75% ethanol rinsing for 4 min, rinsing once with sterile water, 3% sodium hypochlorite rinsing for 2 min, and rinsing three times with sterile water. The sterilized root segments were placed on PDA solid medium and cultured at 28°C in the dark for 7 days. The growth of colonies around the root segments was observed every other day, and the colonies were transferred to PDA solid medium for purification to obtain the isolated strain, which was named JP1-7.

[0035] 1.2 Morphological identification of the strain

[0036] The strain JP1-7 was inoculated on PDA solid medium and then cultured at 28°C in the dark for 5 days. The growth of colonies on the plate was observed and recorded. The colony morphology of JP1-7 on PDA solid medium is shown in Figure 1 , which is round, with fast and uniform mycelial growth. The mycelium is gray and grows densely. Under a microscope, the mycelium is black, has septa, is single-branched, and does not produce conidia. Figure 2 According to the methods in the Fungal Identification Manual and the like, the strain JP1-7 was preliminarily identified as Macrophoma.

[0037] 1.3 Molecular biological identification

[0038] DNA was extracted from JP1-7 for sequence alignment identification

[0039] (1) 2% CTAB extraction buffer was preheated in a water bath at 65°C.

[0040] (2) A small amount of JP1-7 mycelium (about 300 mg) was placed in a mortar and ground to powder with liquid nitrogen;

[0041] (3) 700 ul of 2% CTAB extraction buffer was added and stirred gently;

[0042] (4) The ground solution was divided into 1.5 ml sterile centrifuge tubes, and the height of the ground solution accounted for about two-thirds of the tube;

[0043] (5) It was placed in a water bath at 65°C or in a constant-temperature box, and was gently shaken every 10 min. It was taken out after 30-60 min;

[0044] (6) After cooling for 2 min, chloroform-isoamyl alcohol (24:1) was added to the tube, and it was vigorously shaken for 2-3 min (if total genome is extracted, it cannot be shaken vigorously). The two were mixed uniformly;

[0045] (7) Put into centrifuge 10000 rpm for 10 min, while, add 600 μL of isopropyl alcohol into another new sterilized centrifuge tube;

[0046] (8) After centrifuging at 10000 rpm for 1 min, pipette gently pipette the supernatant into the centrifuge tube containing isopropyl alcohol, and slowly shake the centrifuge tube up and down for 30 sec, so that the isopropyl alcohol and the water layer are fully mixed to see the DNA flocculation;

[0047] (9) After centrifuging at 10000 rpm for 1 min, immediately pour out the liquid, and pay attention not to pour out the white DNA precipitate, and put the centrifuge tube upside down on the spread paper towel;

[0048] (10) After 60 sec, stand the centrifuge tube, add 720 μL of 75% ethanol and 80 μL of 5M sodium acetate, and gently rotate, and use the finger to pop the tube tip, so that the precipitate and the DNA block material at the bottom of the tube float in the liquid;

[0049] (11) Place for 30 min to dissolve the impurities of the DNA block material;

[0050] (12) After centrifuging at 10000 rpm for 1 min, pour out the liquid, and add 800 μL of 75% ethanol, and wash the DNA for 30 min;

[0051] (13) After centrifuging at 10000 rpm for 30 sec, immediately pour out the liquid, and put the centrifuge tube upside down on the spread paper towel; after several minutes, stand the centrifuge tube, and dry the DNA (natural air drying or blowing dry with an air gun);

[0052] (14) Add 50 μL of 0.5x TE (containing RNase) buffer to dissolve the DNA, and place in a 37℃ constant temperature box for about 15 h to digest the RNA. The extracted DNA is subjected to PCR amplification, and the PCR amplification product is sent to Shanghai Shengong Biotechnology Co., Ltd. for sequencing, and the obtained DNA sequence (as shown in SEQ ID NO: 1) is input into NCBI, and compared and analyzed with all sequences in the database by using a Blast program. The DNAman is used to construct a phylogenetic tree, and sequence analysis shows that the strain isolated in the application belongs to Phaeosphaeria cladiospora.

[0053] Sequence of JP1-7 strain (SEQ ID NO: 1):

[0054] AGAAGCCGGAGCCCTCGTGGCTCTGTTTCTGCCCCATCTGTCTGAATATTCACCCATGTCTTTTGCGTACCAATTGTTTCCTTGGCGGGCTTGCCCGCCAACAGGACATTGTTAAACCTTTTGTAATTG CAGTCAGCGTCAGAAAAAACTTAATAGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCT TTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTTGTCTCCCCTGGGAGACTCGCCTCAAAACAATTGGCAGC CGGCATATTGGTATCGGAGCGCAGCACAAGTCGCGCTTCTGTCCATGAATGTCGGCGTCCAGCAAGACCATTTTTCACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA.

[0055] Preservation information: Pseudomonas macrostemii JP1-7 was deposited on March 9, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40519. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0056] 1.4 Screening of Congo Red

[0057] Colonies of strain JP1-7 were picked and incubated in the dark at 28°C for 5 days on CMC-Na medium. They were then stained with 1% Congo red for 30 minutes, the stain was discarded, and the culture was rinsed with 0.9% NaCl solution for 30 minutes to produce a clear inhibition zone. Figure 3 As shown. To verify the inhibition zones produced by *Pseudomonas macrostemon* JP1-7 after growth on CMC-Na medium at different salt concentrations and subsequent exposure to Congo red, strain JP1-7 was placed on CMC-Na medium with NaCl concentrations of 0.4, 0.8, and 1.2 mol / L, respectively, under the same cultivation conditions as described above. Inhibition zones were produced at different NaCl concentrations as shown in the figure. Figure 4-6 As shown.

[0058] Preparation of crude enzyme solution: JP1-7 was inoculated into solid PDA medium and cultured at 28°C in dark and inverted for 5 days to obtain pure colonies, and a 7-mm-diameter colony was picked and cultured in liquid enzyme production medium (10 g of corn straw, 0.5 g of potassium phosphate dibasic, 0.5 g of magnesium sulfate, 0.5 g of sodium chloride, 0.2 g of sodium nitrate, and 1000 mL of distilled water) at 28°C with a shaking speed of 180 r / min for 7 days. The cultured bacterial solution was centrifuged at a speed of 4000 r / min for 10 min, and the supernatant was obtained as the crude enzyme solution.

[0059] 1.5 Optimum enzyme activity temperature screening

[0060] The crude enzyme solution was used for optimum enzyme activity temperature screening, and the enzyme activity was determined by the DNS method. Seven test tubes (No. 1, 2, 3, 4, 5, 6, and 8) were used as experimental groups, and another seven test tubes were used as control groups. 1.5 ml of phosphate buffer with a pH of 6.0 was added to each test tube, and all the test tubes were preheated in a 50°C water bath for 10 min. After preheating, all the test tubes were taken out of the water bath, and 0.5 ml of crude enzyme solution was added to the No. 1-7 experimental group test tubes, and the control group was not treated. The No. 1-7 experimental group and the control group were placed in water baths at 20°C, 30°C, 40°C, 50°C, 60°C, 70°C, and 80°C, respectively, and reacted for 20 min. After the reaction, 3.0 ml of DNS reagent was added to the experimental group test tubes, and 0.5 ml of crude enzyme solution and 3.0 ml of DNS reagent were added to the control group test tubes. All the test tubes were placed in a boiling water bath for 15 min, and each experimental group had three parallel tests. After boiling, all the test tubes were cooled, and the OD value of each test tube was determined at 540 nm. The optimum enzyme activity temperature statistical graph is shown in Figure 7 The optimum enzyme activity temperature statistical value is shown in Table 1.

[0061] Table 1

[0062]

[0063]

[0064] 1.6 Optimum enzyme activity pH screening

[0065] The crude enzyme solution is used to continue to screen the optimum reaction pH of enzyme activity by the DNS method. 6 test tubes (numbered 1, 2, 3, 4, 5, 6) are taken as experimental groups, which are divided into 6 groups, and another 6 test tubes are taken as the control group of each group. In each group of test tubes 1-6, pH 3.0, 4.0, 5.0, 6.0, 7.0, and 8.0 phosphate buffer is added respectively, and then all test tubes are preheated in a 50℃ water bath for 10 minutes. After preheating, all test tubes are taken out of the water bath, 0.5ml of crude enzyme solution is added to each test tube 1-6, and the control group is not treated. The test tubes 1-6 and the control group are placed in a 50℃ water bath for 20 minutes, and then 3.0ml of DNS reagent is added to each test tube of the experimental group, and 0.5ml of crude enzyme solution and 3.0ml of DNS reagent are added to each test tube of the control group. All test tubes are placed in a boiling water bath for 15 minutes, and each group of experimental groups has 3 parallel tests. After boiling, all test tubes are cooled, and the OD value of each test tube is measured at 540nm. The optimum enzyme activity pH statistical diagram is shown in Figure 8 The optimum enzyme activity pH statistical value is shown in Table 2.

[0066] Table 2

[0067] pH Enzyme activity (U / ml) 3 0.974 4 1.196 5 1.326 6 1.502 7 1.305 8 1.266

[0068] In summary, by placing the JP1-7 strain of the present application on a CMC-Na medium with different NaCl concentrations, it is observed that the strain provided by the present application can grow under salt stress.

[0069] Example 2

[0070] When the strain is placed in a corn straw culture medium to produce cellulase (the carbon source in the liquid culture medium is corn straw), it also has high activity. The enzyme activity reaches (1.354u / ml) at 5 days of fermentation culture, and has good application prospect.

[0071] The present application inoculates the Phoma macrostoma JP1-7 into a corn straw culture medium (corn straw 10g, dipotassium hydrogen phosphate 0.5g, magnesium sulfate 0.5g, sodium chloride 0.5g, sodium nitrate 0.2g, distilled water 1000mL) and cultures for 5 days, and the culture conditions are: 28℃, shaking speed 180r / min. The cultured bacterial liquid is centrifuged at a speed of 4000r / min for 10 minutes, and the supernatant after centrifugation is the crude enzyme solution. 0.5ml of the crude enzyme solution is added to 1.5ml of pH 6.0 phosphate buffer, and the DNS method is used to determine the reducing sugar in the supernatant.

[0072] The results show that the cellulase activity produced by the strain of the application can reach 1.354 u / ml, and the cellulase produced by the strain of the application can hydrolyze β-1,4-glycosidic bond to obtain reducing sugar.

[0073] The above-described embodiments are only used to describe the preferred modes of the application, and do not limit the scope of the application. Without departing from the design spirit of the application, various modifications and improvements of the technical solutions of the application made by those skilled in the art shall fall within the protection scope of the claims of the application.

Claims

1. A strain of Macrophoma sp. JP1-7, characterized in that, The Phaeoacremonium aleophilum JP1-7 is preserved in the China General Microbiological Culture Collection Center on March 9, 2023, with a preservation number of CGMCC No. 40519 and a preservation address of No. 1 Yard of Beichen West Road, Beijing City, China Institute of Microbiology, Chinese Academy of Sciences.

2. A salt tolerant high yield cellulase bacterial inoculant characterized in that, The Phaeoacremonium aleophilum JP1-7 of claim 1.

3. The preparation method of the salt-tolerant, high-yield cellulase-producing bacterial agent as described in claim 2, characterized in that, The method comprises inoculating the Phaeoacremonium aleophilum JP1-7 into a liquid enzyme-producing culture medium, culturing after centrifugation, centrifuging the obtained bacterial liquid at 4000 rpm for 10 min, resuspending the supernatant to obtain the salt-tolerant high-yield cellulase bacterial agent.

4. The production method according to claim 3, wherein The liquid enzyme-producing culture medium comprises 10 g of corn straw, 0.5 g of dipotassium hydrogen phosphate, 0.5 g of magnesium sulfate, 0.5 g of sodium chloride, 0.2 g of sodium nitrate and 1000 mL of distilled water.

5. The production method according to claim 3, wherein The post-centrifugation culture is specifically 7 days of culture at 28°C after centrifugation at 180 rpm.

6. Use of the Phaeoacremonium aleophilum JP1-7 of claim 1 or the salt-tolerant high-yield cellulase bacterial agent of claim 2 in the production of cellulase.

Citation Information

Patent Citations

  • Trichoderma asperelloides with salt and alkali tolerance and application of Trichoderma asperelloides

    CN111394261A