A novel cuped virus FCV detection real-time fluorescent quantitative PCR primer system, detection method and application
By designing specific primers and constructing recombinant plasmids, combined with real-time quantitative PCR technology, the problems of rapid, simple, sensitive and specific detection of novel caliciviruses have been solved, achieving efficient quantitative detection that is suitable for the economic development of aquaculture.
Patent Information
- Application Number
- CN202311023859.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-15
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2043-08-15
AI Technical Summary
There is a lack of effective detection methods in the current technology to quickly, easily, sensitively and specifically detect novel calicivirus FCV, especially in fish, which causes large-scale outbreaks and leads to economic losses in the aquaculture industry.
Specific primers FCV-qPF and FCV-qPR were designed and synthesized, and the recombinant plasmid pMD18-Calicivirus-RdRp was constructed. A real-time quantitative PCR detection system was established, and the quantitative detection of the novel calicivirus was achieved through a standard curve. Combined with SYBR Green I real-time quantitative PCR technology, the experimental steps were simplified and the detection efficiency was improved.
It has achieved rapid, simple, sensitive and highly specific quantitative detection of novel caliciviruses, with a detection limit of 10³ copies/μL, which is 1000 times that of conventional PCR. It has good repeatability, with an intra-group coefficient of variation of 1.001% and an inter-group coefficient of variation of 2.559%, filling the gap in detection technology at home and abroad.
Smart Images

Figure CN116949219B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of virus detection technology, specifically to a novel real-time fluorescence quantitative PCR primer system, detection method, and application for the detection of calicivirus FCV. Background Technology
[0002] Caliciviridae is a family of viruses in the order Picornavirales. Their genomes consist of linear, single-stranded, positive-sense, unsegmented RNA molecules containing coding sequences in two or more partially overlapping open reading frames (ORFs). ORF1 encodes a polyprotein. Members of the Caliciviridae family encode a major structural capsid protein, VP1, while norovirus, reovirus, and poxvirus also have a smaller structural capsid protein, VP2. This family has been detected in various vertebrates and is currently divided into 11 genera: 7 genera infect mammals (Vesivirus, Valovirus, Sapovirus, Recovirus, Nebovirus, Norovirus, and Lagovirus), 2 genera infect birds (Bavovirus and Nacovirus), and 2 genera infect fish (Minovirus and Salovirus). In 2020, an outbreak of a disease of unknown cause occurred in Hubei, Zhejiang and other places, resulting in the death of a large number of fish and causing huge economic losses to the aquaculture industry. After analysis, the hemorrhagic virus pathogen was identified as a calicivirus pathogen in fish for the first time.
[0003] This study investigated viral communities in different fish tissues using emerging metagenomics methods. Fish from the Lhasa River in the Tibet Autonomous Region of China were collected, with specimens taken from the gills, intestinal contents, liver, muscle, swim bladder, heart, and brain. DNA libraries were constructed and high-throughput sequencing was performed. After splicing and comparing the sequencing results, a fragment of a similar calicivirus was obtained, which is related to a strain of *Plasmodium spp.* from southern Guangdong Province, China. The strain is most similar to the calicivirus found in the study, with both the polyprotein and VP2 segments showing 80.22% protein sequence similarity. Phylogenetic analysis revealed that this calicivirus belongs to the calicivirus genus and was named a novel calicivirus (FCV, NCBI GenBank number: OP933700).
[0004] Caliciviruses are rapidly evolving viruses that cause global pandemics associated with significant morbidity and mortality. Currently, there are no reports of various detection methods for this virus, both domestically and internationally, and research on this virus is still in its nascent stage. Therefore, there is an urgent need to establish a comprehensive primer system and detection method. SUMMARY
[0005] In order to solve the above problems in the prior art, the application provides a real-time fluorescent quantitative PCR primer system for detecting a new calicivirus FCV, a detection method and application.
[0006] To achieve the above object, the application adopts the technical scheme comprising:
[0007] The application provides a real-time fluorescent quantitative PCR primer system for detecting a new calicivirus FCV, which comprises a primer FCV-qPF and a primer FCV-qPR; the nucleotide sequence of the primer FCV-qPF is shown as Seq_1 in the sequence table, i.e., TTCGACGTTCACGACACAGT; the nucleotide sequence of the primer FCV-qPR is shown as Seq_2 in the sequence table, i.e., TCGGCGTCCATAACATACCG; and each pair of primers in the primer system is mixed in equimolar amount.
[0008] Preferably, the new calicivirus is Fish calicivirus.
[0009] The application further provides application of the real-time fluorescent quantitative PCR primer system in a Fish calicivirus virus detection reagent.
[0010] Further, the application further provides a kit for quantitatively detecting a new calicivirus, which comprises the real-time fluorescent quantitative PCR primer system, Taq DNA polymerase, a positive control, a negative control and a PCR reaction premix.
[0011] Preferably, the ratio of the primer system, Taq DNA polymerase, positive control, negative control and PCR reaction premix is 1.8 μL:25 μL:1 μL:1 μL:5 μL:3.80 μL; the primer FCV-qPF and the primer FCV-qPR in the primer system are mixed in equal proportion, and the PCR reaction premix contains 2×SYBR Green Ⅰ Mix and nuclease-free water in a volume ratio of 5 μL:3.80 μL.
[0012] Further, the application further provides a method for detecting a new calicivirus by real-time fluorescent quantitative PCR, which comprises the following steps:
[0013] (1) According to the gene sequence of the RdRp fragment of the new calicivirus, multiple sequence alignment is performed, the conserved sequence region of the new calicivirus is selected, and specific primers FCV-qPF and FCV-qPR are designed, the nucleotide sequence of FCV-qPF is shown as Seq_1 in the sequence table, and the nucleotide sequence of FCV-qPR is shown as Seq_2 in the sequence table;
[0014] (2) The viral cDNA is obtained by reverse transcription taking the new calicivirus RNA as a template, the primers FCV-qPF and FCV-qPR designed in step (1) are used for PCR amplification, the target gene DNA fragment is obtained by recovering the PCR product, the TA cloning is performed on the recovered product, and the ligation product is transformed into DH5α E. coli competent cells, the positive clone bacteria liquid is selected, and the recombinant plasmid pMD18-Calicivirus-RdRp standard is obtained;
[0015] (3) The recombinant plasmid pMD18-Calicivirus-RdRp standard obtained in step (2) is prepared into a series of concentration gradient recombinant plasmid standard solutions by 10 times dilution, and SYBR Green I real-time fluorescent quantitative PCR is performed using specific primers FCV-qPF and FCV-qPR, taking the logarithmic value of the copy number concentration of the recombinant plasmid standard as the abscissa and the Ct value as the ordinate, and a standard curve is established;
[0016] (4) The RNA of the sample to be tested is extracted, the viral cDNA is obtained by reverse transcription, which is used as a template, and SYBR Green I real-time fluorescent quantitative PCR is performed using specific primers FCV-qPF and FCV-qPR, and the Ct value obtained is brought into the standard curve established in step (3), so as to realize real-time fluorescent quantitative detection of the new calicivirus in the sample to be tested.
[0017] Preferably, the multiple sequence alignment in step (1) is performed according to the gene sequence of the RdRp fragment of the new calicivirus, and the sequences of the calicivirus in GenBank are aligned by MEGA-X software using MUSCLE, and the alignment results are imported into Geneious Prime software to obtain the conserved sequence region of the new calicivirus.
[0018] The DNA fragment of the recombinant plasmid pMD18-Calicivirus-RdRp standard in step (2) has a size of 2864 bp.
[0019] The standard curve in step (3) is y=-3.6584x+47.346, and the correlation coefficient R 2 is 0.9903.
[0020] The copy number concentration of the recombinant plasmid standard in step (3) is 2.13*10 3 ~2.13*10 10 copies / μL.
[0021] The reaction system of the real-time fluorescent quantitative PCR in step (3) and step (4) is 2*SYBR Green I Mix 5 μL, FCV-qPF (10 μM) 0.10 μL, FCV-qPR (10 μM) 0.10 μL, DNA template to be detected 1.00 μL, nuclease-free water 3.80 μL, and the total volume is 10.00 μL.
[0022] The reaction program of the real-time fluorescent quantitative PCR in step (3) and step (4) is as follows: 95 ℃ pre-denaturation for 30 s; 95 ℃ denaturation for 10 s; 60 ℃ annealing for 30 s.
[0023] Compared with the prior art, the application has the beneficial effects that:
[0024] The application designs and synthesizes specific primers according to the gene sequence of the RdRp fragment of the novel calicivirus, constructs a recombinant plasmid pMD18-Calicivirus-RdRp, establishes a standard curve by taking the recombinant plasmid as a standard, establishes a real-time fluorescent quantitative PCR detection system for the novel calicivirus, and realizes quantitative detection of the novel calicivirus. The specific primers have no specific amplification for multiple viruses such as SeV; the recombinant plasmid with a concentration of 10 3 copies / μL is 1000 times that of conventional PCR; the maximum variation coefficient of intra-group repetition is 1.001%, and the maximum variation coefficient of inter-group repetition is 2.559%, so that the application has the advantages of high specificity and sensitivity, good repeatability and short time consumption. The detection result of the application can be directly read by computer software, without the need of agarose gel electrophoresis and gel imaging detection, so that the experimental steps are simplified and the detection time is saved. The application provides a new detection method for the novel calicivirus, fills the blank in the related technical field at home and abroad, provides a basis for diagnosing the novel calicivirus infection, plays a significant role in the economy and development of aquaculture, and has a good application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 is an optimization result diagram of the annealing temperature of the fluorescent quantitative PCR for the novel calicivirus (FCV) ;
[0026] Figure 2 is an optimization result diagram of the primer concentration of the fluorescent quantitative PCR for the novel calicivirus (FCV) ;
[0027] Figure 3 is a standard curve diagram of the fluorescent quantitative PCR for the novel calicivirus (FCV) ;
[0028] Figure 4 is a new calicivirus (FCV) real-time fluorescent quantitative PCR specificity verification comparison chart;
[0029] Figure 5 is a new calicivirus (FCV) conventional PCR sensitivity verification chart;
[0030] Figure 6 is a new calicivirus (FCV) real-time fluorescent quantitative PCR sensitivity verification chart. DETAILED DESCRIPTION
[0031] The specific embodiments of the present application are described below to facilitate the understanding of the present application for those skilled in the art, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, it is obvious that various changes are within the spirit and scope of the present application defined and determined by the appended claims, and all the inventions utilizing the concept of the present application are within the scope of protection.
[0032] Example 1: Sequence alignment and primer design of new calicivirus (FCV)
[0033] According to the gene sequence of the RdRp fragment of the newly discovered new calicivirus (NCBI GenBank number: OP933700) in the previous study, the region has a total length of 906 bp, and the nucleotide sequence is shown as Seq_3 in the sequence table; MUSCLE is used for multiple sequence alignment by MEGA-X software (v10.1.8), and the alignment results are imported into Geneious Prime software (v2019.0.4). According to the multiple sequence alignment results, the conserved sequence region of calicivirus is selected, and the primers FCV-qPF and FCV-qPR are designed; the nucleotide sequence of FCV-qPF is shown as Seq_1 in the sequence table, that is: TTCGACGTTCACGACACAGT; the nucleotide sequence of FCV-qPR is shown as Seq_2 in the sequence table, that is: TCGGCGTCCATAACATACCG. The specificity of the primers is verified by NCBI Primer-BLAST function (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ), the length of the amplification product is 170 bp, and the primers are synthesized by Sheng Wu Biotechnology (Shanghai) Co., Ltd.
[0034] Example 2: Construction of new calicivirus (FCV) recombinant plasmid pMD18-Calicivirus-RdRp
[0035] Fish collected in Lhasa River, Tibet Autonomous Region, China in 2020 were selected as samples. The samples were taken from the gills, intestinal contents, liver, muscle, swim bladder, heart, and brain of the fish (the samples were stored at -80°C for a long time). After grinding, the samples were resuspended in 1 mL of DPBS (Hyclone) and repeatedly frozen and thawed three times. After centrifugation at 15000 g and 4°C for 10 min, 200 μL of supernatant was taken, and viral nucleic acid was extracted using a viral nucleic acid extraction kit (TaKaRa). The extracted viral RNA was used as a template for reverse transcription to obtain viral cDNA. The reverse transcription reaction steps are shown in Table 1.
[0036] Table 1. Reverse transcription reaction steps
[0037]
[0038]
[0039] Gently mix, spin down, and react at 65°C for 5 min, then immediately place on ice for 2 min. Then add the reverse transcription reaction reagents shown in Table 2 according to the steps.
[0040] Table 2. Reverse transcription reaction reagents
[0041]
[0042] Gently mix, spin down, and react at 25°C for 5 min, then react at 42°C for 60 min, and heat at 70°C for 5 min to terminate the reaction.
[0043] After reverse transcription, the cDNA of the new calicivirus was used as a template, and primers FCV-qPF and FCV-qPR were used for PCR amplification of the target gene DNA fragment. The PCR amplification reaction system is shown in Table 3, and the PCR reaction program is shown in Table 4.
[0044] Table 3. PCR amplification reaction system
[0045]
[0046] Table 4. PCR amplification reaction program
[0047]
[0048]
[0049] After 1.0% agarose gel electrophoresis of the PCR product, the specific band with the desired fragment size (170 bp) was cut and recovered using a DNA gel recovery kit (Kangwei Century). The recovered product was subjected to TA cloning. The reaction system is shown in Table 5.
[0050] Table 5. Reaction system
[0051]
[0052] Gently mix, instantaneous spin centrifugation, reaction at 16℃ for 4h. The ligation product is transformed into DH5α E. coli competent cells (Novagen), and after overnight culture at 37℃, single colony is picked into LB medium containing ampicillin antibiotic for 4h, followed by bacterial liquid PCR, and positive clone liquid is selected for first-generation sequencing (Shenguo Bio). The sequencing results are compared with the sequence of the new calicivirus (FCV) RdRp fragment (170bp) by MEGA-X software (v10.1.8), and the positive clone liquid with the same comparison result is selected and transferred to 15mL LB medium containing ampicillin antibiotic, and cultured overnight at 37℃. The endotoxin-free plasmid extraction kit (Kangwei Century) is used to extract the plasmid, and the recombinant plasmid pMD18-Calicivirus-RdRp (2864bp) standard is obtained. The obtained recombinant plasmid has an OD260 / OD280 ratio of 1.8-2.0, high purity, and can be used for subsequent standard curve establishment experiment.
[0053] Example 3: Optimization and establishment of SYBR Green I fluorescent quantitative PCR detection method for new calicivirus (FCV)
[0054] The recombinant plasmid pMD18-Calicivirus-RdRp standard is used as a template, and the optimal annealing temperature is selected at 60℃ from 50℃ to 60℃, and the optimal primer final concentration is selected at 0.10μM from 0.10μM to 0.35μM. Figure 1 is the optimization result diagram of the annealing temperature of the new calicivirus (FCV) fluorescent quantitative PCR; wherein, M: DNA ladder marker; 1: 50℃; 2: 52℃; 3: 54℃; 4: 56℃; 5: 58℃; 6: 60℃; 7: Negative control.
[0055] Figure 2 is the optimization result diagram of the primer concentration of the new calicivirus (FCV) fluorescent quantitative PCR; wherein, M: DNA ladder marker; 1: primer final concentration 0.10μM; 2: primer final concentration 0.15μM; 3: primer final concentration 0.20μM; 4: primer final concentration 0.25μM; 5: primer final concentration 0.30μM; 6: primer final concentration 0.35μM; 7: Negative control. Figure 1 , 2 The SYBR Green I fluorescent quantitative PCR reaction system is shown in Table 6 as shown in Table 6; the real-time fluorescent quantitative PCR reaction program is shown in Table.
[0056] Table 6. Fluorescent quantitative PCR reaction system
[0057]
[0058] Table 7. Fluorescent quantitative PCR reaction procedure
[0059]
[0060] Note: The melting curve acquisition procedure is different for different types of instruments, and the default melting curve acquisition procedure of the instrument can be used.
[0061] Example 4: Establishment of standard curve for new calicivirus (FCV) SYBR Green I fluorescent quantitative PCR detection method
[0062] The molecular weight of the recombinant plasmid standard pMD18-Calicivirus-RdRp obtained according to Example 2 was converted to copy number concentration, and the formula used was copies / μL=(6.02x10 23 ) x (ng / μL x 10 -9 ) / (DNA length x 660). The recombinant plasmid pMD18-Calicivirus-RdRp was diluted 10 times to prepare a series of recombinant plasmid standard solutions with gradient concentrations, and SYBR Green I real-time fluorescent quantitative PCR was performed using specific primers FCV-qPF and FCV-qPR with different concentrations of recombinant plasmid standard solution as templates. The real-time fluorescent quantitative PCR system and reaction procedure were the same as in Example 3.
[0063] Figure 3 is a standard curve for new calicivirus (FCV) fluorescent quantitative PCR; as shown in Figure 3 , the log value of the copy number concentration of the recombinant plasmid standard is taken as the abscissa, and the Ct value is taken as the ordinate, to obtain a linear regression equation and establish a standard curve. The straight line equation is y=-3.6584x+47.346, and the correlation coefficient (R 2 ) is 0.9903. When the concentration of the recombinant plasmid pMD18-Calicivirus-RdRp is 2.13x10 3 ~2.13x10 10 copies / μL, there is a good linear relationship between the Ct value and the log of the copy number concentration of the recombinant plasmid.
[0064] Example 5: Specificity verification of new calicivirus (FCV) SYBR Green I fluorescent quantitative PCR detection method
[0065] The Sendai virus (SeV), vesicular stomatitis virus (VSV), porcine delta coronavirus (PDCoV), Japanese encephalitis virus (JEV), fish papillomavirus nucleic acid and deer parvovirus nucleic acid are preserved by the laboratory. The virus nucleic acid extraction kit (TaKaRa) is used to extract JEV, SeV, VSV and PDCoV virus nucleic acid. The RNA virus nucleic acid is obtained by reverse transcription PCR to obtain cDNA. The recombinant plasmid pMD18-Calicivirus-RdRp standard solution, the extracted virus DNA and the reverse-transcribed virus cDNA are used as templates, and the nuclease-free water (negative control) is used as a blank control, and the established new calicivirus SYBR Green I fluorescent quantitative PCR detection system is used for analysis.
[0066] Figure 4 is a new calicivirus (FCV) real-time fluorescent quantitative PCR specificity verification comparison chart; in the figure, 1: pMD18-Calicivirus-RdRp; 2: negative control; 3: SeV; 4: JEV; 5: PDCoV; 6: VSV; 7: parvovirus; 8: Fish papillomavirus; as shown in Figure 4 , only the qPCR sample with pMD18-Calicivirus-RdRp as the template has a typical amplification curve. The control viruses and the blank control have no obvious peak value, indicating that the new calicivirus SYBR Green I fluorescent quantitative PCR detection method established by the application has the specificity of detecting FCV.
[0067] Example 6: Sensitivity verification of new calicivirus (FCV) SYBR Green I fluorescent quantitative PCR detection method
[0068] The recombinant plasmid pMD18-Calicivirus-RdRp is diluted by 10 times to obtain 2.13×10 3 ~2.13×10 10 copies / μL of a series of concentration gradient recombinant plasmid standard solutions, and different concentrations of recombinant plasmid standard solutions are used as templates, and nuclease-free water is used as a blank control, and conventional PCR and real-time fluorescent quantitative PCR detection are performed.
[0069] Figure 6 is a new calicivirus (FCV) conventional PCR sensitivity verification chart; in the figure, numbers 1-11 represent 2.13×10 10 copies / μL, 2.13×10 9copies / μL, 2.13 x 10 8 copies / μL, 2.13 x 10 7 copies / μL, 2.13 x 10 6 copies / μL, 2.13 x 10 5 copies / μL, 2.13 x 10 4 copies / μL, 2.13 x 10 3 copies / μL, 2.13 x 10 2 copies / μL, 2.13 x 10 1 copies / μL, Negative control. As shown in Figure 5 , the detection lower limit of routine PCR is 10 6 copies / μL. Figure 6 is a new feline calicivirus (FCV) real-time fluorescent quantitative PCR sensitivity verification chart;
[0070] In the figure, numbers 1-9 represent 2.13 x 10 10 copies / μL, 2.13 x 10 9 copies / μL, 2.13 x 10 8 copies / μL, 2.13 x 10 7 copies / μL, 2.13 x 10 6 copies / μL, 2.13 x 10 5 copies / μL, 2.13 x 10 4 copies / μL, 2.13 x 10 3 copies / μL, Negative control. As shown in Figure 6 , the detection lower limit of real-time fluorescent quantitative PCR is 10 3 copies / μL, so the sensitivity of real-time fluorescent quantitative PCR is 1000 times that of routine PCR.
[0071] Example 7: Reproducibility verification of new feline calicivirus (FCV) SYBR Green I fluorescent quantitative PCR detection method
[0072] Select 2.13 x 10 5 ~ 2.13 x 10 7 copies / μL 3 dilution gradient recombinant plasmid standard solution as template for intra-group and inter-group real-time fluorescent quantitative PCR reaction, with standard deviation (SD) and coefficient of variation (CV) of Ct value as judgment standard.
[0073] Table 8. Results of repeatability experiment of the new calicivirus SYBR Green I fluorescent quantitative PCR detection method
[0074]
[0075] As shown in Table 8, the maximum coefficient of variation of the new calicivirus (FCV) SYBR Green I fluorescent quantitative PCR detection system is 1.001% for intra-group repeatability and 2.559% for inter-group repeatability, indicating that the detection system established in the application has good repeatability.
[0076] Example 8: Detection of new calicivirus (FCV) in fish samples
[0077] The virus nucleic acid of 20 different fish samples was extracted and reverse transcribed, and the 20 virus nucleic acids were detected for FCV using the real-time fluorescent quantitative PCR detection system established in the application. The Ct value obtained was compared with the standard curve established in the application. When the virus nucleic acid concentration was lower than the lower limit of detection 2.13 x 10 3 copies / μL, the detection result was determined to be negative.
[0078] Table 9. Detection results of new calicivirus (FCV) in 20 fish samples
[0079]
[0080] Note: +, positive; -, negative.
[0081] As shown in Table 9, among the 20 samples, the virus detection rate by the real-time fluorescent quantitative PCR established in the application was 20%, while the virus detection rate by the conventional PCR was 0%, indicating that the application can be used for the detection of FCV in fish samples, and the detection effect is better. It is proved that the establishment of the application fills the technical gap for the detection of the new calicivirus, and has a high detection rate. The virus detected by the application is a new calicivirus in the tissues of Chinese plateau fish discovered by the laboratory. There was no related research before, which filled the gap in the detection technology field of the new calicivirus at home and abroad.
[0082] The application is based on the RdRp fragment gene sequence of the newly discovered new calicivirus (FCV), and specific primers are designed and synthesized. The specific primers have no specific amplification for SeV and other viruses, and have high sensitivity, and can detect 10 3 copies / μL of recombinant plasmid, which is 1000 times that of conventional PCR; at the same time, the repeatability is good, the maximum coefficient of variation of intra-group repeatability is 1.001%, and the maximum coefficient of variation of inter-group repeatability is 2.559%.
[0083] In conclusion, the novel FCV detection method provided by the application has the advantages of high specificity and sensitivity, good repeatability and short time consumption.
[0084] The above only describes the preferred embodiments of the application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the application, and these improvements and refinements should also be considered as the protection scope of the application.
Claims
1. A kit for quantitatively detecting a new calicivirus, characterized by comprising: The real-time fluorescent quantitative PCR primer system for detecting the new calicivirus FCV, Taq DNA polymerase, positive control, negative control and PCR reaction premix are included; the primer system includes primer FCV-qPF and primer FCV-qPR; The nucleotide sequence of FCV-qPF is shown in SEQ ID NO: 1 in the sequence listing, i.e. TTCGACGTTCACGACACAGT; the nucleotide sequence of FCV-qPR is shown in SEQ ID NO: 2 in the sequence listing, i.e. TCGGCGTCCATAACATACCG; the primers in the primer system are mixed in equimolar amount, and the new calicivirus is Fish calicivirus with GenBank number OP933700.
2. A method for detecting the new calicivirus for non-diagnostic purposes by real-time fluorescent quantitative PCR, comprising the following steps: (1) selecting a conserved sequence region of the new calicivirus according to the multiple sequence alignment of the gene sequence of RdRp fragment of the new calicivirus, designing specific primers FCV-qPF and FCV-qPR, the nucleotide sequence of FCV-qPF is shown in SEQ ID NO: 1 in the sequence listing, and the nucleotide sequence of FCV-qPR is shown in SEQ ID NO: 2 in the sequence listing, and the gene sequence of RdRp fragment is shown in SEQ ID NO: 3 in the sequence listing; (2) obtaining virus cDNA by reverse transcription with the new calicivirus RNA as a template, performing PCR amplification with the primers FCV-qPF and FCV-qPR designed in step (1), recovering the PCR product to obtain the target gene DNA fragment, performing TA cloning on the recovered product, and transforming the ligation product into DH5α E. coli competent cells, selecting positive clone bacteria liquid to obtain recombinant plasmid pMD18-Calicivirus-RdRp standard; (3) preparing a series of concentration gradient recombinant plasmid standard solutions by 10-fold dilution of the recombinant plasmid pMD18-Calicivirus-RdRp standard obtained in step (2), and using the same as a template to perform SYBR Green I real-time fluorescent quantitative PCR with specific primers FCV-qPF and FCV-qPR, taking the logarithmic value of the copy number concentration of the recombinant plasmid standard as the abscissa and the Ct value as the ordinate to establish a standard curve; (4) extracting the RNA of the sample to be tested, reverse transcribing to obtain virus cDNA, taking the same as a template, and performing SYBR Green I real-time fluorescent quantitative PCR with specific primers FCV-qPF and FCV-qPR, and bringing the obtained Ct value into the standard curve established in step (3) to realize real-time fluorescent quantitative detection of the new calicivirus in the sample to be tested; the standard curve in step (3) is y = -3.6584x + 47.346, and the correlation coefficient R2 is 0.9903.
3. The method of claim 2, wherein, The multiple sequence alignment in step (1) is a multiple sequence alignment of the gene sequence of the RdRp fragment of the novel calicivirus and the calicivirus sequence in GenBank by MEGA-X software using MUSCLE, and the alignment result is introduced into Geneious Prime software to obtain the conserved sequence region of the novel calicivirus.
4. The method of claim 2, wherein, The size of the DNA fragment of the recombinant plasmid pMD18-Calicivirus-RdRp standard in step (2) is 2864 bp.
5. The method of claim 2, wherein, The copy number concentration of the recombinant plasmid standard in step (3) was 2.13 x 10 3 2.13 x 10 10 copies / μL.
6. The method of claim 2, wherein, The reaction system of the real-time fluorescent quantitative PCR in steps (3) and (4) is 2×SYBR Green Ⅰ Mix 5 μL, FCV-qPF 0.10 μL, FCV-qPR 0.10 μL, DNA template to be detected 1.00 μL, nuclease-free water 3.80 μL, and the total volume is 10.00 μL.
7. The method of claim 2, wherein, The reaction program of the real-time fluorescent quantitative PCR in steps (3) and (4) is: 95℃ pre-denaturation for 30s; 95℃ denaturation for 10s; 60℃ annealing for 30s.
Citation Information
Patent Citations
Real-time fluorescent quantitative RT-PCR detection method for bovine norovirus
CN110885908A