Application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus edulis

Abstract

The present invention relates to the field of microbial technology, and discloses the application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus. By providing a new microbial strain, Rhizopus microsporus HR3-26, and allowing Rhizopus microsporus HR3-26 to grow moderately in Boletus powder added with sucrose to produce a variety of hydrolases. Subsequently, the fermented Boletus powder is heated with water, and substances such as cellulose in the cell wall are hydrolyzed, which helps the bound polyphenols in Boletus to dissolve during ethanol ultrasonic treatment, thereby significantly improving the extraction rate of polyphenols. When the present invention applies Rhizopus microsporus HR3-26 to the extraction of polyphenols from Boletus, compared with the conventional extraction method of ethanol ultrasonic treatment, the extraction rate of polyphenols can be increased by 28.4%.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly to the application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus edulis. Background Art

[0002] Boletus edulis is a general term for fungi in the family Boletaceae. There are 35 genera and more than 787 species in this family. Among them, except for a few species whose fruiting bodies are poisonous or bitter and inedible, the fruiting bodies of most species are fleshy and thick, and the caps are thick. The color is very similar to that of a bovine liver. After being cooked thoroughly, it tastes like a bovine liver, so it is named "Boletus edulis". Common edible Boletus edulis varieties in China include Boletus edulis ( Boletus edulis , also known as white Boletus edulis), Boletus aurantiaco-olivaceus ( Boletus citrifragrans ), Boletus luridus ( Boletus auripes ), Boletus aereus ( Boletus nigricans ), and Boletus erythropus ( Boletus erythropus ) etc.

[0003] Boletus edulis tastes delicious and is rich in nutrients. It belongs to one of the "Four King Mushrooms", and people all over the world have the habit of eating Boletus edulis. Boletus edulis is rich in polysaccharides, proteins, polyphenols, amino acids, boletine, triterpenes, vitamins, minerals and other substances. Eating Boletus edulis has the effects of clearing heat and relieving vexation, tonifying deficiency and refreshing the mind on the human body. It can treat symptoms such as pain in the waist and legs, numbness of hands and feet, and also has the effect of anti-influenza virus and preventing colds. In traditional Chinese medicine, it has the effects of promoting digestion and regulating the middle energizer, dispelling wind-cold, and relaxing tendons and collaterals, and is mainly used to treat symptoms such as less food and abdominal distension, pain in the waist and legs, numbness of hands and feet, etc. Wild Boletus edulis is scarce and belongs to precious food. In recent years, due to the gradual maturity of artificial cultivation technology, the supply of Boletus edulis in the market has increased, and it has become an ordinary dish on people's tables.

[0004] Natural polyphenols have good antioxidant, anti-aging, antibacterial, blood pressure-lowering and preventing cardiovascular and cerebrovascular diseases and other biological activities. The polyphenol content in Boletus edulis is relatively high. Extracting polyphenols from Boletus edulis and applying them to the food field has broad prospects.

[0005] At present, there are not many research reports on the extraction of polyphenols from Boletus edulis. In the reported research, the main method for polyphenol extraction is ethanol extraction. The conventional ethanol extraction method is simple in operation, but the extraction yield is often not high. On the basis of the ethanol extraction method, supplemented with ultrasonic treatment, it can promote the dissolution of polyphenols, and the extraction yield has a certain degree of increase. The ultrasonic-assisted extraction method has low equipment requirements and will not significantly increase the extraction cost, but the improvement effect on the extraction yield is not significant enough.

[0006] In recent years, enzymatic hydrolysis technology has been widely used in the extraction of natural active substances. It has the advantages of mild conditions, little damage to the structure of active ingredients, and can significantly improve the extraction yield of products. In the enzymatic hydrolysis-assisted extraction method, cellulase is the most used, followed by pectinase and protease, or multiple enzymes are used simultaneously. The cell walls of plants or edible fungi are composed of substances such as cellulose, hemicellulose, lignin, and pectin. Therefore, using a single enzyme alone has very limited effect on improving the extraction yield of products. Many studies use multiple enzymes (complex enzymes) simultaneously. If the amount of enzyme used is large, it will undoubtedly increase the extraction cost.

[0007] Natural substances in nature are decomposed and decayed by microorganisms. These microorganisms can produce various enzymes that decompose plant or edible (medicinal) fungal tissues during their growth process, including cellulase, hemicellulase, ligninase, and pectinase, etc. However, relying on the action of microorganisms to improve the extraction yield of polyphenols from Boletus has not been effectively applied. Summary of the Invention

[0008] The extraction yield of polyphenols from Boletus by the existing method is low. To solve this technical problem, the present invention provides the application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus.

[0009] One of the purposes of the present invention is to provide a new microbial strain - Rhizopus microsporus ( Rhizopus microsporus ), HR3-26. By inoculating this strain into Boletus for microbial fermentation, the extraction yield of polyphenols in Boletus can be greatly improved.

[0010] Another purpose of the present invention is to provide a method for the application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus - controlling the growth degree of Rhizopus microsporus HR3-26 to achieve enzyme production and hydrolysis of the cell wall of Boletus, but not decomposing soluble polyphenols, thereby promoting the dissolution of polyphenols in Boletus and finally improving the extraction yield.

[0011] The specific technical solution of the present invention is as follows:

[0012] On the one hand, the present invention provides a strain of Rhizopus microsporus ( Rhizopus microsporus ), HR3-26, and its preservation number is GDMCC No: 63394.

[0013] The present invention isolated strain HR3 from the microbial enrichment of Boletus powder. After ultraviolet mutagenesis, strain HR3-26, namely Rhizopus microsporus ( Rhizopus microsporus)HR3-26, the strain is deposited in Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No: 63394, the deposit date is April 24, 2023, the address is: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province; Postal Code 510070. The present invention provides a new microbial strain - Rhizopus microsporus ( Rhizopus microsporus )HR3-26, and the strain was inoculated into boletus for microbial fermentation, which greatly improved the extraction rate of polyphenols in boletus.

[0014] The nucleotide sequence of the ribosomal DNA internal transcribed spacer region of Rhizopus microsporus HR3-26 is shown in SEQ ID NO.1.

[0015] On the other hand, the present invention provides the use of the above-mentioned Rhizopus microsporus HR3-26 in the extraction of boletus polyphenols.

[0016] The present invention provides a new microbial strain Rhizopus microsporus HR3-26, which is purposefully separated and screened for the ability to hydrolyze the cell wall of boletus, and is obtained through mutagenesis. Microorganisms can produce a variety of enzymes for decomposing plant or edible (medicinal) fungus tissues during growth, including cellulase, hemicellulase, ligninase, pectinase, etc. Therefore, on the premise of screening and obtaining a superior strain for use in the extraction of boletus polyphenols, if the boletus is pretreated by direct fermentation with microorganisms, as long as the growth degree is well controlled to achieve the production of enzymes to hydrolyze the cell wall of the boletus, but without decomposing soluble polyphenols, thereby promoting the dissolution of the boletus polyphenols, the extraction rate can be improved.

[0017] Specifically, the present invention also provides a method for the application, comprising the following steps:

[0018] (1) adding microsporus Rhizopus HR3-26 spore liquid to boletus powder for fermentation to obtain a boletus fermentation product;

[0019] (2) Add deionized water to the fermented porcini, stir well, and keep warm at 35-40°C for 2-3 h. Then add anhydrous ethanol, sonicate, and filter to obtain a polyphenol extract.

[0020] (3) The polyphenol extract is distilled under reduced pressure until no liquid flows out, then dissolved in anhydrous ethanol, and dried to obtain a polyphenol extract.

[0021] After the above steps (1) to (3), the extraction yield of polyphenols during the ultrasonic aqueous extraction of Boletus can be significantly improved. In step (1), Rhizopus microsporus HR3-26 grows moderately in the Boletus powder supplemented with sucrose, producing various hydrolases. Subsequently, in step (2), the fermented Boletus powder is incubated with water at a certain temperature, and substances such as cellulose in the cell wall are hydrolyzed, which helps the bound Boletus polyphenols to dissolve during ethanol ultrasonic treatment, thereby significantly increasing the extraction yield of polyphenols. Specifically:

[0022] In step (1), after inoculating the spore suspension of Rhizopus microsporus HR3-26 into the Boletus powder, fermenting at 28-32 °C for 60-72 h can make the growth of Rhizopus microsporus HR3-26 just reach the appropriate level for enzyme production.

[0023] In step (2), adding deionized water to the Boletus fermented product and incubating at 35-40 °C for 2-3 h can make the fermentation reach the level of just hydrolyzing substances such as cellulose in the Boletus cell wall but not decomposing soluble polyphenols.

[0024] As a preference of the above technical solution of the present invention, in step (1), the concentration of the spore suspension of Rhizopus microsporus HR3-26 is 1×10 7 ~2×10 7 CFU / mL.

[0025] As a preference of the above technical solution of the present invention, calculated by the mass of the Boletus powder, in step (1), the volume addition amount of the spore suspension of Rhizopus microsporus HR3-26 is 4-5 mL / g.

[0026] As a preference of the above technical solution of the present invention, in step (1), the fermentation conditions are fermenting at 28-32 °C for 60-72 h.

[0027] As a preference of the above technical solution of the present invention, the preparation method of the spore suspension of Rhizopus microsporus HR3-26 is: inoculating the spores of Rhizopus microsporus HR3-26 on a potato dextrose agar plate medium, culturing at a constant temperature of 25-30 °C for 56-72 h to obtain a culture, and then adding a sterile sucrose aqueous solution to the culture and stirring to suspend the spores to obtain a spore suspension.

[0028] As a preference of the above technical solution of the present invention, in step (2), the addition amount of absolute ethanol is such that the ethanol volume fraction of the extraction system reaches 50%-60%.

[0029] In the extraction system treated by fermentation with Rhizopus microsporus HR3-26, when the ethanol volume fraction of the extraction system is 50%-60%, there is a better polyphenol extraction effect.

[0030] As a preference of the above technical solution of the present invention, in step (2), the temperature of the ultrasonic wave is 80~90°C, the power is 150~200 W, and the time is 80~100 min.

[0031] As a preference of the above technical solution of the present invention, in step (3), the drying method is vacuum drying.

[0032] Compared with the prior art, the present invention has the following technical effects:

[0033] The present invention provides a new microbial strain, Rhizopus microsporus HR3-26, which is purposefully isolated and screened for its ability to hydrolyze the cell wall of Boletus edulis, and obtained through mutagenesis. It is applied to improve the extraction yield of polyphenols from Boletus edulis, and the effect is remarkable.

[0034] The present invention also provides an application method of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus edulis. By adding Rhizopus microsporus HR3-26 to the Boletus edulis powder with sucrose, the fermentation conditions are optimized to make it grow moderately, produce a variety of hydrolases, achieve the hydrolysis of the cell wall of Boletus edulis by the produced enzymes, but without decomposing the soluble polyphenols, and finally improve the extraction yield of polyphenols. By applying this method, compared with the conventional ethanol ultrasonic extraction method without fermentation treatment with Rhizopus microsporus HR3-26, the extraction yield of polyphenols in Boletus edulis can be increased by 28.4%. Description of the Drawings

[0035] Figure 1 It is the standard curve for the determination of polyphenols by spectrophotometry using gallic acid as the standard;

[0036] Figure 2 It is the standard curve for the determination of glucose by DNS method in Example 2 of the present invention;

[0037] Figure 3 It is the colony morphology photo of Rhizopus microsporus HR3-26 cultured on PDA at 28°C for 3 d in Example 3 of the present invention. Detailed Embodiments

[0038] The present invention will be further described below in conjunction with the embodiments and the drawings.

[0039] The Boletus edulis used in the embodiments and comparative examples of the present invention is the fruiting body of Boletus edulis ( Boletus edulis ) of the family Boletaceae, also known as white Boletus; the Boletus edulis powder is the fine powder obtained by drying Boletus edulis at 85°C, cutting it into thin slices, and pulverizing it through a 40-mesh sieve.

[0040] In the examples and comparative examples of the present invention, the PDA plate medium is a ready-made potato dextrose agar medium (Qingdao Haibo Biotechnology Co., Ltd.), which is prepared at a concentration of 46 g / L with tap water, with the pH being natural. It is placed in an Erlenmeyer flask, sealed with 8 layers of gauze, sterilized at 121 °C for 20 min under high-pressure steam, and poured into a sterile petri dish with a diameter of 9 cm before solidification, 15 - 20 mL per dish.

[0041] In the examples and comparative examples of the present invention, the polyphenol content was determined by the Folin-Ciocalteu colorimetric method. The specific method was as follows: 1 mL of the sample solution to be tested was placed in a 10-mL stoppered test tube, and then 0.5 mL of the Folin-Ciocalteu reagent and 1.5 mL of an aqueous solution of sodium carbonate (Na2CO3) with a mass concentration of 15% were added in sequence. Then, it was made up to 10 mL with deionized water. After standing in the dark at 25 °C for 2 h, its absorbance (A 765 ) was measured at 765 nm. The measured absorbance was calculated from the gallic acid concentration–A 765 standard curve (as shown in Figure 1 ) to obtain the polyphenol concentration in the sample.

[0042] Gallic acid concentration–A 765 Standard curve drawing: 10 mg of gallic acid standard was accurately weighed, first dissolved in 5 mL of absolute ethanol, and then made up to 100 mL with deionized water to obtain a gallic acid standard solution with a concentration of 100 mg / L. 0, 0.1, 0.2, 0.3, 0.4, 0.5 mL of the gallic acid standard solution with a concentration of 100 mg / L was transferred to 10-mL stoppered test tubes, and then 0.5 mL of the Folin-Ciocalteu reagent and 1.5 mL of an aqueous solution of sodium carbonate with a mass concentration of 15% were added in sequence. Then, it was made up to 10 mL with deionized water. After standing in the dark at 25 °C for 2 h, its absorbance (A 765 ) was measured at 765 nm. A standard curve was drawn with the gallic acid concentration as the abscissa and A 765 as the ordinate. The results are shown in Figure 1 .

[0043] The yield of polyphenols extracted from Boletus edulis was calculated according to the following formula:

[0044] .

[0045] Example 1 Isolation and screening of microbial strains of fermented Boletus edulis

[0046] The microbial strains of fermented Boletus edulis were obtained by isolation and screening according to the following steps:

[0047] (1) Add 5 g of boletus powder to a 150 mL Erlenmeyer flask, then add 25 mL of sterile normal saline to moisten it, and incubate at a constant temperature of 28 °C for 72 h. Dilute the enriched culture covered with mold with sterile normal saline by 1×10 -5 , 1×10 -6 , 1×10 -7 , 1×10 -8 times respectively. Then, pipette 0.1 mL of the diluted solution and spread it on a potato dextrose agar plate medium (PDA). After incubating at a constant temperature of 28 °C for 48 h, pick out mold colonies with different colors and morphologies and transfer them to a fresh PDA plate medium, and incubate at a constant temperature of 30 °C for 72 h to obtain 7 pure culture strains. The numbers of each strain are shown in Table 1.

[0048] (2) Add 10 mL of sterile sucrose aqueous solution to the fresh plate cultures of 7 strains respectively, stir with an inoculation loop to suspend the spores, transfer the spore liquid to a sterile test tube, and adjust the spore concentration with sterile sucrose aqueous solution so that the spore liquids of different strains are between 1×10 7 and 2×10 7 cells / mL to obtain the spore liquids of each strain. Among them, the concentration of the sterile sucrose aqueous solution is 20 g / L, and it is sterilized at 115 °C by high-pressure steam for 20 min.

[0049] (3) Take 7 100 mL Erlenmeyer flasks sterilized by dry heat at 160 °C for 2 h, add 2 g of boletus powder to each, and then add 10 mL of the spore liquid of each mold prepared in step (2) (the volume dosage is 5 mL / g based on the mass of boletus powder). After stirring evenly, tie the mouth of the Erlenmeyer flask with 8 layers of gauze and incubate at 30 °C for 72 h to obtain the boletus fermented product.

[0050] (4) Add 20 mL of deionized water to all the boletus powder fermented by each strain in step (3) (10 mL / g based on the mass of the raw boletus). Stir evenly and keep it warm in a water bath at 35 °C for 3 h, then add 30 mL of absolute ethanol (the volume fraction of ethanol in the extraction system is 60%). Then, place it in an ultrasonic cleaner at 65 °C and extract with ultrasound at 200 W for 40 min. Filter with a Buchner funnel while it is hot, collect the filtrate, and determine the polyphenol content by spectrophotometry.

[0051] (5) According to the methods of steps (3) and (4) above, add 10 mL of sterile sucrose solution (concentration 20 g / L) to 2 g of boletus powder to make a blank fermentation control without inoculating mold; according to the method of step (4) above, add 2 g of boletus to 50 mL of ethanol aqueous solution with a volume fraction of 60% to directly extract polyphenols to make an unfermented control. The polyphenol extraction yields of the boletus fermented by different strains and the control are shown in Table 1.

[0052] Table 1 Polyphenol extraction yields of Boletus edulis fermented by different strains and the control

[0053] Serial number Strain number and control Polyphenol extraction rate (%) Improvement rate (%) 1 HR1 1.88 0.535 2 HR2 1.92 2.67 3 HR3 2.13 13.9 4 HR4 1.86 -0.535 5 HR5 1.90 1.60 6 HR6 1.74 -6.95 7 HR7 2.01 7.49 8 Blank fermentation control 1.85 -1.07 9 Unfermented control 1.87 /

[0054] As can be seen from the data in Table 1: For the blank fermentation control with sterile sucrose aqueous solution added but without inoculating molds, since almost no molds grew, the polyphenol extraction yield had no significant difference from that of the unfermented extraction control; after most strains fermented Boletus edulis, the polyphenol extraction yield did not increase significantly, and even after fermentation by some strains, the polyphenol extraction yield decreased slightly, such as strain HR6; after Boletus edulis was fermented by strain HR3, the polyphenol extraction yield was 2.13%, which was 13.9% higher than 1.87% of the unfermented control. Therefore, in the present invention, strain HR3 was selected as the microbial strain for fermenting Boletus edulis to conduct subsequent mutagenesis breeding to further increase the polyphenol extraction yield.

[0055] Example 2 Mutagenesis breeding of the microbial strain for fermenting Boletus edulis

[0056] Mutagenesis breeding was carried out on strain HR3 to screen for strains with better fermentation performance. The specific method was as follows:

[0057] (1) Preparation of spore suspension: Strain HR3 was activated and cultured on a PDA plate medium at 30 °C for 48 h, 5 mL of sterile normal saline was added, and the spores were suspended by stirring with an inoculation loop. 1 mL of the spore suspension was transferred to a triangular flask containing 50 mL of sterile normal saline (20 - 30 glass beads were added), and shaken at room temperature for 15 min. The spore suspension was filtered to remove the mycelium (a small mass of fluffy absorbent cotton was plugged at the bottom of the triangular funnel), the spores in the spore suspension were counted under a microscope using a hemocytometer, and appropriately diluted with sterile normal saline to adjust the spore concentration to 1.53×10 7 cells / mL.

[0058] (2) Mutagenesis: Under red light illumination, 1.5 mL of the above spore suspension and a sterile paper clip were taken into 6 petri dishes with a diameter of 6 cm respectively. The petri dishes were placed on a magnetic stirrer, and irradiated at a distance of 30 cm from a 15 W ultraviolet lamp preheated for 30 min for 1, 2, 3, 4, 5, and 6 min respectively. 0.5 mL of the irradiated spore suspension was taken, appropriately diluted, and 0.1 mL was respectively pipetted and spread on the PDA plate medium. In the same operation, the spore suspension without ultraviolet irradiation was diluted and spread on the plate as a control to calculate the lethality rate. The inoculated PDA plates were wrapped with black cloth and inverted and cultured at 28 °C for 48 h, the colonies on the plates were counted, and the lethality rate was calculated.

[0059] (3) Screening: Pick the colonies on the PDA plate with a lethality rate of over 90% and transfer them to a fresh PDA plate medium. Incubate at 30 °C for 72 h to obtain 40 strains. Add 10 mL of sterile normal saline to the fresh plate cultures of each strain, and stir with an inoculation loop to suspend the spores to obtain the spore suspensions of each strain. Take 2.5 mL of the spore suspension of each strain and inoculate it into 50 mL of the enzyme-producing medium. After shaking culture at 30 °C and 200 r / min for 72 h, the fermentation broth is filtered by Buchner funnel, and the filtrate (i.e., the crude enzyme solution) is collected, and the cellulase activity of the crude enzyme solution of each strain is measured. Select 13 strains with the enzyme production activity increased by 15% compared with the original strain HR3. Then, according to the method of Example 1, inoculate the spore suspensions of these strains to ferment boletus powder, extract polyphenols by ethanol ultrasonic method, and the yields of polyphenol extracts from the boletus fermented by the mutant strains and the control are shown in Table 2.

[0060] Among them, the composition of the enzyme-producing medium is: wheat bran 50 g / L, (NH4)2SO4 6 g / L, peptone 4 g / L, KH2PO4 2 g / L, MgSO4·7H2O 1 g / L, CaCl2 0.5 g / L, the solvent is tap water, and the pH is 6.0. Fill 50 mL of the enzyme-producing medium into a 250 mL Erlenmeyer flask, tie the mouth with 8 layers of gauze, and sterilize at 121 °C under high pressure steam for 20 min.

[0061] Table 2 Yields of polyphenol extracts from the boletus fermented by the mutant strains and the control

[0062]

[0063] It can be seen from the data in Table 2 that among the 13 selected strains, the strain numbered HR3-26 has a cellulase activity of 41.8 U / mL in fermentative production, which is increased by 52.6% compared with 27.4 U / mL of the wild strain HR3. After fermenting boletus with this strain, the yield of polyphenol extraction is 2.34%, which is increased by 9.39% compared with 2.13% of the wild strain HR3 and increased by 25.1% compared with 1.87% of the unfermented control. Therefore, the present invention selects the HR3-26 strain as the microbial strain for fermenting boletus, and optimizes the extraction conditions to improve the yield of polyphenol extract.

[0064] Among them, the method for determining the activity of cellulase is as follows: In a 10 mL graduated test tube, add 1.5 mL of 10 g / L sodium carboxymethyl cellulose solution (prepared with 0.2 mol / L phosphate buffer at pH 6.0) and 0.5 mL of crude enzyme solution. Incubate in a water bath at 50 °C for 30 min, then add 3 mL of DNS reagent, boil for 5 min, cool with running water, and make up the volume to 10 mL with deionized water, and stir evenly; use the crude enzyme solution inactivated by boiling at 100 °C for 10 min for the same treatment as the reference, and measure the absorbance (A 540 ) at a wavelength of 540 nm with a spectrophotometer. Calculate the glucose concentration in the sample from the glucose standard curve (as shown in Figure 2 ), and then calculate the cellulase activity (U / mL). Definition of cellulase activity: Under the conditions of pH 6.0 and 50 °C, the amount of enzyme required to hydrolyze sodium carboxymethyl cellulose to produce 1 μmol of glucose per minute is 1 enzyme activity unit (U).

[0065] The formula for calculating cellulase activity is: U=(CV1) / (TV2). Among them, C is the glucose concentration (μmol / mL) calculated from the standard curve; V1 is the volume of the enzyme reaction system, that is, 2 mL; T is the reaction time, that is, 30 min; V2 is the volume of the crude enzyme solution, that is, 0.5 mL.

[0066] Among them, the preparation of the glucose standard curve: In 7 10-mL graduated test tubes, add 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mL of a standard glucose aqueous solution with a concentration of 5 μmol / mL, then add 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, and 0.8 mL of 0.2 mol / L phosphate buffer at pH 6.0 to each, and then add 3.0 mL of DNS solution to each. The mixed solution is boiled in a boiling water bath for 5 min, cooled with running water, and made up the volume to 10 mL with deionized water, and stir evenly. Use the color-developing solution in the test tube without glucose as the reference, and measure A 540 , draw a standard curve with the glucose concentration as the abscissa and A 540 as the ordinate, as shown in Figure 2 .

[0067] Among them, the preparation method of DNS reagent is as follows: Add 6.3 g of 3,5-dinitrosalicylic acid and 262 mL of 2 mol / L NaOH aqueous solution to 500 mL of a hot aqueous solution containing 182 g of sodium tartrate, then add 5 g of redistilled phenol and 5 g of sodium sulfite, stir to dissolve, cool, and make up the volume to 1 L with deionized water. Store in a brown bottle and use after 7 days.

[0068] Example 3 Classification and Identification of Strain HR3-26

[0069] The strain HR3-26 was streaked on a PDA plate medium and cultured at 28 °C. During the culture process, it was found that the colony was grayish-white and villous at the initial stage, and turned gray after 2 days. The hyphal layer was 5-8 mm thick, dense, with many stoloniferous hyphae and rhizoids, and abundant sporangia on the surface. The back of the colony was grayish-brown, and there was no pigment diffusion in the medium. The sporangiophores of the strain HR3-26 were erect, the sporangia were spherical or nearly spherical, gray or grayish-brown, and the sporangiospores were lemon-shaped, with stripes on the surface, and the size was 3-4 μm × 5-7 μm. Among them, the colony morphology photo of the Rhizopus microsporus HR3-26 cultured on PDA at 28 °C for 3 days is shown in Figure 3 . Among them, the composition and preparation method of the PDA plate medium were the same as those in Example 1.

[0070] The rDNA-ITS nucleotide sequence of the strain HR3-26 was shown as SEQ ID NO.1. This sequence was blasted and compared on NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov), and had a homology of more than 98% with the rDNA-ITS sequences of 5 known Rhizopus microsporus ( Rhizopus microsporus ). According to the colony morphological characteristics of the strain HR3-26 and the results of the rDNA-ITS nucleotide sequence alignment, the biological classification position of the strain HR3-26 can be determined (refer to Mycobank, http: / / www.mycobank.org): Fungi, Mucoromycota, Mucoromycetes, Mucorales, Mucoraceae, Rhizopus Rhizopus ), Rhizopus microsporus Rhizopus microsporus .

[0071] The rDNA-ITS nucleotide sequence of the strain HR3-26 is:

[0072] TTTACTTCTCAGTATTGTTTGCTTCTATACTGTGAACCTCTGGCGATGAAGGTCGTAACTGACCTTCGGGAGAGACTCAGGACATATAGGCTATAATGGGTAGGCCTGTTCTGGGGTTTGATCGATGCCAATCAGGATTACCTTTCTTCCTTTGGGAAGGAAGGCGCCTGGTACCCTTTACCATATACCATGAATTCAGAATTGAAAGTATAATATAATAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGATCTTCTATAGAGTACGCTTGCTTCAGTATCATAACCAACCCACACATAAAATTTATTTTATGTGGTGATGGACAAATTCGGTTAGATTTAATTATTATACCGATTGTCTAAAATACAGCCTCTTTGTAATTTTCATTAAATTACGAACTACCTAGCCATCGTGCTTTTTTGGTCCAACCAAAAAACATTTAATCTAGGGGTTCTGCCAGCCAGCAGATATTTTAATGCTCTTTAACTATGATCTGAAGTCAAGTGGGACTACCCGCTGAACTTAA。

[0073] In summary, strain HR3 was isolated from the microbial enrichment of Boletus powder. After ultraviolet mutagenesis, strain HR3-26, namely Rhizopus microsporus Rhizopus microsporus ), HR3-26, was obtained by screening. This strain was deposited in the Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No: 63394, the deposit date being April 24, 2023, and the address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong Province; Postcode 510070.

[0074] Example 4 Application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus

[0075] The application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus is carried out according to the following steps:

[0076] (1)The spores on the PDA plate of Rhizopus microsporus HR3-26 stored at 4 °C were inoculated onto a fresh PDA plate medium and incubated at a constant temperature of 28 °C for 62 h. 10 mL of sterile sucrose aqueous solution was added to the petri dish, and the spores were suspended by stirring with an inoculation loop. The spore solution was transferred to a sterile test tube, and the spore concentration was adjusted to 1.38×10 7 CFU / mL with sterile sucrose aqueous solution to obtain the spore solution of Rhizopus microsporus HR3-26.

[0077] The composition and preparation method of the PDA plate medium were the same as in Example 1; the concentration of the sterile sucrose aqueous solution was 15 g / L, and it was sterilized by high-pressure steam at 115 °C for 20 min.

[0078] (2)10 g of Boletus powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 45 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) was added (the volume dosage was 4.5 mL / g based on the mass of Boletus powder), and it was stirred evenly. The Erlenmeyer flask was tied with 8 layers of gauze and cultured at 30 °C for 66 h to obtain the Boletus ferment.

[0079] (3)All of the Boletus ferment from step (2) was transferred into a 500 mL beaker. 125 mL of deionized water was added (the volume dosage was 12.5 mL / g based on the mass of Boletus powder), and it was stirred evenly. After being kept warm in a water bath at 37.5 °C for 2.5 h, 150 mL of absolute ethanol was added (the ethanol volume fraction in the extraction system was 54.5%). Then, it was placed in an ultrasonic cleaner at 70 °C and ultrasonically extracted at 200 W for 45 min. After the ultrasonic ethanol extraction was completed, it was filtered by Buchner funnel while it was hot to obtain the polyphenol extract.

[0080] (4)The polyphenol extract prepared in step (3) was distilled under reduced pressure at 45 °C and -0.1 MPa until no liquid flowed out. 20 mL of absolute ethanol was added (the volume dosage was 2 mL / g based on the mass of Boletus powder). After being fully shaken, it was transferred into a centrifuge tube and centrifuged at 8000 r / min for 10 min. The supernatant was transferred into a clean petri dish and dried under vacuum at 65 °C and -0.1 MPa to obtain the polyphenol extract.

[0081] Example 5 Application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus

[0082] The application of Rhizopus microsporus HR3-26 in the extraction of polyphenols from Boletus was operated according to the following steps:

[0083] (1) PDA plate spores of Rhizopus microsporus HR3-26 stored at 4°C were inoculated on fresh PDA plate medium and cultured at 28°C for 68 h. 10 mL of sterile sucrose aqueous solution was added to the culture dish and stirred with an inoculation loop to suspend the spores. The spore solution was transferred to a sterile test tube and the spore concentration was adjusted to 1.63×10 7 / mL, and obtain the spore liquid of Rhizopus microsporus HR3-26.

[0084] The components and preparation method of the PDA plate culture medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 20 g / L, and it is sterilized by high-pressure steam at 115° C. for 20 min.

[0085] (2) Add 50 mL of the microsporus Rhizopus HR3-26 spore solution prepared in step (1) (5 mL / g based on the mass of the boletus powder) to 10 g of the boletus powder in a 250-mL conical flask sterilized by dry heat at 160°C for 2 h, and stir evenly. Tie the flask with 8 layers of gauze and incubate at 28°C for 72 h to obtain the boletus fermentation product.

[0086] (3) All the porcini fermented products in step (2) were transferred to a 500 mL beaker, 100 mL of deionized water (10 mL / g based on the mass of porcini powder) was added, and the mixture was stirred evenly and kept in a 35°C water bath for 3 h. Then, 150 mL of anhydrous ethanol (ethanol volume fraction of the extraction system was 60%) was added, and then ultrasonic extraction was performed at 200 W for 40 min in an ultrasonic cleaner at 65°C. After the ultrasonic alcohol extraction was completed, the mixture was filtered with a hot Buchner funnel to obtain a polyphenol extract.

[0087] (4) The polyphenol extract prepared in step (3) was distilled under reduced pressure at 45°C and -0.1 MPa until no liquid flowed out, 15 mL of anhydrous ethanol (the volume dosage was 1.5 mL / g based on the mass of the boletus powder) was added, and after sufficient oscillation, the mixture was transferred into a centrifuge tube and centrifuged at 8000 r / min for 5 min. The supernatant was transferred into a clean culture dish and vacuum dried at 65°C and -0.1 MPa to obtain a polyphenol extract.

[0088] Example 6 Application of Rhizopus microsporus HR3-26 in the extraction of boletus polyphenols

[0089] Microsporum Rhizopus HR3-26 was used to extract polyphenols from Boletus, and the following steps were followed:

[0090] (1) PDA plate spores of Rhizopus microsporus HR3-26 stored at 4°C were inoculated on fresh PDA plate medium and cultured at 28°C for 56 h. 10 mL of sterile sucrose aqueous solution was added to the culture dish and stirred with an inoculation loop to suspend the spores. The spore solution was transferred to a sterile test tube and the spore concentration was adjusted to 1.15×10 7 The composition and preparation method of the PDA plate medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 10 g / L, and the high-pressure steam is sterilized at 115°C for 20 min.

[0091] (2) Add 40 mL of the microsporus Rhizopus HR3-26 spore solution prepared in step (1) (4 mL / g based on the mass of the boletus powder) to 10 g of boletus powder in a 250 mL Erlenmeyer flask sterilized by dry heat at 160°C for 2 h, and stir evenly. Tie the flask with 8 layers of gauze and incubate at 32°C for 60 h to obtain the boletus fermentation product.

[0092] (3) All the porcini fermented products in step (2) were transferred to a 500 mL beaker, and 150 mL of deionized water (15 mL / g based on the mass of porcini powder) was added. After stirring evenly, the mixture was kept in a 40°C water bath for 2 h, and then 150 mL of anhydrous ethanol (ethanol volume fraction of the extraction system was 50%) was added. The mixture was then ultrasonically extracted at 200 W for 50 min at 70°C in an ultrasonic cleaner. After the ultrasonic alcohol extraction was completed, the mixture was filtered with a hot Buchner funnel to obtain a polyphenol extract.

[0093] (4) The polyphenol extract prepared in step (3) was distilled under reduced pressure at 45°C and -0.1 MPa until no liquid flowed out. 20 mL of anhydrous ethanol (the volume dosage was 2 mL / g based on the mass of the boletus powder) was added, and after sufficient oscillation, the mixture was transferred into a centrifuge tube and centrifuged at 8000 r / min for 10 min. The supernatant was transferred into a clean culture dish and dried under vacuum at 65°C and -0.1 MPa to obtain a polyphenol extract.

[0094] Comparative Example 1

[0095] The main difference from Example 4 is that no Rhizopus microsporus HR3-26 fermentation treatment was performed before ethanol ultrasonic extraction.

[0096] Follow these steps:

[0097] (1) 10 g of porcini powder was placed in a 500 mL beaker, and 125 mL of deionized water (12.5 mL / g based on the mass of porcini powder) was added. The mixture was stirred evenly and kept in a 37.5°C water bath for 2.5 h. Then, 150 mL of anhydrous ethanol (ethanol volume fraction of the extraction system was 54.5%) was added. The mixture was then ultrasonically extracted at 200 W for 45 min at 70°C. After the ultrasonic extraction, the polyphenol extract was filtered through a hot Buchner funnel.

[0098] (2) The polyphenol extract prepared in step (1) was distilled under reduced pressure at 45°C and -0.1 MPa until no liquid flowed out, 20 mL of anhydrous ethanol (the volume dosage was 2 mL / g based on the mass of the boletus powder) was added, and after sufficient oscillation, the mixture was transferred into a centrifuge tube and centrifuged at 8000 r / min for 10 min. The supernatant was transferred into a clean culture dish and vacuum dried at 65°C and -0.1 MPa to obtain a polyphenol extract.

[0099] Comparative Example 2

[0100] The main difference from Example 4 is that the fermentation temperature in step (2) is 25° C. The other steps are the same as Example 4.

[0101] Step (2) Follow the steps below:

[0102] 10 g of porcini powder was sterilized by dry heat at 160°C for 2 h in a 250 mL Erlenmeyer flask, and 45 mL of the microsporus Rhizopus HR3-26 spore solution prepared in step (1) (the volume dosage was 4.5 mL / g based on the mass of porcini powder) was added and stirred evenly. The flask was sealed with 8 layers of gauze and cultured at 25°C for 66 h to obtain the porcini fermentation product.

[0103] Comparative Example 3

[0104] The main difference from Example 4 is that the fermentation temperature in step (2) is 35° C. The other steps are the same as Example 4.

[0105] Step (2) Follow the steps below:

[0106] (2) Add 45 mL of the microsporus Rhizopus HR3-26 spore solution prepared in step (1) (4.5 mL / g based on the mass of the boletus powder) to 10 g of the boletus powder in a 250 mL Erlenmeyer flask sterilized by dry heat at 160°C for 2 h, and stir evenly. Tie the flask with 8 layers of gauze and incubate at 35°C for 66 h to obtain the boletus fermentation product.

[0107] Comparative Example 4

[0108] The main difference from Example 4 is that the fermentation time in step (2) is 54 h. Other steps are the same as in Example 4.

[0109] Step (2) is operated as follows:

[0110] 10 g of boletus powder is placed in a 250 mL Erlenmeyer flask sterilized by dry heat at 160 °C for 2 h. Add 45 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage is 4.5 mL / g based on the mass of the boletus powder), and stir evenly. The Erlenmeyer flask is tied with 8 layers of gauze and cultured at 30 °C for 54 h to obtain the boletus ferment.

[0111] Comparative Example 5

[0112] The main difference from Example 4 is that the fermentation time in step (2) is 78 h. Other steps are the same as in Example 4.

[0113] Step (2) is operated as follows:

[0114] 10 g of boletus powder is placed in a 250 mL Erlenmeyer flask sterilized by dry heat at 160 °C for 2 h. Add 45 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage is 4.5 mL / g based on the mass of the boletus powder), and stir evenly. The Erlenmeyer flask is tied with 8 layers of gauze and cultured at 30 °C for 78 h to obtain the boletus ferment.

[0115] Comparative Example 6

[0116] The main difference from Example 4 is that the heat preservation temperature in step (3) is 30 °C. Other steps are the same as in Example 4.

[0117] Step (3) is operated as follows:

[0118] All the boletus ferment in step (2) is transferred into a 500 mL beaker. Add 125 mL of deionized water (the volume dosage is 12.5 mL / g based on the mass of the boletus powder), stir evenly, keep warm in a 30 °C water bath for 2.5 h, then add 150 mL of absolute ethanol (the ethanol volume fraction in the extraction system is 54.5%), and then place it in an ultrasonic cleaner at 70 °C and extract ultrasonically at 200 W for 45 min. After the ultrasonic ethanol extraction is completed, filter it hot with a Buchner funnel to obtain the polyphenol extract.

[0119] Comparative Example 7

[0120] The main difference from Example 4 is that the heat preservation temperature in step (3) is 45 °C. Other steps are the same as in Example 4.

[0121] Step (3) is operated as follows:

[0122] All the porcini fermented products in step (2) were transferred to a 500 mL beaker, and 125 mL of deionized water (12.5 mL / g based on the mass of porcini powder) was added. After stirring evenly, the mixture was kept in a 45°C water bath for 2.5 h, and then 150 mL of anhydrous ethanol (ethanol volume fraction of the extraction system was 54.5%) was added. Then, the mixture was ultrasonically extracted at 200 W for 45 min at 70°C in an ultrasonic cleaner. After the ultrasonic alcohol extraction was completed, the mixture was filtered with a hot Buchner funnel to obtain a polyphenol extract.

[0123] Comparative Example 8

[0124] The main difference from Example 4 is that the holding time in step (3) is 1 hour. The other steps are the same as Example 4.

[0125] Step (3) Follow the steps below:

[0126] All the porcini fermented products in step (2) were transferred to a 500 mL beaker, 125 mL of deionized water (12.5 mL / g based on the mass of porcini powder) was added, stirred evenly, kept warm in a 37.5°C water bath for 1 hour, and then 150 mL of anhydrous ethanol (ethanol volume fraction of the extraction system was 54.5%) was added, and then ultrasonic extraction was performed at 200 W for 45 min in an ultrasonic cleaner at 70°C. After the ultrasonic alcohol extraction was completed, the polyphenol extract was filtered through a hot Buchner funnel to obtain a polyphenol extract.

[0127] Comparative Example 9

[0128] The main difference from Example 4 is that the holding time in step (3) is 4 hours. The other steps are the same as Example 4.

[0129] Step (3) Follow the steps below:

[0130] All the porcini fermented products in step (2) were transferred to a 500 mL beaker, and 125 mL of deionized water (12.5 mL / g based on the mass of porcini powder) was added. After stirring evenly, the mixture was kept in a 37.5°C water bath for 4 hours, and then 150 mL of anhydrous ethanol (ethanol volume fraction of the extraction system was 54.5%) was added. Then, the mixture was ultrasonically extracted at 200 W for 45 minutes at 70°C in an ultrasonic cleaner. After the ultrasonic alcohol extraction was completed, the mixture was filtered with a hot Buchner funnel to obtain a polyphenol extract.

[0131] Comparative Example 10

[0132] The main difference from Example 4 is that the volume fraction of ethanol in the extraction system in step (3) is 40%. The other steps are the same as those in Example 4.

[0133] Step (3) Follow the steps below:

[0134] All the porcini fermented products in step (2) were transferred to a 500 mL beaker, and 125 mL of deionized water (12.5 mL / g based on the mass of porcini powder) was added. After stirring evenly, the mixture was kept in a 37.5°C water bath for 2.5 h, and then anhydrous ethanol was added to make the ethanol volume fraction of the extraction system 40%. The mixture was then ultrasonically extracted at 200 W for 45 min at 70°C. After the ultrasonic alcohol extraction was completed, the mixture was filtered with a hot Buchner funnel to obtain a polyphenol extract.

[0135] Comparative Example 11

[0136] The main difference from Example 4 is that the volume fraction of ethanol in the extraction system in step (3) is 70%. The other steps are the same as those in Example 4.

[0137] Step (3) Follow the steps below:

[0138] All the porcini fermented products in step (2) were transferred to a 500 mL beaker, and 125 mL of deionized water (12.5 mL / g based on the mass of porcini powder) was added. After stirring evenly, the mixture was kept in a 37.5°C water bath for 2.5 h, and then anhydrous ethanol was added to make the ethanol volume fraction of the extraction system 70%. The mixture was then ultrasonically extracted at 200 W for 45 min at 70°C. After the ultrasonic alcohol extraction was completed, the mixture was filtered with a hot Buchner funnel to obtain a polyphenol extract.

[0139] Evaluation of fermentation results

[0140] In Examples 4 to 6 and Comparative Examples 1 to 11, the mass of polyphenol extracts obtained from 10 g of boletus, the mass of polyphenols in boletus, the percentage of polyphenols in boletus and the extraction yield of polyphenols in boletus are shown in Table 3. The percentage of polyphenols in boletus is the percentage of the mass of polyphenols in boletus to the mass of the polyphenol extract obtained.

[0141] Table 3 Yield of extracting porcini polyphenols by the methods of Examples 4 to 6 and Comparative Examples 1 to 11

[0142]

[0143] From the data in Table 3, we can see that:

[0144] ① From the data of Examples 4 to 6, it can be seen that the application of Rhizopus microsporus HR3-26 in the extraction of boletus polyphenols can effectively improve the extraction rate of boletus polyphenols.

[0145] ②Comparing Comparative Example 1 with Example 4, without performing the fermentation pretreatment with Rhizopus microsporus HR3-26 before the conventional ethanol ultrasonic extraction, the extraction yield is greatly reduced. This shows that performing the fermentation pretreatment with Rhizopus microsporus HR3-26 before water extraction and alcohol precipitation can significantly improve the polyphenol extraction yield. Further analyzing the reason, the fermentation of Rhizopus microsporus HR3-26 can produce various hydrolases to hydrolyze the cell wall of Boletus edulis, which may be one of the reasons for the increase in the polyphenol extraction yield. The extraction yield of Example 4 with the fermentation pretreatment of Rhizopus microsporus HR3-26 is 2.35%, which is 28.4% higher than that of Comparative Example 1 without treatment.

[0146] ③Comparative analysis of Example 4 and Comparative Examples 2-5 shows that when applying Rhizopus microsporus HR3-26 to the polyphenol extraction of Boletus edulis, after adding the spore solution of Rhizopus microsporus HR3-26 to the Boletus edulis powder and fermenting at 28-32 °C for 60-72 h, the growth of Rhizopus microsporus HR3-26 can just reach the appropriate level for enzyme production, and the polyphenol extraction effect is better.

[0147] ④Comparative analysis of Example 4 and Comparative Examples 6-9 shows that when applying Rhizopus microsporus HR3-26 to the polyphenol extraction of Boletus edulis, after adding deionized water to the Boletus edulis fermented product and keeping it warm at 35-40 °C for 2-3 h, the polyphenol extraction effect is better, which can make the fermentation just reach the degree of hydrolyzing substances such as cellulose in the cell wall of Boletus edulis but not decomposing soluble polyphenols.

[0148] ⑤Comparative analysis of Example 4 and Comparative Examples 10-11 shows that when applying Rhizopus microsporus HR3-26 to the polyphenol extraction of Boletus edulis, in the extraction system, the ethanol volume fraction is 50%-60%, and the polyphenol extraction effect is better.

[0149] In the present invention, the raw materials and equipment used, unless otherwise specified, are common raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are conventional methods in the art.

[0150] The above are only the preferred embodiments of the present invention, and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent transformations made to the above embodiments according to the technical essence of the present invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. Application of Rhizopus microsporus ([[]]END Rhizopus microsporus [[]]END) HR3-26 in the extraction of polyphenols from Boletus, characterized in that,[[]]END The Rhizopus microsporus HR3-26 is deposited in the Guangdong Microbial Culture Collection Center. The deposit date is April 24, 2023, and the deposit number is GDMCC No: 63394. [[]]END​​​ 2. The application according to claim 1, characterized in that: The method of the application includes the following steps: (1) Add the spore liquid of Rhizopus microsporus HR3-26 to the boletus powder and ferment to obtain the boletus ferment; (2) Add deionized water to the boletus ferment, stir evenly, keep warm at 35-40 °C for 2-3 h, then add absolute ethanol, ultrasonicate, and filter to obtain the polyphenol extract; (3) Take the polyphenol extract and distill it under reduced pressure until no liquid flows out, then dissolve it with absolute ethanol, and dry it to obtain the polyphenol extract.

3. The application according to claim 2, characterized in that: In step (1), the concentration of the spore solution of Rhizopus microsporus HR3-26 is 1×10 7 ~2×10 7 spores / mL.

4. The application according to claim 2 or 3, characterized in that: Based on the mass of the boletus powder, in step (1), the volume addition amount of the spore liquid of Rhizopus microsporus HR3-26 is 4-5 mL / g.

5. The application according to claim 2, characterized in that: In step (1), the fermentation conditions are fermentation at 28-32 °C for 60-72 h.

6. The application according to claim 2, characterized in that: The preparation method of the spore liquid of Rhizopus microsporus HR3-26 is: inoculate the spores of Rhizopus microsporus HR3-26 on a potato dextrose agar plate medium, incubate at a constant temperature of 25-30 °C for 56-72 h to obtain a culture, then add a sterile sucrose aqueous solution to the culture, and stir to suspend the spores to obtain the spore liquid.

7. The application according to claim 2, wherein: In step (2), the temperature of the ultrasonic treatment is 80-90 °C.

8. The application according to claim 2 or 7, characterized in that: In step (2), the time of the ultrasonic treatment is 40-50 min.

9. The application according to claim 2, wherein: In step (3), the drying method is vacuum drying.

Images