SNP molecular markers related to polyphenol content in tomato fruit and their applications

Abstract

This invention discloses a SNP molecular marker for identifying the polyphenol content of tomato fruits and its application. Specifically, a G / A substitution type single nucleotide polymorphism exists at position 501 of the sequence in SEQ ID NO.1, which is either 501G or 501A. SNPs linked to SNP-p... cGT A nonsynonymous mutation occurred in the second exon of the gene SlCGT (Solyc01g099020); an A / G substitution type single nucleotide polymorphism was present at position 637 of SEQ ID NO.4, which was 637A (for varieties with relatively low polyphenol content) or 637G (for varieties with relatively high polyphenol content). This invention also discloses primer pairs for detecting SNP markers and methods for applying SNP markers in identifying varieties with high or low polyphenol content in tomato fruits, improving the efficiency and accuracy of seed selection.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and molecular biology, specifically to SNP molecular markers related to the polyphenol content of tomato fruits and their applications. Background Technology

[0002] Tomatoes are self-pollinating plants, highly adaptable, nutritious, and uniquely flavorful, with diverse cultivation methods, and are widely grown worldwide. The polyphenol content of fruit is an important agronomic trait, directly affecting tomato fruit quality and consumer demand. In recent years, research on polyphenols has increased significantly. Metabolites such as flavonoids, chlorogenic acid, and phenylpropionic acid play important roles in many aspects of crop development, including pigmentation in fruits and vegetables, plant-pathogen interactions, tolerance to strong light, salinity, and cold stress, and precursors of volatile substances. Tomatoes have become a major model crop for research on flavonoids, chlorogenic acid, and phenylpropionic acid. Furthermore, polyphenolic compounds are an indispensable part of the diet. Increasing research shows that fruits and vegetables are rich in dietary polyphenols, which are highly effective in preventing cardiovascular disease and other chronic diseases, including diabetes and obesity. Some polyphenolic substances, such as goniochalcone (NC) and its glycosides, have long been considered metabolic markers of maturity in model tomato varieties. Previous studies have identified seven CGA-related compounds in tomato tissues: chlorogenic acid (3-CGA), cryptochlorogenic acid (4-CGA), neochlorogenic acid (5-CGA), and three dicaffeoyl and one tricaffeoyl chlorogenic acids. Furthermore, the CGA derivatives caffeoyl-2-O-glucarate (Caf2Glr) and caffeoyl-5-O-glucarate (Caf5Glr) have been identified as nutrient-rich green tissue-specific metabolites in tomatoes. However, the metabolic changes of polyphenols during tomato fruit ripening remain poorly understood. Therefore, elucidating these changes in polyphenol metabolites using natural tomato populations through multi-omics-assisted breeding methods is crucial.

[0003] In my country, tomatoes are primarily consumed fresh. Excessive polyphenol content can negatively impact their taste. Currently, in breeding, the selection of different fruit materials often relies on traditional methods of phenotypic identification at fruit maturity due to the lack of molecular markers related to genes controlling the relative content of polyphenols in fruits. This method is highly time-consuming and resource-intensive. Developing molecular markers related to the relative content of polyphenols in fruits would allow for the identification of polyphenol content as early as the seedling stage, and also enable large-scale screening of different materials, offering significant economic and social benefits.

[0004] With the rapid development of molecular biology techniques and molecular quantitative genetics, research on molecular genetic markers and marker-assisted selection has been widely carried out and applied in crop breeding, generating a significant impact. SNPs (Single nucleotide polymorphisms) refer to DNA sequence polymorphisms caused by variations in a single nucleotide in the genome. These markers have broad genomic distribution and can be used for large-scale population screening. SNP detection technologies mainly include microarray technology, TaqMan technology, molecular beacon technology, and pyrosequencing. With the decrease in sequencing costs and the advancement of detection technologies, SNP markers have been used more widely.

[0005] Molecular marker-assisted selection (MMR) breeding is a new technology that has emerged with the rapid development of modern molecular biology techniques. It allows for the rapid and accurate analysis of an individual's genetic makeup at the molecular level, enabling direct genotypic selection and molecular breeding. MMR breeding has opened a new avenue for crop breeding, and its role in crop breeding will become increasingly significant with the advancement of modern biological technology. Traditional breeding is time-consuming and labor-intensive. The development and application of molecular markers, especially those targeting the relative polyphenol content of tomato offspring, allows for rapid and accurate screening of polyphenol traits at the seedling stage. This is an effective way to shorten the breeding cycle for polyphenol content in tomato fruits, reduce breeding costs, and improve breeding efficiency. Therefore, molecular markers related to polyphenol traits in tomato fruits represent a crucial technological barrier that needs to be overcome in the rapid development of disease- and pest-resistant, high-quality varieties. This is of great significance for improving tomato quality and increasing farmers' income. Summary of the Invention

[0006] In view of the deficiencies in the existing technology, the purpose of this invention is to provide SNP molecular markers related to the polyphenol content of tomato fruits and specific primer pairs for detecting these molecular markers, so as to improve the efficiency and accuracy of seed selection.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] SNP molecular markers associated with polyphenol content in tomato fruit, characterized in that the SNP molecular markers include SNP-p and SNPs linked to SNP-p. CGT .

[0009] Furthermore, the nucleotide sequence of the SNP-p molecular marker is shown in SEQ ID NO.1, where there is an SNP site at position 501 bp, and the base here is G or A. G corresponds to tomatoes with high polyphenol content, and A corresponds to tomatoes with low polyphenol content.

[0010] Furthermore, the SNP CGTThe nucleotide sequence of the molecular marker is shown in SEQ ID NO.4, where there is an SNP site at 637bp, where the base is A or G. A corresponds to tomatoes with low polyphenol content, and G corresponds to tomatoes with high polyphenol content. The SNP site is located at the second exon of the tomato SlCGT gene.

[0011] Furthermore, the specific primer pair for detecting SNP-p molecular markers is characterized by having the following characteristics:

[0012] Forward primer F: 5'TCATCGGATTCACTTTCAGTTGTC 3';

[0013] Reverse primer R: 5'CTTGATACAAATGGAACAATGTTCAG 3'.

[0014] Furthermore, it is used to detect labeled SNPs. CGT Molecular marker-specific primer pairs, characterized in that they are respectively:

[0015] Forward primer F: 5'ATGGCATTGGGAATGAGAGTG 3';

[0016] Reverse primer R: 5'AACACGACAGTTCAATTGGGGT 3'.

[0017] Another objective of this invention is to provide a method for identifying the polyphenol content of tomato fruits.

[0018] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0019] A method for identifying the polyphenol content of tomato fruit, characterized by comprising the following steps:

[0020] Step 1: Extract genomic DNA from the tomatoes to be tested;

[0021] Step 2: Using the specific primer pair described in claim 4 or 5, PCR amplification is performed with the genomic DNA of the tomato to be tested as a template, and the PCR amplification product is then subjected to gel electrophoresis.

[0022] Step 3: Cut the target band in the gel electrophoresis results and perform gel sequencing to obtain the sequencing results;

[0023] Step 4: Compare the sequencing results with SNP molecular markers to determine the relative content of polyphenols in the tomato fruit to be tested.

[0024] Furthermore, the PCR amplification reaction system in step two is: containing MonAmp TM25 μL of 2×Taq Mix (+Dye), 1 μL each of 10 μM forward and reverse primers, 1 μL of 20 ng / μL DNA template, and ddH2O to bring the total to 50 μL;

[0025] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s or 90 s, 35 cycles; 72℃ extension for 5 min.

[0026] The PCR amplification products were detected by agarose gel electrophoresis. If the result showed only a single 601 bp band (228th to 828th bp of the sequence shown in Seq ID No. 1), the amplified target band was specific. Pyrosequencing was then performed on the relevant sequences. If the target band at 274 bp (equivalent to 501st bp of the sequence shown in Seq ID No. 1) was G, it indicated that the relative polyphenol content of the tested tomato was likely high; if the target band at 274 bp was A, it indicated that the relative polyphenol content of the tested tomato was likely low. If the result showed only a single 1482 bp band (86th to 1567th bp of the sequence shown in Seq ID No. 4), the amplified target band was specific. Pyrosequencing was then performed on the relevant sequences. If the target band at 552 bp (equivalent to Seq ID No. 4) was G, the target band at 501st bp (equivalent to 501st bp of the sequence shown in Seq ID No. 1) was G, it indicated that the relative polyphenol content of the tested tomato was likely high; if the target band at 552 bp (equivalent to 501st bp of the sequence shown in Seq ID No. 1) was G, it indicated that the relative polyphenol content of the tested tomato was likely low. The presence of G at 637bp of the sequence shown in No.4 indicates that the relative polyphenol content of the tomato being tested is very likely to be high. If the presence of A at 552bp of the target band indicates that the relative polyphenol content of the tomato being tested is very likely to be low.

[0027] The relative polyphenol content is related to genotype as follows: GG genotype > AA genotype.

[0028] Another object of the present invention is to provide the application of SNP molecular markers related to the polyphenol content of tomato fruit.

[0029] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0030] Contains the specific primer pairs described above for detecting SNP-p molecular markers and SNPs CGT A kit for detecting the relative content of polyphenols in tomato fruits using molecular marker-specific primer pairs;

[0031] Another technical solution adopted by this invention is:

[0032] SNP-p molecular markers and SNPs related to the relative content of polyphenols in tomato fruits CGTThe application of molecular markers in marker-assisted breeding of tomatoes. This involves selecting tomato varieties with relatively high and relatively low polyphenol content based on genotype, thereby accelerating the tomato breeding process. Specifically:

[0033] First, resequencing data from 331 tomato germplasm materials and metabolic data on polyphenols (β-D-glucopyranosylcaffeic acid) were used. Genome-wide association analysis (GWAS) was employed to identify two SNP loci associated with the relative polyphenol content in tomato fruit from 2,875,396 SNPs in the currant tomato (PIM) and cherry tomato (CER) populations. Figure 3 4). According to the tomato genome (SL2.4) and the genome annotation version (ITAG2.3), SNP-p is located in the intergenic region, and SNPs linked to SNP-p are... CGT The locus is located on the second exon of the gene Solyc01g099020 (SlCGT) (ch01: 81121473). The base G at this locus is highly linked to polyphenol phenotypes with relatively high abundance, while the base A at this locus is highly linked to polyphenol phenotypes with relatively low abundance. Analysis of the distribution of this locus in the PIM and CER populations revealed that 31 individuals in the 53 PIM populations had the AA genotype, and 94 individuals in the 112 CER populations had the GG genotype.

[0034] The present invention discloses a SNP molecular marker for identifying the polyphenol content of tomato fruits and its application. Its advantages include: it can replace the traditional method of determining the relative polyphenol content of tomato fruits after ripening, completely eliminating the influence of human factors and making the results more accurate and reliable. Compared with traditional methods, the method of the present invention is simpler and more effective, greatly improving breeding efficiency and economic benefits, and enabling large-scale screening of breeding materials, significantly accelerating the tomato breeding process. Attached Figure Description

[0035] The present invention includes the following figures:

[0036] Figure 1 The frequency histogram of β-D-glucopyranosylcaffeic acid content distribution is provided in the embodiments of the present invention.

[0037] Figure 2 The relative content distribution of β-D-pyranoglucosylcaffeic acid in currant tomatoes (PIM), cherry tomatoes (CER), and large-fruited tomatoes (BIG) provided in this embodiment of the invention is shown in the figure.

[0038] Figure 3This invention utilizes GWAS analysis to screen 288,000 SNPs (minimum allele frequency > 5%, deletion rate < 10%) from currant tomatoes and cherry tomatoes to identify SNP-p sites associated with polyphenol content in tomato fruits.

[0039] Figure 4 This invention discovers SNPs linked to SNP-p. CGT (SL2.40ch01:81121473) Schematic diagram: A nonsynonymous mutation occurred on the second exon of the gene SlCGT(Solyc01g099020).

[0040] Figure 5 SNP in this invention CGT A graph showing the relative content of polyphenol β-D-glucopyranosylcaffeic acid under different genotypes.

[0041] Figure 6 The SNP molecular marker SNP-p sequencing results provided in this embodiment of the invention; wherein, the [GG] genotype is a variety with a relatively high content of fruit polyphenols, and the [AA] genotype is a variety with a relatively low content of fruit polyphenols.

[0042] Figure 7 The SNP molecular marker SNP provided in this embodiment of the invention CGT The sequencing results are shown in the figure; among them, the [GG] genotype is a variety with a relatively high content of fruit polyphenols, and the [AA] genotype is a variety with a relatively low content of fruit polyphenols. Detailed Implementation

[0043] The following is in conjunction with the embodiments and appendices Figure 1-7 The specific embodiments of the present invention will be described in detail below. The embodiments are used to illustrate the specific content of the present invention, but are not intended to limit the scope of the present invention.

[0044] Example 1: Obtaining SNP-p markers related to the relative content of polyphenols in tomato fruits

[0045] Resequencing was performed on 331 accessions of currant tomato (PIM), cherry tomato (CER), and large-fruited tomato (BIG) collected from around the world. Simultaneously, their polyphenol (β-D-glucopyranosylcaffeic acid) phenotypes were collected, revealing that their phenotypes conformed to a normal distribution. Figure 1Statistical analysis of polyphenol content distribution in PIM, CER, and BIG populations revealed significant differences in polyphenol content between PIM and CER, and between CER and BIG populations. Genome-wide association analysis (GWA) was performed on the PIM and CER populations using a mixed linear model (MLM). EMMAX software was used to identify a single SNP (SL2.40ch01:80380047) from 288,000 SNPs that was significantly associated with the relative polyphenol content phenotype in tomato fruit. Figure 3 At this locus, G is highly linked to varieties with relatively high fruit polyphenol content (88 individuals with the GG genotype in 112 CER populations), while A is highly linked to varieties with relatively low fruit polyphenol content (36 individuals with the AA genotype in 53 PIM populations).

[0046] The relative content of polyphenols in tomato fruits was detected using primer pairs spanning the SNP-p region (Seq ID No. 2-3). The specific method is as follows: Genomic DNA was extracted from the tomatoes to be tested, and PCR amplification was performed using specific primer pairs for detecting the SNP-p marker. The PCR reaction system contained 1.5 mmol / L Mg... 2+ 2 μL of 1×PCR reaction buffer, 0.8 μL of 2.5 mM dNTPs, 0.3 μL each of 10 μM forward and reverse primers, 0.4 μL of 2.5 U / μL Taq DNA polymerase, 2 μL of 20 ng / μL DNA template, and ddH2O to bring the total to 20 μL.

[0047] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0048] The PCR amplification products were detected by agarose gel electrophoresis. If the detection result showed only a single 601 bp band (228 to 828 bp of the sequence shown in Seq ID No. 1), it indicated that the amplified target band was specific. The relevant sequence was then subjected to pyrosequencing. If the target band at 274 bp (equivalent to the 501 bp of the sequence shown in Seq ID No. 1) was G, it indicated that the relative polyphenol content of the tested tomato was very likely to be high. If the target band at 274 bp was A, it indicated that the relative polyphenol content of the tested tomato was very likely to be low.

[0049] Example 2: SNPs related to the relative content of polyphenols in tomato fruits CGT Marking

[0050] Chaining analysis revealed SNPs CGT(SL2.40ch01:81121473) is linked to SNP-p, which is located on the second exon of the gene SlCGT (Solyc01g099020) and has undergone a nonsynonymous mutation. Figure 4 At this locus, G is highly linked to varieties with relatively high fruit polyphenol content (94 individuals with the GG genotype in 112 CER populations), while A is highly linked to varieties with relatively low fruit polyphenol content (31 individuals with the AA genotype in 53 PIM populations).

[0051] Utilizing SNPs CGT The primer pairs (Seq ID No. 5-6) were used to detect the relative content of polyphenols in tomato fruits. The specific method is as follows: Genomic DNA was extracted from the tomatoes to be tested, and the primers were used to detect the SNP markers. CGT PCR amplification was performed using specific primer pairs. The PCR reaction system contained 1.5 mmol / L Mg. 2+ 2 μL of 1×PCR reaction buffer, 0.8 μL of 2.5 mM dNTPs, 0.3 μL each of 10 μM forward and reverse primers, 0.4 μL of 2.5 U / μL Taq DNA polymerase, 2 μL of 20 ng / μL DNA template, and ddH2O to bring the total to 20 μL.

[0052] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 90 s, 35 cycles; 72℃ extension for 5 min.

[0053] The PCR amplification products were detected by agarose gel electrophoresis. If the detection result showed only a single band of 1482 bp (86th to 1567th bp of the sequence shown in Seq ID No. 4), it indicated that the amplified target band was specific. The relevant sequence was then subjected to pyrosequencing. If the target band at 552 bp (equivalent to 637th bp of the sequence shown in Seq ID No. 4) was G, it indicated that the relative polyphenol content of the tested tomato was very likely to be high. If the target band at 552 bp was A, it indicated that the relative polyphenol content of the tested tomato was very likely to be low.

[0054] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Any aspects not covered in the embodiments of the present invention can be selected from the prior art by those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

[0055] The contents not described in detail in this specification are existing technologies known to those skilled in the art. SEQUENCE LISTING <110> China Agricultural University <120> SNP molecular markers related to polyphenol content in tomato fruit and their applications <130> SEQ ID NO. <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 1001 <212> DNA <213> tomato <220> <221> misc_feature <222> (501)..(501) <223> n is g or a <400> 1 tgccaattgt ctcatcattc tcatattcac attggcaaat aacacatatt atttcttctc 60 catcgtcagt atcacgatga attcttgttt ttatcatatt tcctataatc tcctctgtaa 120 cctcctcctc gttctcgtcc tcgtcctcgt cctcattgcc ttccacgtag agcacaatat 180 cttccaataa acgtatcaaa taaatcatgt catcaatatc aatattatca tcggattcac 240 tttcagttgt catatcatca tcggattcac tttccattgt gacatcatca atgaattcag 300 ttgttaattg atcaaaggaa ctctgttgat tatatatatg acgatccaga cccataagag 360 ttgaattgtg atctaataag tattgattat ttggttgagg ttgatgttga tcaatgaatt 420 cccttgttat ctgatttaac aaataatcaa acgaactcat gattgataac actaaattat 480 gtatagtaat caataaaatt ntagagagaa aatattggaa cgatgaatta agcagtatga 540 ggaatacgag tttatataac acaaagttct ttacttacta ggattaggaa aaaattatat 600 tactatattt tatacgtaca tatactaaat atggaaactc cctatctcaa aaagtttaat 660 ttacaatttt acctcaaaag ttaactaaca atatagtcct tttacattca aacattatta 720 ccaaatattt ctaatatctt tggtttctaa atttgacatc aaaattcctt taaatatgaa 780 ttaagtatta atgatctctt tactgaacat tgttccattt gtatcaagat aagtgtattg 840 ttaaaatatt tttcatagtt caaattaact taattgtgtg atcttcaaaa atatatttta 900 aattttcttt tatttttatc cttcatttaa attttccatg tgatgagtga ataaactttg 960 attgcgtagt tagaatttaa agtagttatc atgattaatg t 1001 <210> 2 <211> 24 <212> DNA <213> Artificial sequence <400> 2 tcatcggatt cactttcagt tgtc 24 <210> 3 <211> 26 <212> DNA <213> Artificial sequence <400> 3 cttgatacaa atggaacaat gttcag 26 <210> 4 <211> 1719 <212> DNA <213> Tomato <220> <221> misc_feature <222> (637)..(637) <223> n is a or g <400> 4 atacgtcctg ttttcatcct atggaaatta attgcgtttt ctccttttct atataatctc 60 aattttgtat ttgcaaaatc aaatcatggc attgggaatg agagtggtag tgtttcatct 120 cttaatcagt ttgttgcttc ttcaactgat caaaggagat gatgatatga taataaagct 180 taaagaaccg aaattgaaga aatgcggaat tgacagaatt tttcagtttg gtgattcact 240 ttccgatact ggaaactgtt tgagagagag ctattgtgga gctcaaacta aaaccggaaa 300 acttccttac ggaatgaatt tttaccagaa cgcaactgga cgttgttctg atggattcat 360 catccttgat tacataggtt gatattccaa aaactactat actcatatat aatattgatg 420 atttttcttt atttaatttg cgtctctctc gtattgtaat atatacagcg atggaatgtg 480 gtcttcctct cctaaatccg tccttggaag aaaatgcaga ttttagccat ggtgtgaatt 540 tcgccgtatc aggagctact gctttatcag cggaatacct catatcgagg gacatcgcta 600 tgtctttcac aaacagttca ttaagtgttc agatgcnatg gatgtcttct tatttcaaat 660 ctgtttgctc caatggtaat taaattactc tctacttatt cataacaatt ataagctaaa 720 ctattgacag ttgaatgtta cttgtttgct agattgcgca aaatatttgg aaaattcact 780 tttcttaatt ggagaaatcg gaggagatga cgttacttat ggatttaagc aaggcaaacc 840 catagaggag gtgcgaagaa tagtgcctga tattgtgaaa aacatcattc attctgttag 900 agtaagtgtt ttttattat ttcttcgtca ttaaaagaat agcttcaaat tcgattccta 960 ttgatgattg tcatttttct cttcttgcag acagtcattg gttttggggc tactcgaatt 1020 ttagttcctg gtaatttcc ttcaggttgt ttcccaatta tactaacgtt atacatgaat 1080 gattcctcaa ctgtctacga tgagtaccat tgcgcggaag aatggaacaa ttttacaatc 1140 tcttataaca atcttctgca acaatccatt catgagctga acgaagagta tccaaacatt 1200 tcaattattt acggcgatta ctacaatgcc tattactggc ttctgcgaaa tgctgtcgct 1260 cttggtgagt gtatatgact aattttcaag gaggttctca attttaaata ttaagcgtga 1320 tttactgacc gacgagttct tttttccagg attcaataaa aagacactac agatatcatg 1380 ttgtggaata ggaggagaat ataactacac cgaatccagg agatgtggta agccaggagc 1440 tgaaaaggct tgtgcagacc cgagtagtta cttaagttgg gatggaagtc atttgacaca 1500<000开云体育官网登录入口0221>aaaggcatat ggttggataa caaaatggct aattgatgac attttacccc aattgaactg 1560 开云体育官网登录入口 tcgtgtttga attcaagctt ttaatttctt ttgattgaat gttttttttt gtttaatagt 1620 aatttaaagg gattcatatc catgttcaat gttcagaagc tattacaaaa taaagttgtg 1680 ttttgttttt cttttgatct gcctaataat tatgctatc 1719 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <400> 5 atggcattgg gaatgagagt g 21 <210> 6 <211> 22 <212> DNA <开云体育官网登录入口213> Artificial Sequence <400> 6<开云体育官网登录入口 aacacgacag ttcaattggg gt 22

Claims

1. A method for identifying the polyphenol content of tomato fruit, characterized in that, Includes the following steps: Step 1: Extract genomic DNA from the tomatoes to be tested; Step 2: Using the specific primer pair described in (1) or (2) below, PCR amplification is performed with the genomic DNA of the tomato to be tested as a template. After obtaining the PCR amplification product, gel electrophoresis is performed. Step 3: Cut the target band in the gel electrophoresis results and perform gel sequencing to obtain the sequencing results; Step 4: Compare sequencing results with SNP molecular markers to determine the relative content of polyphenols in the tomato fruit to be tested; The polyphenol is β-D-glucopyranosylcaffeic acid; The SNP molecular marker is SNP-p or SNP linked to SNP-p. CGT ; The nucleotide sequence of the SNP-p molecular marker is shown in SEQ ID NO.1, wherein the base at the 501 bp position of the sequence is G or A, where G corresponds to tomatoes with high polyphenol content and A corresponds to tomatoes with low polyphenol content. The SNP CGT The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4, where the base at the 637th bp of the sequence is A or G, where A corresponds to tomatoes with low polyphenol content and G corresponds to tomatoes with high polyphenol content. (1) The specific primer pair used to detect the labeled SNP-p is: Forward primer F: 5' TCATCGGATTCACTTTCAGTTGTC 3'; Reverse primer R: 5' CTTGATACAAATGGAACAATGTTCAG 3'; (2) Used for detecting marked SNPs CGT The specific primer pairs are: Forward primer F: 5' ATGGCATTGGGAATGAGAGTG 3'; Reverse primer R: 5' AACACGACAGTTCAATTGGGGT 3'.

2. The method for identifying the polyphenol content of tomato fruit as described in claim 1, characterized in that, The PCR amplification reaction system in step two is: containing MonAmp TM 2 Taq Mix (+Dye) 25 uL, 1 uL each of 10 uM forward and reverse primers, 1 uL of 20 ng / uL DNA template, and ddH2O to bring the total to 50 uL. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s or 90 s, 35 cycles; 72℃ extension for 5 min.

Images