A method for efficiently detecting specific single nucleotide variants in mixed genetic samples

The Pool-ARMS method, utilizing PCR amplification with one outer primer and one inner primer, solves the problem of low detection efficiency of specific SNVs in plant and animal genomes, achieving efficient and low-cost screening of specific SNVs in populations, and is suitable for high-throughput detection of plant breeding and medical disease samples.

CN116987773BActive Publication Date: 2026-04-03ZHEJIANG UNIV +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-10
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing technologies are inefficient in detecting specific single nucleotide variations in plant and animal genomes, especially in low-frequency target allele variations, where efficient screening and detection are difficult. Furthermore, traditional methods have limited detection thresholds for mixed samples, failing to meet the demands for high throughput and low cost.

Method used

Using the Pool-ARMS method, one outer primer and one inner primer were designed and combined with a mixed genetic sample as a DNA template for PCR amplification. By optimizing the PCR system and annealing temperature, targeted screening of specific SNVs in the population was achieved.

Benefits of technology

It improves detection efficiency and accuracy, simplifies primer design and amplification condition optimization, reduces detection costs, and is suitable for high-throughput detection of low-frequency gene mutation populations, especially for screening and identification of plant breeding and medical disease samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004440006340000031
    Figure BDA0004440006340000031
  • Figure BDA0004440006340000041
    Figure BDA0004440006340000041
  • Figure BDA0004440006340000091
    Figure BDA0004440006340000091
Patent Text Reader

Abstract

This invention discloses a highly efficient method for detecting specific single nucleotide variants in mixed genetic samples. Taking two genes controlling photosensitive male sterility as examples, this invention establishes a system for detecting mutations using DNA extracted from mixed samples of leaf or coleoptile tissue under selected primer pairs and amplification reaction procedures. The mutation detection level is 1:49 for the former and 1:24 for the latter. This method can achieve targeted screening of single nucleotide variants of photosensitive male sterility genes in rice populations and can be extended to base editing and induced mutation breeding of photoperiod-temperature-sensitive male sterile lines in rice, significantly reducing detection costs and improving breeding efficiency. Furthermore, this method is expected to be used for targeted screening of target variants in single-base editing populations and physicochemical mutagenesis populations in plants and animals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a method for detecting specific single nucleotide variations in mixed genetic samples. Background Technology

[0002] Single nucleotide variants (SNVs), also known as single nucleotide polymorphisms (SNPs), are widely present in the genomes of plants and animals, including humans. SNVs can affect RNA transcription, splicing, and protein translation, thereby controlling the formation of various biological traits, including diseases. In humans, single nucleotide variants (SNVs) have been used as biomarkers for detecting drug resistance, cancer diagnosis, and infectious diseases. In crop breeding, SNVs are the genetic basis for many important agronomic trait variations. For example, the SNV (G→T) at the splice donor site of the first intron of the Wx gene determines the amylose content in indica and japonica rice; and an SNV (C→A) at position 71 of the TMS5 gene encoding RNase produces the thermosensitive male sterility trait in rice.

[0003] To date, various SNV analysis methods have been developed to identify an individual's genotype or detect gene mutations. For example, sequencing is currently the gold standard for SNV detection. Other methods include converting SNVs into CAPS or dCAPS markers based on differences in restriction enzyme sites, high-resolution melting curve (HRM) technology based on differences in DNA double-strand melting characteristics, and tetraprimer ARMS-PCR (Tetra-primer ARMS-PCR), which utilizes the high sensitivity of DNA polymerase extension to mismatches between the primer 3' end or vicinity and the template.

[0004] However, a crucial task in crop breeding is to purposefully create superior SNV sites to rapidly improve new crop varieties. Currently, this is mainly achieved through two methods: induced mutation and base editing. Physicochemical mutagenesis, such as gamma ray induction, can induce different types of base changes, but the mutation frequency is very low; for example, the frequency of gamma-ray-induced base substitution is only 7.5 × 10⁻⁶. -6 ~9.8×10 -6 CRISPR / Cas technology has been used for plant genome editing for over a decade. Prime editing (PE) can precisely replace all nucleotides, thus holding significant promise for crop improvement. However, the uniqueness of base editing targets results in low editing efficiency, and the efficiency in plants is significantly lower than in animal cells, severely limiting its application in plant breeding. Even with the latest PE3 technology, while some sites achieve a success rate as high as 54.2%, the editing efficiency at many sites remains low, and many sites are unsuccessful.

[0005] Because the mutation frequency of the target allele is relatively low in plant populations induced by mutations and base editing, performing genotyping or mutation detection on each individual in the population is extremely inefficient. If a high-throughput detection could be performed on all individuals in the population to determine the presence of the target base variation, detection efficiency would be greatly improved and costs reduced. To efficiently detect various mutations within the target region in induced mutation populations, a technique for detecting mutations in mixed samples, namely TILLING, has been developed, leading to the development of different techniques for detecting different types of mutations, such as iTILLING, Seq-TILLING, and HRM-TILLING. Except for Seq-TILLING based on NGS, the fold increase in plant pool detection is very limited, generally with a screening threshold of only 1:4. Furthermore, including Seq-TILLING, these techniques detect various random mutations within the target region and are not suitable for screening specific SNVs. Similarly, CRISPR / Cas technology has also spawned various PCR-based detection techniques and various sequencing-based techniques. However, these detection methods only detect the presence of insertions / deletions and base substitutions within the target region, rather than detecting specific SNVs, and they are only effective when the proportion of mutations in the sample is at least 15%.

[0006] Therefore, the methods for screening and detecting target SNVs in gene editing populations still need improvement, given the high off-target rate of gene editing leading to low efficiency in obtaining target variants and the randomness and uncertainty of variant directions in mutagenesis populations. Summary of the Invention

[0007] In view of this, the purpose of this invention is to provide a method for efficiently detecting specific single nucleotide variants in mixed genetic samples. The method of this invention achieves targeted screening of specific SNVs in a population by establishing a Pool-ARMS, and can be used for targeted screening of target variants in animal and plant single-base editing populations and physicochemical mutagenesis populations.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides a method for detecting SNVs in mixed genetic samples, comprising: designing an outer primer at a suitable position, designing a specific inner primer at the target SNV site, adding a mismatch at the third-to-last base of the 3' end of the inner primer, setting an optimal annealing temperature for the PCR system, performing PCR amplification using a mixed genetic sample of each individual in the population as a DNA template, and analyzing the PCR amplification product to identify whether the target SNV exists in the population.

[0010] In a second aspect, the present invention provides a method for detecting the rice photosensitivity male sterility gene pms1, comprising the following steps:

[0011] (1) Prepare a mixed genetic sample using any one of the following methods (i) to (iii) and use it as a DNA template:

[0012] (i) Extract leaf DNA from each rice plant in the population and adjust it to the same concentration. Then mix the leaf DNA in equal volumes to use as a DNA template.

[0013] (ii) Take leaf tissues of the same size from each rice plant in the population, mix them, and then extract DNA as a DNA template.

[0014] (iii) Take coleoptile tissues of the same length from each germinating rice seed in the population, mix them, and then extract DNA as a DNA template;

[0015] (2) Using the following first primer pair, the DNA template prepared in step (1) is subjected to PCR amplification according to the following first PCR amplification program to obtain PCR amplification products;

[0016] The nucleotide sequence of the first primer pair used for specific amplification of pms1 is shown below:

[0017] p1 / 3G: ATGCATCAGGAAAGAAGCTTCTACGAT (SEQ ID No. 9);

[0018] p1 / R: TGGCTATAACTGATGACTGTGTTCCAGT (SEQ ID No. 10);

[0019] The PCR amplification product size was 229 bp;

[0020] The first PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 62℃ annealing for 15 s, 72℃ extension for 14 s, for a total of 30 cycles; 72℃ extension for 5 min.

[0021] (3) The PCR amplification products obtained in step (2) are subjected to electrophoresis to determine whether there are rice photosensitivity-stress gene pms1 mutant plants in the population.

[0022] In some specific examples of the present invention, in step (2), the PCR amplification reaction system of pms1 has the following composition:

[0023]

[0024] In some specific examples of the present invention, in step (1), the coleoptile tissue is obtained by soaking rice seeds for 2 days and germinating them for 2 days to obtain germinating rice seeds, and taking a coleoptile of the same length (e.g., 4 mm in length) from the germinating rice seeds.

[0025] In some specific examples of the present invention, in step (1), the leaf tissue is obtained by punching holes in the leaves of the rice plant with a punch (e.g., a 1.5 mm punch) to obtain samples.

[0026] In some specific examples of the present invention, in step (3), the electrophoresis detection refers to separating the PCR amplification product obtained in step (2) by agarose gel electrophoresis, staining with GelGreen nucleic acid dye, imaging under a gel imaging system, and observing the electrophoretic bands to determine whether there are rice photosensitizing male sterility gene pms1 mutant plants in the population.

[0027] In a third aspect, the present invention provides a method for detecting the rice photosensitivity male sterility gene pms3, comprising the following steps:

[0028] (1) Prepare a mixed genetic sample using any one of the following methods (i) to (iii) and use it as a DNA template:

[0029] (i) Extract leaf DNA from each rice plant in the population and adjust it to the same concentration. Then mix the leaf DNA in equal volumes to use as a DNA template.

[0030] (ii) Take leaf tissues of the same size from each rice plant in the population, mix them, and then extract DNA as a DNA template.

[0031] (iii) Take coleoptile tissues of the same length from each germinating rice seed in the population, mix them, and then extract DNA as a DNA template;

[0032] (2) Using the second primer pair below, the DNA template prepared in step (1) is subjected to PCR amplification according to the second PCR amplification procedure below to obtain PCR amplification products;

[0033] The second primer pair used for selectively amplifying pms3 has the following nucleotide sequence:

[0034] p3 / 3G: GATAAAAATTTTACTCTTGATGGATGGGAC (SEQ ID No. 11);

[0035] p3 / F: AAGAAAAGCAGAGACATAGATGAGCAAC (SEQ ID No. 12);

[0036] The PCR amplification product size is 185 bp;

[0037] The second PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 63℃ annealing for 15 s, 72℃ extension for 12 s, for a total of 30 cycles; 72℃ extension for 5 min.

[0038] (3) The PCR amplification products obtained in step (2) are subjected to electrophoresis to determine whether there are rice photosensitivity-stress gene pms3 mutant plants in the population.

[0039] In some specific examples of the present invention, in step (2), the PCR amplification reaction system of pms3 has the following composition:

[0040]

[0041] In some specific examples of the present invention, in step (1), the coleoptile tissue is obtained by soaking rice seeds for 2 days and germinating them for 2 days to obtain germinating rice seeds, and taking a coleoptile of the same length (e.g., 4 mm in length) from the germinating rice seeds.

[0042] In some specific examples of the present invention, in step (1), the leaf tissue is obtained by punching holes in the leaves of the rice plant with a punch (e.g., a 1.5 mm punch) to obtain samples.

[0043] In some specific examples of the present invention, in step (3), the electrophoresis detection refers to separating the PCR amplification product obtained in step (2) by agarose gel electrophoresis, staining with GelGreen nucleic acid dye, imaging under a gel imaging system, and observing the electrophoretic bands to determine whether there are rice photosensitizing male sterility gene pms3 mutant plants in the population.

[0044] In a fourth aspect, the present invention provides a first primer pair for detecting the rice photoperiod-sensitive male sterility gene pms1 in mixed genetic samples, the nucleotide sequence of which is shown below:

[0045] p1 / 3G: ATGCATCAGGAAAGAAGCTTCTACGAT (SEQ ID No. 9);

[0046] p1 / R: TGGCTATAACTGATGACTGTGTTCCAGT (SEQ ID No. 10);

[0047] The PCR amplification product was 229 bp in size.

[0048] In a fifth aspect, the present invention provides a second primer pair for detecting the rice photoperiod-sensitive male sterility gene pms3 in mixed genetic samples, the nucleotide sequence of which is shown below:

[0049] p3 / 3G: GATAAAAATTTTACTCTTGATGGATGGGAC (SEQ ID No. 11);

[0050] p3 / F: AAGAAAAGCAGAGACATAGATGAGCAAC (SEQ ID No. 12);

[0051] The PCR amplification product was 185 bp in size.

[0052] In a sixth aspect of the invention, the invention provides a PCR kit for detecting the rice photoperiod-sensitive male sterility gene pms1 in a mixed genetic sample, comprising: the first primer pair.

[0053] In a seventh aspect of the invention, the invention provides a PCR kit for detecting the rice photoperiod-sensitive male sterility gene pms3 in a mixed genetic sample, comprising: the second primer pair described above.

[0054] In this invention, genomic DNA was extracted from rice leaves and coleoptiles of germinating rice seeds using the CTAB method.

[0055] Traditional ARMS-PCR uses two outer primers and two inner primers, making primer selection and optimization of the optimal annealing temperature in the PCR system extremely cumbersome and resulting in low success rates. This invention creatively proposes a two-primer approach, consisting of only one outer primer and one inner primer, to select a PCR system and reaction procedure specifically for amplifying the target gene. Furthermore, it boldly employs mixed genetic samples as DNA templates for PCR amplification, establishing a Pool-ARMS detection system. This enables the detection of target SNVs in population samples, making it particularly suitable for populations with low target allelic mutation frequencies. The reduction in the number of primers in this invention significantly simplifies the PCR system optimization process, facilitating the acquisition of optimal primer pairs and annealing temperatures. This method also eliminates the need for sequencing, making the experimental technique more streamlined. Furthermore, it allows for efficient identification of mutagenic materials and materials obtained from single-base edited transgenes. This technology can be extended to molecular marker-assisted selection breeding of photoperiod-temperature-sensitive male-sterile lines in rice, expanding the breeding population and shortening the breeding cycle of male-sterile lines, thus providing new methods for creating new materials and having significant value in utilizing heterosis in two-line breeding. For example, guided editing, as a highly efficient gene-targeted editing technology, has received widespread attention from scientists in crop breeding and medical disease treatment in recent years, but its practical application is still limited due to its editing efficiency. For low-frequency gene editing that is prone to off-target effects, conventional methods require sequential DNA extraction from individual samples. Whether it is a conventional DNA extraction method or a more time-saving rapid extraction method, it requires a lot of time and reagent costs when identifying a large number of samples, failing to achieve the goal of rapid and efficient experimentation. The Pool-ARMS detection system of this invention solves this problem. If a specific SNV mutation exists in multiple mixed unidentified materials, this method can identify it simply, efficiently, and at low cost. Moreover, the thresholds of the three screening systems are significantly higher than those of traditional systems. For example, the screening system that uses leaf tissues of the same size for mixing and then extracting DNA expands the proportion of positive mutation detection to a pool of 50 plants, greatly reducing labor and reagent costs. This invention's method is expected to replace single-sample sequencing in the screening and identification of single-base edited animal and plant samples and medical disease samples, significantly improving detection efficiency. For mutation detection in plant mutation breeding, the insufficient mutation frequency and uncertainty in mutation direction make the identification of offspring mutants a laborious task. To address this, this invention expands the proportion of positive mutation detection to a pool of 25 seeds by using a method of sampling and mixing seed coleoptiles to extract DNA templates. Since the production goal is to screen for directional mutations, this method is also applicable. Therefore, in mutation detection in plant mutation breeding, this invention's method is also expected to replace single-sample sequencing, significantly improving detection efficiency.

[0056] Meanwhile, due to the use of PCR technology, this invention has the advantages of high sensitivity, simplicity and speed, low cost, and low requirements for sample purity, making it suitable for wide application.

[0057] Compared with the prior art, the present invention has the following beneficial technical effects:

[0058] (1) Compared with traditional ARMS-PCR, this invention has made creative improvements: First, it replaces four primers with two specific primers, achieving good detection results. This not only greatly simplifies primer design and optimization of amplification conditions, but also reduces the reduction in amplification efficiency of specific fragments caused by mismatched base pairs introduced by the inner primers and the adverse effects of the outer primers on the internal amplification inhibition of the inner primers, thus improving detection accuracy. It is also conducive to obtaining the best amplification conditions and increasing the amplification efficiency of specific fragments. Second, it replaces single samples with mixed genetic samples to establish a Pool-ARMS detection system, thereby changing the multiple detections of individual mutations one by one to a single detection of the target SNV in the population, which significantly improves the detection effect. It is especially suitable for the detection of target SNVs in populations with low-frequency gene mutations. It can be applied to the breeding work of other crops and animals for the targeted screening of target variations in single-base editing populations and physicochemical mutagenesis populations, in order to play an important role in the development of modern agriculture.

[0059] (2) The method of the present invention also has the advantages of high sensitivity, simplicity and speed, low cost and low requirements for sample purity, and is suitable for wide application. Attached Figure Description

[0060] Figure 1A Comparison of PMS1 gene sequence validation results for four rice materials.

[0061] Figure 1B Comparison of PMS3 gene sequence validation results for four rice materials.

[0062] Figure 2 This is a gel electrophoresis image of the PCR amplification products of different samples in Example 1.

[0063] Figure 3 This is a gel electrophoresis image of the PCR amplification products of different samples in Example 2.

[0064] Figure 4 This is a gel electrophoresis image of the PCR amplification products of different samples in Example 3.

[0065] Figure 5 This is a gel electrophoresis image of the PCR amplification products of different samples in Example 4.

[0066] Figure 6 This is a gel electrophoresis image of the PCR amplification products of different samples in Example 5.

[0067] Figure 7 This is a gel electrophoresis image of the PCR amplification products of different samples in Example 6.

[0068] Figure 8 The image shows gel electrophoresis diagrams of the PCR amplification products of different samples in Comparative Example 1.

[0069] Figure 9 The image shows gel electrophoresis results of PCR amplification products from different samples in Comparative Example 2. Detailed Implementation

[0070] The present invention will be further described below with reference to specific embodiments and accompanying drawings. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0071] Unless otherwise specified in the examples, the techniques or conditions described in the literature in this field or in accordance with the product instructions shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products. In the examples, μM refers to μmol / L.

[0072] Rapid Tap Master Mix and Green Taq Mix were purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0073] Single nucleotide variants (SNVs) are one of the genetic bases controlling human diseases and economic traits in plants and animals. Economical, simple, and efficient detection systems can aid in genetic disease screening and targeted screening of individuals carrying SNVs in plant base editing and mutagenesis populations. When the mutation frequency of the target allele is relatively low in plant populations undergoing induced mutations and base editing, a single high-throughput detection of all individuals in the population can determine the presence of the target base variant, significantly improving detection efficiency and reducing costs. This invention provides a method for detecting SNVs in mixed genetic samples, comprising: designing an outer primer at an appropriate position, designing a specific inner primer at the target SNV site, adding a mismatch at the third-to-last base of the 3' end of the inner primer, setting the optimal annealing temperature for the PCR system, performing PCR amplification using a mixed genetic sample from each individual in the population as a DNA template, and analyzing the PCR amplification product to identify the presence of the target SNV in the population.

[0074] The following section will use two genes controlling photosensitive male sterility in rice as examples to illustrate an efficient method for detecting specific SNV variations in a population.

[0075] The photosensitive male sterility trait in rice is caused by a single-base mutation in the long non-coding RNA (lncRNA) genes PMS1 (GenBank: KX578836.1) or PMS3 (GenBank: JQ317784.1) to pms1 (GenBank: KX578835.1) or pms3 (GenBank: JQ317785.1). The nucleotide sequences of PMS1, PMS3, pms1, and pms3 are shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4, respectively.

[0076] I. Experimental Materials:

[0077] Conventional rice material 1: The yellow-leaf mutant “Zhejing 7BY” of the BT-CMS maintainer line “Zhejing 7B”;

[0078] Conventional rice material 2: The emerald green leaf mutant line "Cuiyu B (CYB)" of the wild-absent indica rice cytoplasmic male sterility line maintainer "Longtepu B".

[0079] Conventional rice material 3: The near-isogenic line "9311pg" of the indica rice variety "9311" which aggregates the rice blast resistance genes Pi1 and Pigm.

[0080] Photosensitive male-sterile rice material: Japonica photosensitive male-sterile line “Jiang 79S”.

[0081] All the above materials are from our laboratory. The methods for obtaining them can be found in the following literature, or they can be obtained using other methods disclosed in the existing technology:

[0082] 1. Ye Jing, Ye Shenghai, Zhai Rongrong, Zhu Guofu, Zhang Xiaoming. Zhejing 7A, a Japonica rice male-sterile line bred using anther culture technology [J]. Zhejiang Agricultural Sciences, 2020, 61(8):1529-1530

[0083] 2. Li RQ, Jiang M, Huang JZ IM,Shu Q Y.Mutations of the GenomesUncoupled 4Gene Cause ROS Accumulation and Repress Expression of PeroxidaseGenes in Rice[J].Frontiers in plant science,2021,12:682453

[0084] 3. Wu YY, Xiao N, Chen Y, Yu L, Pan CH, Li YH, Zhang XX, Huang NS, Ji HJ, Dai ZY, Chen XJ, Li A H. Comprehensive evaluation of resistance effects of pyramiding lines with different broad-spectrum resistance genes against Magnaporthe oryzae in rice (Oryza sativa L.)[J].Rice(NY),2019,12(1):11

[0085] 4. Tan Yuanyuan, Wang Qing, Fu Haowei, Zhang Weizhang, Wu Sanling, Shu Qingyao. Cultivation of a two-line male-sterile Japonica rice line Jiang 79S using flower culture and irradiation mutagenesis [J]. Journal of Nuclear Agricultural Sciences, 2022, 36(06): 1073-1079

[0086] II. Verification of Experimental Materials

[0087] To ensure the accuracy of the experimental materials, the PMS1 and PMS3 gene fragments containing mutation sites in the conventional rice materials 1-3 and the photosensitive male sterile rice materials were first amplified and sequenced.

[0088] The CTAB method was used to extract leaf DNA from conventional rice materials 1-3 and photosensitive male sterile rice materials, which were then used as DNA templates.

[0089] The nucleotide sequences of the PMS1 amplification primers are as follows:

[0090] pms1 / Mseq / F: CCACGCAAGCTTGGCTCTTT (SEQ ID No. 5);

[0091] pms1 / Mseq / R:CTATCCGCCGAACCGACAGT(SEQ ID No.6);

[0092] PMS1 amplification reaction system:

[0093]

[0094] PMS1 amplification conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 5 s, for a total of 34 cycles; 72℃ extension for 5 min.

[0095] The nucleotide sequences of the PMS3 amplification primers are as follows:

[0096] pms3 / Mseq / F:TTTCTCTAACATCGCACAG(SEQ ID No.7);

[0097] pms3 / Mseq / R:TGGCAAACAAAAACTCAAC(SEQ ID No.8);

[0098] PMS3 amplification reaction system:

[0099]

[0100] PMS3 amplification conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 50℃ annealing for 15 s, 72℃ extension for 10 s, for a total of 34 cycles; 72℃ extension for 5 min.

[0101] Sequencing results of the PMS1 and PMS3 amplification products confirmed that the two genes in Jiang 79S are consistent with the reported photosensitivity-induced sterility genes, with SNV-pms1 and SNV-pms3 being T and G, respectively; while the SNV-PMS1 and SNV-PMS3 of the other three materials were G and C, respectively. Figure 1A and Figure 1B As shown.

[0102] III. Explanation of Commonly Used Experimental Methods

[0103] 3.1 Genomic DNA was extracted from leaf tissue or germinating seed coleoptile tissue using the CTAB method.

[0104] Take an appropriate amount of leaf tissue (or germinating seed coleoptile tissue), cut it into small pieces, and place it in a 2.0 ml centrifuge tube. Add two steel balls, then place the centrifuge tube in liquid nitrogen for rapid freezing. Remove the tube and grind the tissue using a tissue homogenizer. Add 900 μl of 2×CTAB extraction solution (CTAB 20.0 g, NaCl 81.8 g, Tris 12.1 g, EDTA) to the above sample. 5.8g, dissolved in 1L distilled water, sterilized, then 2ml β-mercaptoethanol (for later use), shaken well, incubated in a 65℃ water bath for 1h, shaking every 15min; add 900μl of chloroform:isoamyl alcohol (v:v = 24:1) mixture, shake well, centrifuge at 10000rpm for 10min; transfer the supernatant to a 1.5ml centrifuge tube, add an equal volume of pre-chilled isopropanol, gently shake well, and place in a -20℃ freezer for 2h, then remove and centrifuge at 10000rpm for 10min, discarding the supernatant; add 800μl of 75% ethanol, centrifuge at 10000rpm for 10min, discarding the supernatant, then add 800μl of anhydrous ethanol, centrifuge at 10000rpm for 10min, discarding the supernatant, and dry in a 37℃ oven; after drying, add 50μl... Dissolve in ddH2O, determine DNA concentration and mass using a Nanodrop micro-volume spectrophotometer, and store at -4℃.

[0105] 3.2 Sequencing and Sequence Alignment Methods

[0106] Unpurified PCR amplification products were sent to Zhejiang Youkang Biotechnology Co., Ltd. for Sanger sequencing, and the returned data were sequence aligned using DNAMAN.

[0107] 3.3 Primer Synthesis

[0108] Primers or primer pairs were synthesized by Zhejiang Shangya Biotechnology Co., Ltd.

[0109] IV. Specific Examples

[0110] Example 1

[0111] (1) Sample preparation: The sterile line Jiang 79S was used as the source of PMS1, and the conventional variety Zhejing 7BY was used as the source of PMS1. Leaf DNA was extracted from Jiang 79S and Zhejing 7BY using the CTAB method, and all leaf DNA was adjusted to the same concentration. Then, the leaf DNA of Jiang 79S and Zhejing 7BY were uniformly mixed at volume ratios of 1:1, 1:9, 1:19, 1:49, and 1:99 to obtain sample pools 1A to 1E with gradient ratios. At the same time, leaf DNA from Zhejing 7BY and leaf DNA from Jiang 79S alone were selected as control samples.

[0112] (2) PCR amplification: In the PCR 8-tube series, the selected optimal primer pair 1 for specific amplification of pms1 was used. The two control samples, five mixed samples 1A-1E, and the negative control obtained in step (1) were used as DNA templates. PCR amplification was performed according to the following settings to obtain the amplification products.

[0113] The optimal primer pair 1 for specific amplification of pms1 has the following nucleotide sequence:

[0114] p1 / 3G: ATGCATCAGGAAAGAAGCTTCTACGAT (SEQ ID No. 9);

[0115] p1 / R: TGGCTATAACTGATGACTGTGTTCCAGT (SEQ ID No. 10);

[0116] The PCR amplification product was 229 bp in size.

[0117] The PCR amplification reaction system for pms1 (20 μL) has the following composition:

[0118]

[0119] The PCR amplification program for pms1 was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 62℃ annealing for 15 s, 72℃ extension for 14 s, for a total of 30 cycles; 72℃ extension for 5 min.

[0120] (3) Detection: The PCR amplification products obtained in step (2) above were separated by agarose gel electrophoresis. After staining with GelGreen nucleic acid dye, the electrophoretic bands were formed under a gel imaging system, such as... Figure 2 As shown. Figure 2 In the diagram, M represents the DL2000 DNA Marker, 1 represents the Zhejiang Jing 7BY sample, 2 represents the Jiang 79S sample, 3-7 represent mixed samples 1A-1E, and 8 represents the negative control. It can be observed that... Figure 2 In the results, sample 1 did not amplify the target band, forming a distinct primer dimer smaller than 100 bp, lacking specificity; sample 2 specifically amplified the photosensitive male-sterile band, measuring 229 bp; samples 3-7 all amplified specific bands. This indicates a pooling threshold of 1:99. This means that if a specific SNV mutation exists within a pool of 100 unidentified samples, this method can easily, efficiently, and cost-effectively identify the population (100 samples) containing that mutant. This significantly improves detection efficiency and reduces costs for large-sample population testing.

[0121] Example 2

[0122] (1) Mixed Sample Preparation: The conventional rice variety Zhejing 7BY was used as the source of PMS1, and the male-sterile line Jiang 79S was used as the source of PMS1. Leaves from each rice plant were perforated using a 1.5mm punch to obtain several leaf tissue samples of the same size. These leaf tissues were then mixed, and DNA was extracted from the mixed leaf tissues using the CTAB method. Leaves were selected and sampled at different ratios of Jiang 79S to Zhejing 7BY samples (1:1, 1:9, 1:19, 1:24, and 1:49), and the resulting DNA samples were designated as Mixes 2A to 2E. Leaf DNA from Zhejing 7BY and Jiang 79S alone were selected as control samples.

[0123] (2) PCR amplification: Using the same primer pair 1, PCR amplification reaction system and PCR amplification program as in Example 1, the two control samples, five mixed samples 2A-2E and the negative control obtained in step (1) were used as DNA templates, and PCR amplification was performed according to the following settings to obtain amplification products.

[0124] (3) Detection: The PCR amplification products obtained in step (2) above were separated by agarose gel electrophoresis. After staining with GelGreen nucleic acid dye, the electrophoretic bands were formed under a gel imaging system, such as... Figure 3 As shown. Figure 3 In the diagram, M represents the DL2000 DNA Marker, 1 represents the Zhejiang Jing 7BY sample, 2 represents the Jiang 79S sample, 3-7 represent mixed samples 2A-2E, and 8 represents the negative control. It can be observed that... Figure 3 In the results, 1 failed to amplify the target band, forming a distinct primer dimer smaller than 100 bp, lacking specificity; 2 specifically amplified the photosensitive male-sterile band, measuring 229 bp; 3-7 all amplified specific bands. This indicates a detection ratio of 1:49, meaning a pooling threshold of 1:49. This implies that if a specific SNV mutation exists among 50 mixed unidentified materials, this method can easily, efficiently, and cost-effectively identify the population (50 samples) containing that mutant. This significantly improves detection efficiency and reduces costs for large-sample population testing.

[0125] Example 3

[0126] (1) Mixed Sample Preparation: The conventional variety Zhejing 7BY was used as the source of PMS1, and the male-sterile line Jiang 79S was used as the source of PMS1. Rice seeds were soaked for 2 days and germinated for 2 days to obtain germinating seeds. 4 mm of the coleoptile was taken from the germinating rice seed coleoptile tissue. After mixing all the germinating rice seed coleoptile tissues, DNA was extracted using the CTAB method. Germinating seeds were selected and their coleoptile tissues were sampled and mixed according to different ratios of Jiang 79S to Zhejing 7BY samples of 1:1, 1:9, 1:19, 1:24, and 1:49. The DNA samples extracted from the mixed germinating seed coleoptile tissues were designated as Mixed Samples 3A to 3E. At the same time, DNA from the germinating seed coleoptile tissues of Zhejing 7BY alone and DNA from the germinating seed coleoptile tissues of Jiang 79S alone were selected as control samples.

[0127] (2) PCR amplification: Using the same primer pair 1, PCR amplification reaction system and PCR amplification program as in Example 1, the two control samples, five mixed samples 3A-3E and the negative control obtained in step (1) were used as DNA templates, and PCR amplification was performed according to the following settings to obtain amplification products.

[0128] (3) Detection: The PCR amplification products obtained in step (2) above were separated by agarose gel electrophoresis. After staining with GelGreen nucleic acid dye, the electrophoretic bands were formed under a gel imaging system, such as... Figure 4 As shown. Figure 4 In the diagram, M represents the DL2000 DNA Marker, 1 represents the Zhejiang Jing 7BY sample, 2 represents the Jiang 79S sample, 3-7 represent mixed samples 3A-3E, and 8 represents the negative control. It can be observed that... Figure 4 In the results, sample 1 failed to amplify the target band, forming a distinct primer dimer smaller than 100 bp, lacking specificity; sample 2 specifically amplified the photosensitive sterile band, measuring 229 bp; samples 3-6 all amplified specific bands. This indicates a detection ratio of 1:24, meaning a pooling threshold of 1:24. This implies that if a specific SNV mutation exists among 25 mixed unidentified materials, this method can easily, efficiently, and cost-effectively identify the population (25 samples) containing that mutant seed. This significantly improves detection efficiency and reduces costs for large-sample population testing.

[0129] Example 4

[0130] (1) Sample preparation: The sterile line Jiang 79S was used as the source of PMS3, and the conventional variety Zhejing 7BY was used as the source of PMS3. Leaf DNA was extracted from Jiang 79S and Zhejing 7BY using the CTAB method, and all leaf DNA was adjusted to the same concentration. Then, the leaf DNA of Jiang 79S and Zhejing 7BY were uniformly mixed at volume ratios of 1:1, 1:9, 1:19, 1:49, and 1:99 to obtain gradient proportions of mixtures 4A to 4E. At the same time, leaf DNA from Zhejing 7BY and leaf DNA from Jiang 79S alone were selected as control samples.

[0131] (2) PCR amplification: In the PCR 8-tube series, the selected optimal primer pair 2 for specific amplification of pms3 was used. The two control samples, five mixed samples 4A-4E, and the negative control obtained in step (1) were used as DNA templates. PCR amplification was performed according to the following settings to obtain the amplification products.

[0132] The optimal primer pair 2 for specific amplification of pms3 has the following nucleotide sequence:

[0133] p3 / 3G: GATAAAAATTTTACTCTTGATGGATGGGAC (SEQ ID No. 11);

[0134] p3 / F: AAGAAAAGCAGAGACATAGATGAGCAAC (SEQ ID No. 12);

[0135] The PCR amplification product was 185 bp in size.

[0136] The PCR amplification reaction system for pms3 (20 μL) has the following composition:

[0137]

[0138] The PCR amplification program for pms3 was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 63℃ annealing for 15 s, 72℃ extension for 12 s, for a total of 30 cycles; 72℃ extension for 5 min.

[0139] (3) Detection: The PCR amplification products obtained in step (2) above were separated by agarose gel electrophoresis. After staining with GelGreen nucleic acid dye, the electrophoretic bands were formed under a gel imaging system, such as... Figure 5 As shown. Figure 5 In the diagram, M represents the DL2000 DNA Marker, 1 represents the Zhejiang Jing 7BY sample, 2 represents the Jiang 79S sample, 3-7 represent mixed samples 4A-4E, and 8 represents the negative control. It can be observed that... Figure 5In the results, sample 1 did not amplify the target band, forming a distinct primer dimer smaller than 100 bp, lacking specificity; sample 2 specifically amplified the photosensitive sterile band, measuring 185 bp; samples 3-7 all amplified specific bands. This indicates a pooling threshold of 1:99. This means that if a specific SNV mutation exists within a pool of 100 unidentified samples, this method can easily, efficiently, and cost-effectively identify the population (100 samples) containing that mutant. This significantly improves detection efficiency and reduces costs for large-sample population testing.

[0140] Example 5

[0141] (1) Mixed Sample Preparation: The conventional rice variety Zhejing 7BY was used as the source of PMS3, and the male-sterile line Jiang 79S was used as the source of PMS3. Leaves from each rice plant were perforated using a 1.5mm punch to obtain several leaf tissue samples of the same size. These leaf tissues were then mixed, and DNA was extracted from the mixed leaf tissues using the CTAB method. Leaves were selected and sampled at different ratios of Jiang 79S to Zhejing 7BY samples (1:1, 1:9, 1:19, 1:24, and 1:49), and the resulting DNA samples were designated as Mixed Samples 5A to 5E. Leaf DNA from Zhejing 7BY and Jiang 79S alone were selected as control samples.

[0142] (2) PCR amplification: Using the same primer pair 2, PCR amplification reaction system and PCR amplification program as in Example 4, the two control samples, five mixed samples 5A-5E and the negative control obtained in step (1) were used as DNA templates, and PCR amplification was performed according to the following settings to obtain amplification products.

[0143] (3) Detection: The PCR amplification products obtained in step (2) above were separated by agarose gel electrophoresis. After staining with GelGreen nucleic acid dye, the electrophoretic bands were formed under a gel imaging system, such as... Figure 6 As shown. Figure 6 In the diagram, M represents the DL2000 DNA Marker, 1 represents the Zhejiang Jing 7BY sample, 2 represents the Jiang 79S sample, 3-7 represent mixed samples 5A-5E, and 8 represents the negative control. It can be observed that... Figure 6In the results, 1 failed to amplify the target band, forming a distinct primer dimer smaller than 100 bp, lacking specificity; 2 specifically amplified the photosensitive male-sterile band, measuring 185 bp; 3–7 all amplified specific bands. This indicates a detection ratio of 1:49, meaning a pooling threshold of 1:49. This implies that if a specific SNV mutation exists among 50 mixed unidentified materials, this method can easily, efficiently, and cost-effectively identify the population (50 samples) containing that mutant. This significantly improves detection efficiency and reduces costs for large-sample population testing.

[0144] Example 6

[0145] (1) Mixed Sample Preparation: The conventional variety Zhejing 7BY was used as the source of PMS3, and the male-sterile line Jiang 79S was used as the source of PMS3. Rice seeds were soaked for 2 days and germinated for 2 days to obtain germinating seeds. 4 mm of the coleoptile was taken from the germinating rice seed coleoptile tissue. After mixing all the germinating rice seed coleoptile tissues, DNA was extracted using the CTAB method. Germinating seeds were selected and coleoptile tissues were sampled and mixed at different ratios of Jiang 79S to Zhejing 7BY samples of 1:1, 1:9, 1:19, 1:24, and 1:49. The DNA samples extracted from the mixed germinating seed coleoptile tissues were designated as Mixed Samples 6A to 6E. At the same time, DNA from the germinating seed coleoptile tissues of Zhejing 7BY alone and DNA from the germinating seed coleoptile tissues of Jiang 79S alone were selected as controls.

[0146] (2) PCR amplification: Using the same primer pair 2, PCR amplification reaction system and PCR amplification program as in Example 4, the two control samples, five mixed samples 6A-6E and the negative control obtained in step (1) were used as DNA templates, and PCR amplification was performed according to the following settings to obtain amplification products.

[0147] (3) Detection: The PCR amplification products obtained in step (2) above were separated by agarose gel electrophoresis. After staining with GelGreen nucleic acid dye, the electrophoretic bands were formed under a gel imaging system, such as... Figure 7 As shown. Figure 7 In the diagram, M represents the DL2000 DNA Marker, 1 represents the Zhejiang Jing 7BY sample, 2 represents the Jiang 79S sample, 3-7 represent mixed samples 6A-6E, and 8 represents the negative control. It can be observed that... Figure 7In the results, sample 1 failed to amplify the target band, forming a distinct primer dimer smaller than 100 bp, lacking specificity; sample 2 specifically amplified the photosensitive sterile band, measuring 185 bp; samples 3-6 all amplified specific bands. This indicates a detection ratio of 1:24, meaning a pooling threshold of 1:24. This implies that if a specific SNV mutation exists among 25 mixed unidentified materials, this method can easily, efficiently, and cost-effectively identify the population (25 samples) containing that mutant seed. This significantly improves detection efficiency and reduces costs for large-sample population testing.

[0148] The above methods have all undergone multiple rounds of testing, and the results can be reproduced well.

[0149] In addition, pms1 and pms3 detection experiments were also conducted on the aforementioned two other conventional materials (CYB and 9311pg). The results showed that they could specifically and efficiently detect pms1 and pms3. This means that primer pair 1 and primer pair 2 have universality and can be used to detect single nucleotide variations of photosensitive male sterility genes in different rice materials. They can be extended to molecular marker-assisted selection breeding of photoperiod-temperature-sensitive male sterile lines in rice, expanding the breeding population and shortening the breeding cycle of male sterile lines.

[0150] As can be seen, this invention, using two photosensitive fertility genes in rice as examples, establishes a highly efficient method for detecting specific SNVs in mixed genetic samples. A pair of primers was determined for each of the two photosensitive sterility loci, PMS1 and PMS3, and the PCR system was adjusted to the optimal conditions, establishing a method, Pool-ARMS, that can efficiently detect target SNVs in a population of plants. In this invention, rapid screening of DNA extracted from mixed samples of plant leaves greatly simplifies the DNA template preparation and amplification process in the population. Rapid screening of DNA extracted from a small amount of coleoptile tissue selected from germinating seeds ensures that the seeds can still grow normally after the coleoptile is removed, while also significantly reducing the workload. Moreover, this method has the advantages of accuracy and practicality, and is expected to become an effective molecular biological detection tool. It can be applied to the breeding of other crops and animals for targeted screening of target variations in single-base edited populations and physicochemically induced mutagenesis populations, aiming to play an important role in the development of modern agriculture.

[0151] Comparative Example 1

[0152] The sterile line Jiang 79S was used as the source of pms1, and the conventional variety Zhejing 7BY was used as the source of PMS1. Leaf DNA was extracted from Jiang 79S and Zhejing 7BY using the CTAB method, and used as DNA templates. In 8-tube PCR, the aforementioned DNA templates were amplified using the following primer pair 3 according to the following settings to obtain amplified products.

[0153] The nucleotide sequence of primer pair 3 is shown below:

[0154] p1 / 2G: ATGCATCAGGAAAGAAGCTTCTACTGT (SEQ ID No. 13);

[0155] p1 / R: TGGCTATAACTGATGACTGTGTTCCAGT (SEQ ID No. 10);

[0156] The PCR amplification product was 229 bp in size.

[0157] The PCR amplification reaction system for pms1 (20 μL) has the following composition:

[0158]

[0159] The PCR amplification program for pms1 was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃-66℃ gradient annealing for 15 s, 72℃ extension for 14 s, for a total of 30 cycles; 72℃ extension for 5 min.

[0160] The products obtained from PCR amplification were separated by agarose gel electrophoresis. After staining with GelGreen nucleic acid dye, the electrophoretic bands were imaged under a gel imaging system, as shown in the image. Figure 8 As shown. Figure 8 In the diagram, M represents the DL2000 DNA Marker, the eight lanes on the left represent the Zhejiang Jing 7BY sample, and the eight lanes on the right represent the Jiang 79S sample. It can be observed that... Figure 8 In the study, both materials amplified a 229bp band at temperature gradients of 56℃ to 66℃ (specifically 56.9℃, 57.8℃, 59.1℃, 60.4℃, 61.6℃, 62.9℃, 64.2℃, and 65.1℃). This indicates that primer pair 3 has poor specificity and cannot distinguish the SNV differences between pms1 and PMS1, and obviously cannot be used for the detection of the rice photoperiod-temperature-sensitive male sterility gene pms1 in mixed genetic samples.

[0161] Comparative Example 2

[0162] The sterile line Jiang 79S was used as the source of PMS3, and the conventional variety Zhejing 7BY was used as the source of PMS3. Leaf DNA was extracted from Jiang 79S and Zhejing 7BY using the CTAB method, and used as DNA templates. In 8-tube PCR, the following primer pair 4 was used to amplify the aforementioned DNA templates according to the following settings to obtain amplification products.

[0163] The nucleotide sequence of primer pair 4 is shown below:

[0164] p3 / 2G: GATAAAAATTTTACTCTTGATGGATGGTGC (SEQ ID No. 14);

[0165] p3 / F: AAGAAAAGCAGAGACATAGATGAGCAAC (SEQ ID No. 12);

[0166] The PCR amplification product was 185 bp in size.

[0167] The PCR amplification reaction system for pms3 (20 μL) has the following composition:

[0168]

[0169]

[0170] The PCR amplification program for pms3 was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, annealing at a temperature gradient of 56℃-66℃ (specifically 56.9℃, 57.8℃, 59.1℃, 60.4℃, 61.6℃, 62.9℃, 64.2℃, 65.1℃) for 15 s, extension at 72℃ for 12 s, for a total of 30 cycles; and extension at 72℃ for 5 min.

[0171] The products obtained from PCR amplification were separated by agarose gel electrophoresis. After staining with GelGreen nucleic acid dye, the electrophoretic bands were imaged under a gel imaging system, as shown in the image. Figure 9 As shown. Figure 9 In the diagram, M represents the DL2000 DNA Marker, the eight lanes on the left represent the Zhejiang Jing 7BY sample, and the eight lanes on the right represent the Jiang 79S sample. It can be observed that... Figure 9 In the study, both materials simultaneously amplified 185bp bands at the first seven temperature gradients, but neither material amplified a band at 65.1℃. This indicates that primer pair 4 has poor specificity and cannot distinguish the SNV differences between pms3 and PMS3, and obviously cannot be used to detect the photoperiod-temperature-sensitive male sterility gene pms3 in mixed genetic samples.

[0172] It can be seen that although both Pool-ARMS primer pairs are designed for pms1 and pms3 containing specific SNV sites, primer pair 3 in Comparative Example 1 and primer pair 4 in Comparative Example 2 do not have good specificity. Even when using leaf DNA from a single plant as a template, PCR amplification based on these two primer pairs did not yield the target band. This means that they cannot even perform genotyping on individual mutant plants, let alone detect mutant individuals in a population. The number of primer pairs in Pool-ARMS is reduced compared to the number of primers in traditional ARMS-PCR, and the primer pairs have a more significant impact on PCR amplification, making their role more important. Compared to Comparative Examples 1 and 2, the primer pairs 1 and 2 selected in this embodiment of the invention achieved unexpected technical effects: not only can genotyping of individual mutant plants be performed, but the target SNV variation in mixed genetic samples can also be identified. Furthermore, the mixed sample threshold is significantly improved compared to traditional thresholds, allowing for its application in molecular marker-assisted selection breeding of photoperiod-temperature-sensitive male-sterile rice lines. This expands the selection population, shortens the male-sterile line selection cycle, and provides a new method for material creation, holding significant value in utilizing heterosis in two-line breeding. This method is expected to replace single-sample sequencing in the targeted mutation screening and identification of single-base edited samples from animals and plants and medical disease samples, as well as in the detection of target mutations in plant mutation breeding, greatly improving detection efficiency. This method combines the advantages of high PCR sensitivity, simplicity, speed, low cost, and low requirements for sample purity, making it suitable for widespread application.

[0173] It is evident that the objective of this invention has been fully and effectively achieved. The method and principle of this invention have been demonstrated and described in the embodiments. Any modifications can be made to the implementation methods without departing from the stated principles. Therefore, this invention includes all modified embodiments based on the spirit and scope of the claims.

Claims

1. A rice photosensitive sterility gene pms1 The detection method includes the following steps: (1) Prepare a mixed genetic sample and use it as a DNA template by any of the following methods (i) to (iii): (i) Extract leaf DNA from each rice plant in the population and adjust it to the same concentration. Then mix the leaf DNA in equal volumes to use as a DNA template. (ii) Take leaf tissues of the same size from each rice plant in the population, mix them, and then extract DNA as a DNA template; (iii) Take coleoptile tissues of the same length from each germinating rice seed in the population, mix them, and then extract DNA as a DNA template; (2) Using the first primer pair below, the DNA template prepared in step (1) is subjected to PCR amplification according to the first PCR amplification program below to obtain PCR amplification products; The nucleotide sequence of the first primer pair is shown below: p1 / 3G: ATGCATCAGGAAAGAAGCTTCTACGAT (SEQ ID No. 9); p1 / R: TGGCTATAACTGATGACTGTGTTCCAGT (SEQ ID No. 10); The PCR amplification product was 229 bp in size. The first PCR amplification program is as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, 62 ℃ annealing for 15 s, 72 ℃ extension for 14 s, for a total of 30 cycles; 72 ℃ extension for 5 min; (3) The PCR amplification products obtained in step (2) are subjected to electrophoresis to determine whether the rice photoperiod-sensitive male sterility gene exists in the population. pms1 Mutant plant.

2. The method as described in claim 1, characterized in that, In step (2), pms1 The PCR amplification reaction system consisted of the following components: 1 μL of the DNA template (200 ng / μL); 0.8 μL of p1 / 3G primer (10 μM); 0.8 μL of p1 / R primer (10 μM); 7.4 μL of ddH2O; and 10 μL of Green Taq Mix.

3. The method as described in claim 1, characterized in that, In step (1), the leaf tissue is obtained by punching holes in the leaves of the rice plant and taking samples; the coleoptile tissue of the germinating rice seed is obtained by soaking and germinating the rice seed to obtain the germinating rice seed and then taking the coleoptile of the same length.

4. A rice photosensitive male sterility gene pms3 The detection method includes the following steps: (1) Prepare a mixed genetic sample and use it as a DNA template by any of the following methods (i) to (iii): (i) Extract leaf DNA from each rice plant in the population and adjust it to the same concentration. Then mix the leaf DNA in equal volumes to use as a DNA template. (ii) Take leaf tissues of the same size from each rice plant in the population, mix them, and then extract DNA as a DNA template; (iii) Take coleoptile tissues of the same length from each germinating rice seed in the population, mix them, and then extract DNA as a DNA template; (2) Using the second primer pair below, the DNA template prepared in step (1) is subjected to PCR amplification according to the second PCR amplification procedure below to obtain PCR amplification products; The nucleotide sequence of the second primer pair is shown below: p3 / 3G: GATAAAAATTTTACTCTTGATGGATGGGAC (SEQ ID No. 11); p3 / F: AAGAAAAGCAGAGACATAGATGAGCAAC (SEQ ID No. 12); The PCR amplification product size was 185 bp; The second PCR amplification program is as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, 63 ℃ annealing for 15 s, 72 ℃ extension for 12 s, for a total of 30 cycles; 72 ℃ extension for 5 min; (3) The PCR amplification products obtained in step (2) are subjected to electrophoresis to determine whether the rice photoperiod-sensitive male sterility gene exists in the population. pms3 Mutant plant.

5. The method as described in claim 4, characterized in that, In step (2), pms3 The PCR amplification reaction system consisted of the following: 1 μL of the DNA template at a concentration of 200 ng / μL; and 0.8 μL of p3 / 3G primer at a concentration of 10 μM. 0.8 μL of p3 / F primer at a concentration of 10 μM; 7.4 μL of ddH2O; 10 μL of Green Taq Mix.

6. The method as described in claim 4, characterized in that, In step (1), the leaf tissue is obtained by punching holes in the leaves of the rice plant and taking samples; the coleoptile tissue is obtained by soaking and germinating rice seeds to obtain germinating rice seeds and taking the coleoptile of the same length.