SNP sites for detecting salt tolerance in watermelons, molecular markers based on these sites, and their applications.

Abstract

This invention belongs to the field of genetic engineering technology, specifically relating to SNP loci for detecting salt tolerance traits in watermelons, molecular markers based on these loci, and their applications. The molecular markers of this invention can identify watermelon salt tolerance at the molecular level and can be directly used in marker-assisted breeding of salt-tolerant watermelon varieties, improving breeding selection efficiency and accelerating the breeding process. Furthermore, these molecular markers can lay the foundation for cloning the watermelon salt tolerance gene ClDREB2A, establishing a marker-assisted breeding system, and also for research on the watermelon salt tolerance regulatory network.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to SNP sites for detecting salt tolerance traits in watermelons, molecular markers based on these sites, and their applications. Background Technology

[0002] Watermelon (Citrullus lanatus) is delicious and juicy, a natural beverage, rich in nutrients and free of fat and cholesterol, making it a popular choice. my country is the world's largest producer and consumer of watermelons, with an area of ​​1.4 million hectares and a yield of 60.86 million tons in 2021. The watermelon industry plays a vital role in increasing farmers' income and improving their living standards. However, watermelon is a salt-sensitive crop, and salt stress adversely affects watermelon plants, leading to a significant decline in yield and quality. In China's main watermelon-producing areas, excessive irrigation, overuse of chemical fertilizers, and continuous cropping have resulted in soil salt stress, which has become one of the main factors restricting healthy watermelon production in my country.

[0003] Research on salt stress tolerance in watermelons is insufficient, with most studies focusing on the use of chemical substances and rootstock selection. Research on salt tolerance-related genes has been conducted using only a few reverse genetics methods, and the obtained genes are not considered key genes. The molecular mechanisms regulating watermelon salt tolerance remain unclear, and further research is needed to identify key genes directly regulating watermelon salt tolerance. Therefore, it is essential to explore the mechanisms of watermelon's response to salt stress, identify key salt tolerance genes, and ultimately elucidate the molecular mechanisms regulating watermelon salt tolerance from a forward genetics perspective. In recent years, high-quality watermelon genome assembly combined with large-scale genome resequencing has elucidated the selection and domestication process of watermelon fruit quality and resistance. When studying complex phenotypic traits in watermelons, an increasing number of researchers are choosing to use high-throughput sequencing data for GWAS analysis related to watermelon traits, greatly facilitating watermelon breeding. However, research using GWAS to identify resistance genes, especially salt tolerance genes, has not yet been reported.

[0004] Therefore, using GWAS to screen SNP sites related to salt tolerance traits in watermelons, and subsequently identifying key genes related to salt tolerance, holds great potential. Furthermore, developing molecular markers associated with watermelon salt tolerance genes can not only effectively assist in marker-assisted selection for breeding new salt-tolerant watermelon varieties, but also significantly shorten the breeding process and improve the accuracy of selection. Summary of the Invention

[0005] One objective of this invention is to provide a SNP locus for detecting salt tolerance in watermelons. The SNP locus is located on chromosome 4 of the watermelon genome (http: / / cucurbitgenomics.org / , V2), where nucleotide G is mutated to T at position 20966276.

[0006] The second objective of this invention is to provide a pair of molecular marker primers for amplifying the watermelon salt tolerance gene ClDREB2A.

[0007] The third objective of this invention is to provide an application of the above-mentioned molecular markers in watermelon molecular breeding.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] Based on the ClDREB2A gene sequence information on chromosome 4 of the watermelon genome (http: / / cucurbitgenomics.org / , V2), a molecular marker for the salt tolerance gene ClDREB2A was designed. The upstream primer sequence for amplifying the ClDREB2A molecular marker is shown in SEQ.ID.NO.1, and the downstream primer sequence is shown in SEQ.ID.NO.2.

[0010] The molecular marker is named ClDREB2A, and its nucleotide sequence is shown in SEQ ID NO.3. The SNP site is located at position 965 of the SEQ ID NO.3 sequence.

[0011] This invention provides a method for identifying salt tolerance traits in watermelons, targeting the salt tolerance gene ClDREB2A molecular marker. The method includes the following steps:

[0012] (1) Extracting DNA from watermelon plant tissues;

[0013] (2) PCR amplification: The sample extracted in step (1) was amplified by PCR using the primer pair described in claim 1.

[0014] (3) The amplification products in step (2) were detected by electrophoresis, then recovered by gel and ligated into the cloning vector pTOPO-Blunt (Aidlab, catalog number: 301026AX).

[0015] (4) Perform Sanger sequencing on the product using the primers described in the instructions.

[0016] (5) The determination is based on the sequencing results of step (3), and the specific criteria are as follows:

[0017] If the 49th base of the cloned product is G, and its sequence is as shown in SEQ ID NO.4 in the sequence listing, then the watermelon plant to be tested is a salt-tolerant watermelon material. If the 49th base of the cloned product is T, and its sequence is as shown in SEQ ID NO.5 in the sequence listing, then the watermelon plant to be tested is a salt-intolerant watermelon material.

[0018] Specifically, the PCR amplification reaction system in step (2) is: a total volume of 20 μL, including 6 μL H2O, 1 μL 10 mM upstream primer, 1 μL 10 mM downstream primer, 10 μL 2×PCR MIX, and 2 μL DNA. The PCR detection reaction conditions are: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s; 58℃ annealing for 20 s; 72℃ extension for 20 s, for a total of 35 cycles. The agarose gel concentration for electrophoresis detection in step (3) is 1.5%. The ligation system for the cloning vector in step (3) is: pTOPO-Blunt 1 μL, 10x Enhancer 1 μL, gel recovery product 8 μL, and a total volume of 10 μL.

[0019] The present invention also protects a kit for identifying salt tolerance traits, the kit comprising the aforementioned molecular marker primer pair.

[0020] In addition, the above-mentioned kit is protected for its application in identifying or assisting in the identification of salt tolerance traits in watermelons. The kit containing the molecular marker primer pair can be used to identify whether the watermelon plant to be tested is salt-tolerant.

[0021] In addition, reagents for detecting the presence of the aforementioned molecular markers, or kits containing such reagents, can be used for the localization of the watermelon salt-tolerant ClDREB2A gene, specifically employing methods conventional in the art.

[0022] Advantages of this invention:

[0023] On the one hand, the molecular markers of the present invention can achieve the cloning of the salt tolerance gene ClDREB2A fragment, and therefore can be directly used for molecular marker-assisted breeding of salt-tolerant watermelon materials. On the other hand, since molecular markers have the advantages of simplicity, speed and high throughput in assisted breeding systems, the molecular markers provided by the present invention have good application value in the breeding of salt-tolerant new varieties.

[0024] In addition, this molecular marker can be used to accurately and quickly identify the salt tolerance trait of watermelon at the budding or cotyledon stage, and has the advantages of convenient detection and stable amplification products.

[0025] This application presents the first detailed study of genes related to salt tolerance in watermelon. GWAS analysis identified two SNP loci significantly associated with salt tolerance (located at nucleotides 18520851 and 20908124 on chromosome 4, respectively). Localization results revealed 39 genes within a 200 kb region upstream and downstream of these two SNP loci. Expression level measurements of these 39 genes using salt-tolerant and salt-intolerant materials showed that the expression level of the salt-tolerant gene ClDREB2A (Cla97C04G073300) was significantly higher after salt treatment than before. Furthermore, a SNP mutation was found at position 965 of the ClDREB2A coding region, specifically a mutation from nucleotide G to T at position 20966276 on chromosome 4. This single-base mutation also resulted in an amino acid variation (Arg). 322 →Met 322 This discovery led to watermelon's intolerance to salt stress. This finding laid the foundation for the eventual cloning of the ClDREB2A gene and the establishment of a molecular marker-assisted breeding system, and also contributed to the research on the final watermelon salt tolerance regulatory network. In conclusion, because molecular markers are of great significance for the final functional gene localization, and because molecular markers have the advantages of simplicity, speed, and high throughput in establishing molecular marker breeding systems, this application has significant application value and important protective significance for the breeding of new watermelon varieties. Attached Figure Description

[0026] Figure 1 To discover key salt tolerance genes in watermelon seedlings based on GWAS;

[0027] Two SNP sites associated with soluble sugar content were identified using GWAS analysis.

[0028] Figure 1 A represents the use of GWAS analysis to identify SNP sites associated with soluble sugar content; Figure 1 B represents the location of the SNP site on the chromosome; Figure 1 C represents the distribution of candidate genes based on the watermelon genome.

[0029] Figure 2 The expression status of 39 candidate genes.

[0030] Figure 3 Comparison of salt-tolerant and non-salt-tolerant varieties before and after treatment with 150mM NaCl;

[0031] In the figure, TC represents the salt-tolerant variety before NaCl treatment, TT represents the salt-tolerant variety after NaCl treatment, SC represents the non-salt-tolerant variety before NaCl treatment, and ST represents the non-salt-tolerant variety after NaCl treatment.

[0032] Figure 4Electrophoretic images of molecular markers in different salt-resistant materials;

[0033] In the figure, M stands for DL2000 Marker, and the figure shows a 100bp stripe.

[0034] Figure 5 To investigate the structure, sequence comparison, and allele diversity of the watermelon C1DREB2A gene. Figure 5 A represents the location of the SNP site in the genome; Figure 5 B represents the CDS sequence differences at some natural materials' SNP sites; (Since there are many materials, but the results are consistent, the germplasm materials corresponding to the bands will not be described in detail). Detailed Implementation

[0035] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0036] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0038] Biomaterials:

[0039] The salt-tolerant watermelon material "Zhongshihong" and the salt-intolerant material "PI186489" are germplasm resources collected and preserved by the inventor's team. They are high-generation inbred lines, and all traits can be stably inherited.

[0040] All of the above materials can be obtained through commercial channels or from the Diploid Watermelon Genetic Breeding Research Group of the Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences.

[0041] During the experiment, watermelon materials were grown in the intelligent greenhouse of Zhengzhou Fruit Research Institute of Chinese Academy of Agricultural Sciences. After germination, seedlings were raised in plug trays and normal watermelon cultivation and management methods were adopted. Relevant physiological and biochemical indicators were investigated and statistically analyzed at the three-leaf and one-heart stage.

[0042] The primers used for PCR amplification and gene sequencing were provided by Sangon Biotech (Shanghai) Co., Ltd.

[0043] The experimental reagents and equipment used in this invention are all commonly used reagents and equipment for PCR amplification and quantitative PCR, and will not be described in detail here.

[0044] Example 1: Obtaining the key gene ClDREB2A and SNP sites for watermelon salt tolerance

[0045] This embodiment mainly includes the determination of soluble sugar content, GWAS analysis, and gene function annotation of 121 watermelon materials (analysis process as follows). Figure 1 As shown), and the expression level of the ClDREB2A gene (as shown). Figure 2 As shown in the figure, this process involves the final localization of the watermelon salt tolerance gene ClDREB2A and the determination of the SNP site. The relevant experimental procedures are briefly introduced below.

[0046] I. Identification of Salt Tolerance-Related Genes Using GWAS Analysis

[0047] The 121 watermelon materials used were high-generation inbred lines collected and preserved by our team. The description of the salt tolerance evaluation method and the salt tolerance index measurement data are consistent with those described in our team's master's thesis, "Gao Bowen. Preliminary establishment of salt tolerance identification system for watermelon seedlings and transcriptome analysis, Chinese Academy of Agricultural Sciences, 2022".

[0048] The 121 watermelon resequencing data used for GWAS analysis are consistent with the article "Guo Shaogui, et al. Resequencing of 414 cultivated and wild watermelon accessions identifies selection for fruit quality traits. Nature genetics, 2019, 51(11): 1616-1623".

[0049] The results show that:

[0050] Soluble sugar content was significantly correlated with salt tolerance level, and two key SNP sites were identified under the soluble sugar content index. Figure 1 A).

[0051] Based on genome functional annotation results, 39 candidate genes were obtained within a 200 kb candidate region upstream and downstream of two SNP sites. Figure 1 B, 1C, Table 1).

[0052] Table 1. Annotation results of 39 genes

[0053]

[0054]

[0055] II. Identification and SNP analysis of ClDREB2A, a key gene for salt tolerance in watermelon.

[0056] The expression levels of the 39 candidate genes in step (I) above were analyzed. The materials and processing methods used were consistent with those in the article "Yingchun Z, et al. Comparative Transcriptome Profiling Provides Insights into Plant Salt Tolerance in Watermelon (Citrullus lanatus). Life, 2022, 12(7): 1033".

[0057] Real-time PCR system:

[0058] 1 μL 10 mM upstream primer, 1 μL 10 mM downstream primer, 10 μL 2×TB Green fluorescent dye, 2 μL 5×cDNA, 6 μL H2O, total volume 20 μL.

[0059] The reaction conditions for quantitative real-time PCR detection were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s; 58℃ annealing for 10 s; 72℃ extension for 20 s, for a total of 45 cycles.

[0060] The results show that:

[0061] Phenotypic images of salt-tolerant material (Middle Stone Red) and heavily salt-sensitive material (PI186489) before and after treatment with 150mM NaCl are shown below. Figure 3 Furthermore, the expression levels of 39 genes before and after salt treatment were detected, and it was found that Cla97C04G073300 was significantly upregulated under salt stress. Figure 4 Based on its similarity to genes in Arabidopsis thaliana, it was named ClDREB2A. Analysis of resequencing VCF data revealed a SNP in the second exon of ClDREB2A, which is a non-synonymous mutation AG. 965 G→AT 965 G, the amino acid it encodes, has also changed. (Arg) 322 →Met 322 The SNP site is a mutation of nucleotide G to T at position 20966276 on chromosome 4 of the watermelon genome. The molecular marker based on this SNP site is named ClDREB2A, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.3. The SNP site is located at position 965 of the sequence in SEQ ID NO.3.

[0062] The sequence of SEQ ID NO.3 is:

[0063]

[0064] Example 2: Identifying whether watermelon is a salt-tolerant material using the ClDREB2A molecular marker.

[0065] 1. Extracting DNA from watermelon tissue

[0066] DNA was extracted from watermelon roots using a DNA extraction kit.

[0067] The OD values ​​of the DNA sample at 260 nm and 280 nm were measured using a UV spectrophotometer. The DNA content and the OD260 / 280 ratio were calculated. The DNA sample purity OD260 / 280 value should be between 1.8 and 2.0. It should be stored at -20℃ for later use.

[0068] 2. Primer selection

[0069] Based on the molecular marker C1DREB2A, the following primer sequences were designed:

[0070] C1DREB2A-F: 5'-CGGTGATGGAAGGAAAGCC-3' (as shown in SEQ.D.NO.1)

[0071] C1DREB2A-R: 5'-CCCATGTGTTTTTGCCGATC-3' (as shown in SEQ.D.NO.2)

[0072] Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the working concentration was 10 μM.

[0073] 3. PCR reaction system

[0074] The PCR reaction procedure was performed according to the standard protocol. The PCR reaction system was as follows:

[0075] The total volume is 20 μL, including 6 μL H2O, 1 μL 10 mM upstream primer, 1 μL 10 mM downstream primer, 10 μL 2×PCRMIX, and 2 μL DNA.

[0076] The PCR amplification procedure is as follows:

[0077] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s; annealing at 58℃ for 20 s; extension at 72℃ for 20 s, for a total of 35 cycles, and storage at 4℃.

[0078] The PCR amplification products were detected by 1.5% agarose gel electrophoresis. During electrophoresis, the electrophoresis buffer was 1×TAE, and the electrophoresis was performed at a constant voltage of 180V for 20-30 minutes. After electrophoresis, gel imaging was performed for observation (e.g.,...). Figure 4 (As shown).

[0079] 4. Sanger sequencing

[0080] All PCR products were collected and Sanger sequenced. If the 49th base of the cloned product is G and its sequence is as shown in SEQ ID NO.4 in the sequence listing, then the watermelon plant to be tested is a salt-tolerant watermelon material. If the 49th base of the cloned product is T and its sequence is as shown in SEQ ID NO.5 in the sequence listing, then the watermelon plant to be tested is a salt-intolerant watermelon material.

[0081] By performing Sanger sequencing on the test material and comparing the sequences, it can be determined whether the watermelon belongs to a salt-tolerant variety. Figure 5 ).

[0082] The sequence of SEQ ID NO.4 is:

[0083] CGGTGATGGAAGGAAAGCCAATGGAGATAGAGAGCTATGGAGATTGTA G GGCCTTCAACCGTGATCTGAGTTTGTTGCTGGATCGGCAAAAACACATGGG;

[0084] The sequence of SEQ ID NO.5 is:

[0085] CGGTGATGGAAGGAAAGCCAATGGAGATAGAGAGCTATGGAGATTGTA T GGCCTTCAACCGTGATCTGAGTTTGTTGCTGGATCGGCAAAAACACATGGG.

[0086] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A primer pair of a molecular marker of a SNP site for detecting salt tolerance traits of watermelon in identifying salt tolerance traits of watermelon, characterized in that, The SNP site is the mutation of nucleotide G to T at the 20966276th nucleotide on the 4th chromosome of the watermelon genome, the nucleotide sequence of the molecular marker based on the site is shown as SEQ ID NO. 3, the SNP site is located at the 965th position of the sequence of SEQ ID NO. 3, the sequence of the upstream primer of the primer pair for amplifying the molecular marker is shown as SEQ ID NO. 1, and the sequence of the downstream primer is shown as SEQ ID NO.

2.

2. A method for identifying salt tolerance in watermelon, characterized by, The method comprises the following steps: (1) extracting DNA of watermelon plant tissue; (2) PCR amplification: using the primer pair of the molecular marker in claim 1, the sample extracted in step (1) is subjected to PCR amplification; (3) Sanger sequencing of the product; (4) determining according to the sequencing result of step (3), and the specific standard is: If the 49th base of the cloning product is G, and the sequence is shown as SEQ ID NO. 4 in the sequence table, the watermelon plant to be tested is a salt-tolerant watermelon material, and if the 49th base of the cloning product is T, and the sequence is shown as SEQ ID NO. 5 in the sequence table, the watermelon plant to be tested is a salt-intolerant watermelon material.

3. The method of claim 2, wherein, The reaction system of the PCR amplification in step (2) is 20 μL in total volume, including 6 μL H2O, 1 μL 10 mM upstream primer, 1 μL 10 mM downstream primer, 10 μL 2x PCR MIX, and 2 μL DNA; the reaction conditions for PCR detection are: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s; 58°C annealing for 20 s; 72°C extension for 20 s, a total of 35 cycles; the concentration of agarose gel for electrophoresis detection in step (3) is 1.5%; the system for connecting the cloning vector in step (3) is: pTOPO-Blunt 1 μL, 10x Enhancer 1 μL, gel recovery product 8 μL, total volume 10 μL.

4. Use of a kit for identifying or aiding in the identification of salt tolerance traits in watermelon, characterized in that, The kit comprises a primer pair, and the sequence of the upstream primer of the primer pair is shown as SEQ ID NO. 1, and the sequence of the downstream primer is shown as SEQ ID NO. 2.

Images