An inducer for sex reversal of largemouth bass XY genetic male fish to XY pseudo-female fish, as well as an induction method and application thereof

Abstract

The present invention relates to fish production and breeding and sex control, and relates to an inducer, induction method, and application for sex reversal of male XY genetic fish of largemouth bass to XY pseudo-female fish. The present invention provides the application of 17α-ethynyl estradiol in inducing sex reversal of male XY genetic fish of largemouth bass to XY pseudo-female fish. 17α-ethynyl estradiol can induce sex reversal of male XY genetic fish of largemouth bass to XY pseudo-female fish, with a high induction success rate, a high survival rate of XY pseudo-female fish, and a low deformity rate, thereby enabling all-male breeding of largemouth bass.

Description

Technical Field

[0001] The invention belongs to the technical field of fish production, breeding and sex control, and particularly relates to an inducer, an induction method and an application for sex reversal of XY genetic male largemouth bass to XY pseudo-female fish. Background Art

[0002] The largemouth bass (Micropterus salmoides), commonly known as the California bass, belongs to the order Perciformes, suborder Percoidei, family Centrarchidae, and genus Micropterus. It is native to California, USA. Due to its delicious meat, strong disease resistance, and rapid growth, it has rapidly become a key aquaculture species in my country, with production steadily increasing year by year.

[0003] In the main aquaculture areas of largemouth bass, pond farming is the norm. However, with the continuous development of the aquaculture industry, unfavorable factors hindering its continued expansion are gradually increasing. The first is the issue of seedlings. The production of high-quality seedlings often exceeds demand, and the situation is mainly concentrated in the Pearl River Delta. The seedling market is mixed, and the germplasm resources are seriously degraded. The genetic sex determination of largemouth bass is the male-heterogametic XX / XY type. One of the key technologies for producing all-male seedlings is estrogen-induced sex reversal of XY genetic males into XY pseudo-females. Before sexual maturity, male largemouth bass grow faster than females. When females reach sexual maturity, they conserve more energy for gonadal development, resulting in a significantly higher feed conversion rate and slower growth. When they reach marketable size, their abdomens swell due to mature gonads, making them unsuitable for sale. Compared to females, males are more slender and attractive, with a higher meat yield, making them more popular in the market. Therefore, it is urgent to achieve all-male aquaculture of largemouth bass through sex control technology. Summary of the Invention

[0004] The present invention aims to provide an inducer, method, and application for sex reversal of XY genetic male largemouth bass to XY pseudo-female fish. 17α-Ethinylestradiol can induce sex reversal of XY genetic male largemouth bass to XY pseudo-female fish, with a high induction success rate, a high survival rate, and a low deformity rate for XY pseudo-female fish, enabling all-male breeding of largemouth bass.

[0005] The present invention provides the use of 17α-ethynyl estradiol in inducing sex reversal of largemouth bass XY genetic male fish into XY pseudo-female fish.

[0006] The present invention also provides an inducer for sex reversal of XY genetic male largemouth bass to XY pseudo-female fish. The inducer comprises 17α-ethynyl estradiol and auxiliary materials.

[0007] Preferably, the auxiliary material includes vitamin C.

[0008] Preferably, the mass ratio of 17α-ethynyl estradiol to vitamin C is (8-16):300.

[0009] The present invention also provides a method for inducing sex reversal of an XY genetic male largemouth bass into an XY pseudo-female fish, comprising the following steps:

[0010] Largemouth black bass fry were fed 17α-ethynyl estradiol daily for 20 to 30 days when they started to feed. When the largemouth black bass grew to 120 to 240 days old, phenotypic and genetic sex identification was performed to obtain XY pseudo-female fish.

[0011] Preferably, the 17α-ethynyl estradiol is mixed with feed and then fed.

[0012] Preferably, during the feeding, the concentration of 17α-ethynyl estradiol in the feed is 80-160 mg / kg.

[0013] Preferably, the genetic sex identification is detected using the restriction endonuclease TaaI.

[0014] Preferably, after obtaining the XY type pseudo-female fish, intensive cultivation is also performed.

[0015] The present invention also provides a method for breeding all-male largemouth bass using XY-type pseudo-female fish induced by the induction method described in the above technical solution, comprising the following steps:

[0016] XY pseudo-female fish are mated with XY genetic male fish to perform phenotypic and genetic sex identification to obtain YY male fish, which are then mated with XX female fish to obtain all-male largemouth bass.

[0017] The present invention provides the use of 17α-ethynylestradiol in inducing sex reversal of largemouth bass XY genetic male fish into XY pseudo-female fish. The present invention finds that 17α-ethynylestradiol can induce sex reversal of largemouth bass XY genetic male fish into XY pseudo-female fish.

[0018] The induction agent of the present invention can effectively reverse the sex of XY genetic male largemouth bass into XY pseudo-female fish, with a high survival rate and low deformity rate, and an induction success rate of up to 100%. By mating with normal XY male fish, YY male fish can be obtained, laying the foundation for all-male largemouth bass. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 This is the electrophoresis result of the sex-reversed group of EE2 after feeding provided by the present invention (n=16);

[0021] Figure 2 This is a diagram showing the histological and morphological observation results of the gonads of the sex-reversed group after feeding EE2 provided by the present invention. DETAILED DESCRIPTION

[0022] The present invention provides the use of 17α-ethynyl estradiol in inducing sex reversal of XY genetic male largemouth bass to XY pseudo-female fish. The present invention does not particularly limit the source of 17α-ethynyl estradiol, and conventional commercially available 17α-ethynyl estradiol can be used. Although the sex determination mechanism of largemouth bass is less affected by the environment, sex reversal can occur under the induction of sex hormones. The present invention uses 17α-ethynyl estradiol as a sex control hormone to induce XY pseudo-female fish. The present invention preferably uses molecular marker technology to screen XY pseudo-female fish. The XY pseudo-female fish obtained by the present invention provide matching parents for subsequent all-male largemouth bass breeding.

[0023] The present invention also provides an inducer for sex reversal of XY genetic male fish of largemouth bass to XY pseudo-female fish, the inducer comprising 17α-ethynyl estradiol (EE2) and auxiliary materials. In the present invention, the auxiliary materials preferably comprise vitamin C. In the present invention, the auxiliary materials preferably also comprise Fu Yu Kang. In the present invention, the function of Fu Yu Kang is to protect the liver of the fish to improve the survival rate. In the present invention, the mass ratio of 17α-ethynyl estradiol to vitamin C is preferably (8-16):300, more preferably 8:300. In the present invention, the mass ratio of 17α-ethynyl estradiol to Fu Yu Kang is preferably (8-16):300, more preferably 8:300. In the present invention, the induction effect is best when the optimum concentration of EE2 is 80 mg / kg, and the survival rate of the fry is improved by combining 3 g / kg of vitamin C and 3 g / kg of Fu Yu Kang. In the present invention, the Fu Yu Kang is preferably purchased from Shanghai Chuangbo Ecology Co., Ltd.

[0024] The present invention also provides a method for inducing sex reversal of an XY genetic male largemouth bass into an XY pseudo-female fish, comprising the following steps:

[0025] Largemouth black bass fry were fed 17α-ethynyl estradiol daily for 20 to 30 days when they started to feed. When the largemouth black bass grew to 120 to 240 days old, phenotypic and genetic sex identification was performed to obtain XY pseudo-female fish.

[0026] In the present invention, the method for obtaining largemouth black bass fry preferably includes: parent selection, parent pairing and fry hatching.

[0027] The parent selection of the present invention preferably selects the F1 generation bred from the northern subspecies of the United States (from Suzhou Jinchengfu Biotechnology Co., Ltd.), with a body weight of preferably more than 600g, a good body shape, no disease or injury on the body surface, and a strong physique. The F1 generation bred from the northern subspecies of the United States has better genetic diversity, higher gene homozygosity, stronger disease resistance, and is more suitable for the establishment of XY-type pseudo-female largemouth bass compared to other domestic breeding species. In the present invention, the time for parent selection is preferably April to May. The temperature fluctuates greatly from April to May, and the parents need to be carefully raised and fed. In the present invention, the water temperature is preferably kept at 18 to 20°C during the parent selection period. April to May is the breeding season for male and female largemouth bass. The male fish selected is preferably those with a concave genital pore, and semen can be seen by gently squeezing. The female fish selected is preferably those with a swollen abdomen and a slightly convex genital pore, and a small amount of eggs can be seen by gently squeezing. In the present invention, the F1 generation is preferably temporarily raised in a cement pool of the circulation system, carefully fed, and the temporary raising density is preferably 5 tails / m 3 .

[0028] After the parents are selected, the present invention preferably performs parent matching. The present invention has no special restrictions on the device used for parent matching, and a conventional broodstock matching pool can be used. For example, a circular circulation pool with a radius of 1.5m and a height of 0.6m is used as a broodstock matching pool. In the present invention, the broodstock matching pool is preferably disinfected and cleaned before use, and aerated in advance after replacing new water. The circular circulation pool is preferably changed every two days, and 0.5g / m 3 Disinfect with concentrated iodine, slightly open the water valve, and allow running water to stimulate spawning. Parents are preferably initially maintained in a square cement pool using well water at 18-20°C. After selection, the parents are moved to a circular circulating pool using a mixture of well and lake water. In the present invention, during the parent mating stage, the water temperature is preferably adjusted to 23-25°C to stimulate spawning and improve mating success.

[0029] After the parents are paired, the present invention preferably collects the eggs and incubates them. The present invention preferably uses palm flakes to hang eggs. Largemouth bass are nesting and spawning fish, and the male fish protects the eggs. During the spawning period, an artificial fish nest is made, and the palm flakes are washed and placed in the spawning frame. Small stones are laid under the palm flakes to simulate natural fish nests. During the pairing period, it is preferred to inspect the spawning situation in a timely manner, move the palm flakes full of fertilized eggs into the hatching pond in a timely manner, and add new fish nests in a timely manner. The peak spawning period will be within 3 to 7 days after the parents are paired, and eggs will continue to be laid thereafter. The present invention preferably pays attention to the spawning situation of the palm flakes every morning, evening and midnight. When the palm flakes are found to be hanging eggs, the fertilized eggs are preferably moved into the fry hatching pond. The present invention preferably controls the water temperature of the hatching pond to be maintained at 23 to 25°C, the dissolved oxygen is above 5 mg / L, the ammonia nitrogen concentration in the water body is detected in a timely manner, and new water is replaced every other day. Largemouth black bass fry will gradually hatch after 48 to 60 hours of hatching. It is best to remove the palm leaves in time after hatching. The fry will sink to the bottom of the water and rely on their own yolk sac to absorb nutrients. 48 to 60 hours after hatching, the yolk sac of the fry will gradually disappear, and they will begin to float and swim, and can open their mouths to eat.

[0030] The present invention preferably involves cultivating Artemia worms before feeding largemouth black sea bass fry. The present invention preferably begins cultivating Artemia worms 24 hours before the fry begin to swim horizontally. Sea bass have variable spawning times, spawning batches, and egg production. Therefore, during fry incubation, Artemia worms must be hatched 24 hours in advance, before all fry begin to swim horizontally. The hatching ratio should be adjusted promptly based on the egg production to improve hatching efficiency. The present invention preferably uses Artemia worms as a starter bait. Using Artemia worms as a starter feed can significantly improve the survival rate of fry. Artemia worm hatching is preferably performed in a 450L water incubation bucket. In the present invention, the water temperature is preferably adjusted to 25-30°C during the incubation process, most preferably to 28°C. The present invention preferably performs constant temperature incubation. In the present invention, Artemia worms are preferably hatched in water with a salinity of 23-25‰ (i.e., 100L of water plus 6 catties of sea salt). In the present invention, sufficient air stones are preferably placed in the incubation water to keep the water churning and continuously aerated. During the incubation process, an incandescent lamp is preferably suspended above the incubation bucket. In the present invention, the illumination intensity of the incandescent lamp is preferably 2000 lx. Artemia larvae, which hatch 24 hours after incubation, must be promptly filtered out and then placed back into water with a salinity of 23-25‰ for temporary feeding. The present invention preferably utilizes Artemia larvae for feeding training of largemouth black bass fry.

[0031] The eggs are hatched to obtain largemouth black bass fry, which are fed 17α-ethynyl estradiol daily when they start to feed, for a total of 20 to 30 days. In the present invention, the 17α-ethynyl estradiol is preferably mixed with feed and then fed. In the present invention, the concentration of 17α-ethynyl estradiol in the feed is preferably 80 to 160 mg / kg, and more preferably three concentration gradients of 80 mg / kg, 120 mg / kg, and 160 mg / kg are set. Feeding the largemouth black bass fry with Artemia bait mixed with EE2 from the time they start to feed can greatly improve the success rate of sex reversal, achieve an inhibitory effect in the early stages of gonadal development, and complete sex reversal can be completed within 30 days of emerging from the membrane, greatly shortening the sex reversal time (as compared to inducing estradiol after successful training feeding, shortening the sex reversal time). The present invention feeds 17α-ethynyl estradiol along with the feeding of feed. During the feeding period, the present invention also preferably trains the largemouth black bass fry to eat. In the present invention, the feed preferably includes Artemia and / or compound feed. In the present invention, the compound feed preferably includes No. 0 compound feed, No. 1 feed, or pellet feed. In the present invention, No. 0 and No. 1 feeds are preferably the hardcover Open-mouthed Treasure produced by Wanghai Biotechnology Co., Ltd. Before feeding Artemia, the hatched Artemia are preferably filtered using a 250-mesh sieve to remove moisture. For every 500g of dry Artemia, EE2 is preferably weighed and mixed at a dosage of 80-160mg / kg. In the present invention, EE2 is preferably dissolved in anhydrous ethanol, and after complete dissolution, salt water is added to soak the Artemia. In the present invention, EE2 and Artemia are preferably thoroughly mixed using an air stone before use. The thoroughly mixed Artemia are poured into a basin and frozen at -20°C to form frozen worms (hereinafter referred to as ice worms) for training feeding. In the present invention, the concentration of the salt water is preferably 23‰ to 25‰. When feeding Artemia after the fry have hatched, live Artemia are preferably fed after hatching and filtration. In the present invention, after the fry open their mouths, the artemia is preferably fed six times a day, starting at 6:30 a.m. and 1:30 p.m., with feeding every two hours. Each feeding time is preferably about half an hour, and the fry are fed until their abdomens are swollen. In the present invention, purple LED lights are preferably hung above the breeding pond during feeding to lure the fry to gather for easy feeding. Largemouth black bass fry like to swim and feed in groups. Lights are used to lure the fry to gather, and the fry's feeding situation can be better observed under the lights. When feeding, the artemia is preferably fed completely within one day. After molting, the artemia becomes an orange-red larva. After the fry have fed, an orange-red color can be observed on their abdomens. If the abdomen is black, they have not fed and need to be fed continuously. When feeding, the artemia should be fed to the fry enrichment area according to the fish gathering situation. When the fry grow to more than 1 cm, the fry's food intake will increase. If the artemia is not fed enough, it is easy to cause closure of the mouth, so supplementary feeding should be done in time. During the feeding period of the present invention, 250 to 500 g of Artemia spp. are preferably fed to 10,000 fish fry. After the feeding period of the present invention reaches about 10 days, it is preferred to start feeding training and changing the feed.The present invention preferably maintains darkness during the entire feeding training period, turns on LED lights during feeding, and lures fish to gather, ensuring successful feeding and improving the success rate of feeding training. At the beginning of feeding training, it is preferably to set up a bait table in the breeding pond, and place filtered and frozen Artemia (ice worms) on the bait table for the first and last meals to lure the fry to get used to the water surface for feeding. After 10 to 12 days, it is preferably to gradually use ice worms for feeding. During this period, it is preferably to maintain a certain amount of water-containing Artemia (the Artemia hatched above, after using a 250-mesh net to filter out the water, is put back into the salt water with EE2, and the water-containing Artemia is scooped for feeding when feeding) to avoid the formation of closed mouth and refusing to eat. During the period of switching to compound feed, the present invention dissolves EE2 powder in 95% ethanol solution, configures it into a 5mg / ml mother liquor for standby use, and stores it at 4°C. Weigh 10 days of No. 0 compound feed according to the feeding ratio. Draw the corresponding mother liquor at a dose of 80-160 mg / kg. Dilute with 100 ml of 95% alcohol and evenly spray the feed using a spray bottle. Dry the sprayed feed in a dark place and store at -20°C until needed. After drying in the shade, grind it into a powder. It is best to gradually introduce the powder feed between days 12 and 14. During this time, place a certain amount of ice worms on the feeding table and gradually switch to the powder feed entirely. 14-16 days, preferably gradually feed No. 0 compound feed, remove the bait table, start feeding from the smallest No. 0 feed, preferably feed a certain powder feed during this period, and gradually switch to No. 0 compound feed; After 16 days, gradually start feeding No. 1 feed to adapt to the mouth cracking of largemouth bass, preferably feed pellets mixed with EE2 hormone at 6:30 and 13:30 every day, feed normal feed (pellet without EE2 hormone) at 5:30, feed 3 meals a day, each feeding time is about half an hour, feed until the fry's abdomen swells, and start switching to normal feed after feeding to 30 days. In the present invention, it is necessary to keep the dark state during the training period, the seabass has a cluster swimming phenomenon, the more the training amount, the higher the training success rate, the seabass fry is not fed and is very likely to close its mouth during the opening period, the training initial stage needs to ensure the amount of Artemia feeding, and it is necessary to suck out the Artemia that has not been eaten and sunk to the bottom in time. In the later stage of feeding training, since the success rate of feeding conversion is not high, when feeding compound feed (including powder), it is necessary to pay attention to the eating situation in time. If the fish do not float on the water surface to eat, they need to be fed with ice worms in time to re-train the fish to eat. During the entire feeding training period, it is preferred to clean up the remaining bait and feces, and change 1 / 2 of the water every morning and evening to maintain the water environment and reduce the probability of disease. When feeding feed mixed with EE2 hormone, the deformity rate of fry will increase. The present invention preferably mixes it with vitamin C each time it feeds the feed to reduce the deformity rate of fry. In the present invention, the feeding concentration of vitamin C is preferably 3g / kg. When feeding EE2 and vitamin C, the present invention preferably uses Fu Yu Kang at the same time. In the present invention, the feeding concentration of Fu Yu Kang is preferably 3g / kg to protect the liver problems of the fry. The present invention preferably adds a small amount of clean water to dissolve and then stirs the feed evenly.

[0032] Phenotypic sex identification of XY pseudo-female fish can be performed when the male and female gonadal tissues can be observed by dissection. The present invention preferably performs phenotypic sex identification and genetic sex identification on largemouth bass when they grow to 120-240 days to obtain XY pseudo-female fish. In the present invention, the phenotypic sex identification preferably collects gonadal tissue of largemouth bass 120 days after feeding EE2, and performs dissection to observe the morphological structure of the gonad to confirm its phenotypic sex. The present invention preferably performs histological observation on the gonadal tissue of largemouth bass whose phenotypic sex has been confirmed by dissection to further confirm the accuracy of the phenotypic sex. Specifically, the present invention preferably collects sex-reversed largemouth bass gonadal tissue, washes it with physiological saline, puts it in a centrifuge tube, and immerses it in 4% paraformaldehyde for fixation for 24 hours, makes paraffin sections of the gonadal tissue for histological observation, and records the gonadal traits. After 24 hours, it is preferably replaced with 70% alcohol fixation.

[0033] In the present invention, the genetic sex identification is preferably detected using the restriction endonuclease TaaI (using the restriction endonuclease technology PCR-RFLP). In the present invention, the genetic sex identification is preferably referred to the invention patent with application number 202211015986.0 to achieve accurate identification of the XX / XY type genetic sex of largemouth black bass. During parent identification, the present invention preferably cuts a small amount of tail fin sample without any harm to the fish body. The present invention adopts SNP marker technology, and the restriction endonuclease TaaI only needs to be enzymatically cut at 65°C for 15 minutes to separate the male and female difference fragments (female largemouth black bass is a specific band, and male fish is three specific bands), and the electrophoresis band separation is clearly visible, the operation is simple and the accuracy is high, which shortens the time for selecting XY pseudo-female fish. The present invention further confirms whether the sex reversal of XY pseudo-female fish is successful through phenotypic sex identification of gonadal tissue in combination with SNP marker technology, and the results are more accurate.

[0034] In the present invention, after obtaining the XY type pseudo-female fish, it is preferred that intensive cultivation is also performed. The intensive cultivation described in the present invention is preferably parent cultivation. The parent cultivation described in the present invention can provide a basis for the subsequent selection and breeding of all-male largemouth black bass. That is, in order to mate the obtained XY type pseudo-female fish with the XY type male fish to obtain the YY type male fish, and then mate with the XX type female fish to obtain all-male largemouth black bass. The present invention preferably transfers the largemouth black bass fry to a large area of ​​water for parent cultivation after they have started to feed for 60 days. Before the cultivation of the present invention, it is preferred that the pond be cleaned and disinfected, and the new water body is preferably added with EM bacteria for hydroponics. In the present invention, EM bacteria is preferably used once every 7 days on the basis of routine management, and the usage amount is preferably 80 mg / m 3. The use of EM bacteria can enrich the plankton in the water body. In the present invention, 2500 to 3000 fry are preferably cultivated per acre of water area. In the parent cultivation stage, the protein content of the feed is preferably not less than 45%, and the animal protein source is preferably higher than 65%. In the present invention, 60 to 100 mg / kg of vitamin E is preferably added to the feed during the parent cultivation process to improve the growth performance and immune ability of the parents. As the parent fry are put into the pond, the growth rate increases rapidly. According to the size of their mouth slits, attention should be paid to the feed model. In the seedling stage, it is preferred to feed No. 1 to 3 (No. 2 and No. 3 are compound feeds of Jie Da Feed Co., Ltd.), and in the adult fish stage, it is preferred to feed No. 4 to 6 (Hui Fu California sea bass puffed compound feed). In the fish seed cultivation stage (the entire breeding stage), the present invention preferably feeds 3 to 4 times a day, with a daily feeding rate of 8% to 10%. In the adult fish stage, the present invention preferably feeds 2 to 3 times a day, with a daily feeding rate of 3% to 5%. The present invention preferably feeds scientifically and rationally according to the principles of "timing, quantity, point, and positioning".

[0035] The present invention also provides a method for breeding all-male largemouth bass using XY-type pseudo-female fish induced by the induction method described in the above technical solution, comprising the following steps:

[0036] XY pseudo-female fish are mated with XY genetic male fish to perform phenotypic and genetic sex identification to obtain YY male fish, which are then mated with XX female fish to obtain all-male largemouth bass.

[0037] Prior to the breeding described herein, parental breeding is preferably performed. The specific parent breeding method is preferably the same as described above. When XY pseudo-female fish are mated with XY genetic male fish, 25% of the offspring are YY male fish. The present invention achieves this by using the phenotypic and genetic sex identification described above.

[0038] To further illustrate the present invention, the following is a detailed description of an inducer, induction method, and application for sex reversal of an XY genetic male largemouth bass to an XY pseudo-female fish provided by the present invention, in conjunction with the accompanying drawings and examples. However, these should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] (1) Parent selection: Select the F1 generation of the northern subspecies of the United States (from the F1 population of the northern subspecies of the United States of Suzhou Jinchengfu Biotechnology Co., Ltd.), with a body weight of more than 600g as parents. The parents are selected to be largemouth bass with good body shape, no disease or injury on the body surface, and strong physique. The breeding season for male and female largemouth bass is from April to May. The male fish are selected to have a concave genital pore, and semen can be seen when gently squeezed. The female fish are selected to have a swollen abdomen and a slightly convex genital pore, and a small amount of semen or a small amount of eggs can be seen when gently squeezed. All the selected F1 generation of the northern subspecies of the United States are temporarily raised in an indoor circulation system cement pool, carefully fed, and the temporary stocking density is 5 fish / m 3 ;

[0041] (2) Parent grouping: A circular circulation pond with a radius of 1.5m and a height of 0.6m was selected as the parent fish grouping pond. The pond was disinfected and cleaned before use, and aerated in advance after replacing the water. The parents were first temporarily raised in a square cement pond using well water at 18-20℃. After the parents were selected, they were moved into the circular circulation pond (specifically, 30 largemouth black bass of both sexes with intact body shape and well-developed gonads were selected from the temporary cement pond, and 5 largemouth black bass of both sexes were transferred to the circular circulation pond for grouping preparation). The water temperature was adjusted to 23-25℃ by mixing well water and lake water. The temperature was raised to stimulate spawning and improve the success rate of grouping. The water in the circular circulation pond for parent grouping was changed every two days, and 0.5g / m 3 Disinfect with concentrated iodine, slightly open the water valve, and allow running water to stimulate spawning. Each mating tank should have three artificial fish nests spaced evenly apart. All mating tanks should be kept in a quiet, no-traffic environment to improve spawning rates. After the parents are transferred to the mating tank, they should be fed a special formula feed as needed, at a rate of 2% to 4% of their body weight. A supplementary feeding of fresh frozen fish can enhance spawning outcomes. Replace half of the water every two days.

[0042] (3) Fry hatching: During the breeding season of largemouth bass from April to May, the temperature in Jiangsu Province fluctuates greatly. Temperature control is required for the hatching pond. Electric heating rods should be installed to control the water temperature at 23-25°C to achieve a better hatching rate. The peak spawning period is 3-7 days after the broodstock are paired. Eggs will continue to spawn thereafter. Pay attention to the palm flakes for spawning every morning, evening and midnight. When eggs are found hanging on the palm flakes, the fertilized eggs need to be moved to the fry hatching pond. The water temperature in the hatching pond should be kept at 23-25°C, the dissolved oxygen should be above 5mg / L, the ammonia nitrogen concentration in the water should be tested in time, and the water should be replaced every other day. Largemouth black bass fry will gradually emerge from their shells 48 to 60 hours after hatching. The palm flakes should be removed promptly after hatching. The fry will sink to the bottom of the water and rely on their own yolk sacs to absorb nutrients. 48 to 60 hours after hatching, the yolk sacs of the fry will gradually disappear, and they will begin to float and swim, and can open their mouths to eat. Largemouth black bass are nesting and spawning fish. The male fish will guard the eggs. During the spawning period, artificial nests are made. The palm flakes are washed and placed in the spawning frame. Small stones are laid under the palm flakes to simulate natural nests. During the mating period, the spawning situation needs to be inspected in a timely manner, and the palm flakes filled with fertilized eggs should be moved into the hatching pond in a timely manner, and new nests should be added in a timely manner.

[0043] (4) Artemia cultivation: Artemia cultivation is started 24 hours before the fry start to swim horizontally. After the largemouth bass start to open, they can be fed with rotifers, copepods such as Artemia, and zooplankton such as Cladocera. The present invention uses Artemia as the opening bait. Artemia hatching is selected in a 450L water incubation bucket. The water temperature is adjusted to 25-30°C, and the optimal water temperature is 28°C. The constant temperature incubation is maintained. Artemia needs to be hatched in a water body with a salinity of 23-25‰ (i.e., 100L water plus 6 catties of sea salt). At the same time, sufficient air stones should be placed to keep the water body rolling and continuously aerated. An incandescent lamp should be hung above the incubation bucket. The lighting effect is best at 2000lx. Artemia hatches 24 hours after incubation and needs to be filtered out in time. The filtered Artemia are put back into a water body with a salinity of 23-25‰ for temporary feeding. Using Artemia as the opening bait can significantly improve the survival rate of seedlings. The spawning time, spawning batches and spawning quantity of sea bass are not fixed. Therefore, during the hatching period of fry, Artemia should be hatched 24 hours in advance before all fry swim horizontally. The hatching ratio should be adjusted in time according to the amount of spawning to improve the hatching efficiency.

[0044] (5) Training diet and estrogen feeding: The present invention uses 17α-ethynylestradiol (EE2) to induce XY male fish to transform into XY pseudo-female fish. Feeding begins when the largemouth black bass fry start to eat, and the entire feeding period is 30 days. 20 to 30 days is the critical period for sex differentiation of largemouth black bass. When feeding Artemia, the hatched Artemia are filtered with a 250-mesh net to dry the water. For every 500g dry weight of Artemia, EE2 is weighed at a dose of 80 to 160mg / kg and dissolved in anhydrous ethanol. After fully dissolved, salt water is added to soak the Artemia. An air stone is used to thoroughly mix the EE2 and Artemia before use. The thoroughly mixed Artemia is poured into a basin and frozen at -20℃ to form frozen worms for training diet feeding. 15 groups of largemouth black bass hatched 100,000 fry for sex reversal, and 5kg of Artemia was fed daily. After the fry hatch, they are fed Artemia spp. six times daily, starting at 6:30 AM and 1:30 PM, with feedings every two hours for approximately half an hour. The fry are fed until their abdomens are swollen. A purple LED light is hung above the tank during feeding to attract the fry to gather and facilitate feeding. All Artemia spp. should be delivered within a day. After feeding for around 10 days (when the fry are approximately 2-3 cm), a feeding transition begins. Darkness is maintained throughout the training period, and LED lights are turned on during feeding to attract the fish to gather, ensuring successful transition and increasing the success rate of feeding. At the beginning of feeding, a feeding table is set up in the tank. (The filtered Artemia spp. are frozen at -20°C one day in advance. They are broken open and placed on the table in the dark to attract the fish to the surface for feeding.) Filtered Artemia spp. are placed on the table during the first and last feedings to entice the fry to come to the water surface for feeding. Between 10 and 12 days, gradually switch to iceworms as the only feed, maintaining a moderate amount of water-borne Artemia to prevent refraining from feeding. During the transition to formula feed, dissolve EE2 powder in 95% ethanol to create a 5 mg / ml stock solution, which should be stored at 4°C. Weigh 10 days of formula feed No. 0 according to the feeding ratio, pipette the corresponding stock solution at a dose of 80-160 mg / kg, dilute with 100 ml of 95% ethanol, and evenly spray the feed using a spray bottle. Store the sprayed feed in the shade, away from light, and store at -20°C until needed.From 12 to 14 days, gradually feed powder feed, place a certain amount of ice worms on the bait table during this period, and gradually switch to powder feed. The concentration of EE2 is the same as when feeding Artemia, and the feeding frequency is also the same, 6 meals a day; from 14 to 16 days, gradually feed No. 0 compound feed, remove the bait table, and start feeding from the smallest No. 0 feed. During this period, also feed a certain amount of powder feed, and gradually switch to compound feed. The concentration of EE2 is the same as when feeding Artemia, and the feeding frequency is also the same, 6 meals a day; after 16 days, gradually start feeding No. 1 feed to adapt to largemouth black bass. For mouth cracking, feed pellets mixed with EE2 hormone at 6:30 and 13:30 every day, and feed normal feed at 5:30, three times a day, each feeding time is about half an hour, feed until the fry's abdomen is swollen, and start feeding normal feed after 30 days; keep away from light during the training period, sea bass tend to swim in groups, the more training the fry, the higher the training success rate, and the sea bass fry are prone to closed mouth if they are not fed to full during the opening period. In the early stage of training, the amount of Artemia worms fed must be guaranteed, and the Artemia worms that are not eaten and sink to the bottom must be sucked out in time. In the later stage of training, because the success rate of switching to feed is not high, it is necessary to pay attention to the eating situation when feeding powder and compound feed. If the fry does not float to the water surface to eat, it is necessary to feed ice worms in time to re-train them. During the entire training period, clean up the leftover bait and feces, change 1 / 2 of the water every morning and evening (before the first meal and after the last meal of the day) to maintain the water environment and reduce the probability of disease; feeding feed mixed with EE2 hormone will increase the deformity rate of fry. Each time you feed, mix it with 3g / kg of vitamin C and 3g / kg of Fuyukang (a mixed feed additive produced by Shanghai Chuangbo Ecology Co., Ltd., Fuyukang) to protect the liver problems of fry. Add a small amount of clean water to dissolve and stir the feed evenly to reduce the deformity rate of fry; it should be noted that the feed needs to be evenly sprinkled when feeding. Larger individuals will feed first, and smaller individuals can only feed on the periphery or lag behind, which can easily cause individual differences. When the individual size differences are large, there will be serious cannibalism. The largest individuals need to be screened in time. During the training period, the overall training success rate is about 50%;.

[0045] (6) Phenotypic sex identification: The gonadal tissues of largemouth bass 120 days after feeding EE2 were collected, and the phenotypic sex was confirmed by observing the morphological structure of the gonads through dissection. The accuracy of the phenotypic sex was further confirmed by histological observation of the gonadal tissues of largemouth bass whose phenotypic sex was confirmed by dissection. The sex-reversed gonadal tissues of largemouth bass were collected, washed with physiological saline, placed in a 5ml round-bottom centrifuge tube, and immersed in 4% paraformaldehyde for 24 hours. The gonadal tissues were made into paraffin sections for histological observation; the collected gonadal tissues needed to be fixed with cell fixative, and the gonadal characteristics were recorded. After 24 hours, the solution was replaced with 70% alcohol for fixation;

[0046] (7) Genetic sex identification: The existing invention patent with application number 202211015986.0 has disclosed a molecular marker, amplification primer and application method related to the sex of largemouth bass, and provided a SNP molecular marker related to the sex of largemouth bass. The present invention uses restriction endonuclease technology (PCR-RFLP) to perform genetic sex identification on sex-reversed largemouth bass, accurately identifying XY type largemouth bass. During parent identification, only a small amount of tail fin sample is cut, which does not harm the fish body.

[0047] (8) Parent cultivation: After the largemouth black bass fry have started feeding for 60 days, they are transferred to a large area of ​​water for parent cultivation. Before cultivation, the pond needs to be cleaned and disinfected, and EM bacteria are added to the new water for hydroponics. EM bacteria are used once every 7 days on the basis of routine management, and the usage amount is 80 mg / m 3 , enriching the plankton in the water body, and cultivating 2,500 to 3,000 fry per mu. The protein content of the feed in the parent breeding stage should not be less than 45%, and the animal protein source should be higher than 65%. During the breeding process, 60 to 100 mg / kg of vitamin E should be added to the feed to improve the growth performance and immune ability of the parents. As the parent fry are put into the pond, the growth rate increases rapidly. According to the size of their mouth, attention should be paid to the feed type. Feed No. 1 to 3 in the fry stage, and No. 4 to 6 in the adult stage. In the fingerling breeding stage, feed 3 to 4 times a day, with a daily feeding rate of 8% to 10%; in the adult stage, feed 2 to 3 times a day, with a daily feeding rate of 3% to 5%. Feed scientifically and rationally according to the principles of "timing, quantity, location, and position".

[0048] Example 2

[0049] Deformity Control: The effectiveness of vitamin C fortification in controlling deformity rates at different feed concentrations (specifically, 80 mg / kg, 120 mg / kg, and 160 mg / kg) was investigated. Control groups were set up at each of the three different concentration gradients. The deformity control results are shown in Table 1. Initially, feed mixed with EE2 was supplemented with vitamin C to reduce deformity rates. During the Artemia feeding phase, vitamin C was dissolved in water and mixed with Artemia to a concentration of 3g / 500g (Artemia). The mixture was thoroughly mixed with the Artemia using an air stone and then fed to the fry. During the feeding period, vitamin C was dissolved in water at a concentration of 3g / kg and mixed with EE2 solution. This was evenly sprayed onto the feed using a spray bottle and allowed to dry naturally in the shade before feeding. The entire vitamin C fortification period lasted for 60 days, effectively controlling fry deformity rates. The induction dose of EE2 is crucial for successful sex reversal. Feeding concentrations of 80 to 160 mg / kg, along three different concentration gradients (80 mg / kg, 120 mg / kg, and 160 mg / kg), all resulted in the production of XY pseudo-female largemouth bass. Vitamin fortification reduced the deformity rate, but at a high concentration of 160 mg / kg, the deformity rate increased by approximately 5%. The optimal induction effect was achieved at 80 mg / kg, reducing the deformity rate to 1%, eliminating facultative individuals, and achieving a 100% induction success rate. The deformity rate was also reduced to 1% at a concentration of 120 mg / kg. Fry not fed vitamin C fortification at the same time experienced a deformity rate of approximately 30%, with progressive mortality and a survival rate of less than 10%, making it impossible to rear all-male fry. These results indicate that simultaneous induction with EE2 and vitamin C fortification can ensure both the success rate and the effective reduction of deformity rates.

[0050] Table 1 Control of deformity rate under different feeding concentrations of vitamin C fortification

[0051]

[0052] Note: When the EE2 concentration is 80 mg / kg, the survival rate and success rate are the highest, and the induction effect is the best; when it is 120 mg / kg, the survival rate and success rate decrease to 45% and 95% respectively; when it is 160 mg / kg, the induction effect is the worst; feeding vitamin C fortification can reduce the overall deformity rate of fry by 30%.

[0053] Example 3

[0054] Comparison of sex reversal types using sex hormones: The sex determination of fish can be changed by environmental factors. Among them, sex hormones EE2, 17β-estradiol (E2) and bisphenol A (BPA) can induce feminization of fish. A comparative experiment was conducted on the success rates of sex reversal induced by these three sex hormones in largemouth bass.

[0055] Three experimental groups and three control groups were set up without vitamin fortification. EE2, 17β-estradiol (E2), and bisphenol A (BPA) were all fed at the same concentration of 80 mg / kg. EE2 and E2 were dissolved in ethanol, and BPA was dissolved in dimethyl sulfoxide (DMSO). F1 generation fertilized eggs of the northern subspecies of the United States, hatched simultaneously from the same mating pond, were used in each experimental group. Each experimental group consisted of 5,000 successfully hatched largemouth bass. From the time the fish were able to open their yolk sacs and begin feeding, they were fed Artemia mixed with the three estrogens. The Artemia stage was initiated with Artemia, and the diet was mixed with the three estrogens during the transition period. This feeding period lasted for 30 days. After 60 days of culture, the fish were transferred to outdoor aquariums and continued feeding. Gonadal tissue was collected from the three experimental groups at 120 days of feeding to compare the success rate of sex reversal. Table 2 shows the results of sex reversal using three different sex hormones. The results show that EE2 and E2 can be used as sex hormones for sex reversal of largemouth bass, with EE2 having a better sex reversal effect and being more suitable for producing XY pseudo-female largemouth bass. BPA, on the other hand, is not suitable for producing pseudo-female largemouth bass.

[0056] Table 2 Comparison of sex reversal results with three different sex hormones

[0057]

[0058]

[0059] Note: Different lowercase letters indicate significant differences (P<0.05)

[0060] The above experiment found that the survival rate of EE2 and E2 was the same at 50%, while BPA had the lowest survival rate at 10%. EE2 had the highest sex reversal effect, reaching 100%, followed by E2 at 90%, and BPA at only 20%. In the vitamin-fortified group, the deformity rate was lowest at 1% in the EE2 group, 10% in the E2 group, and highest at 30% in the BPA group. Without vitamin fortification, the deformity rate increased by 20-30%. These results suggest that compared to other estrogens, EE2 has a higher success rate for sex reversal, and combined with vitamin C fortification, the deformity rate is even lower.

[0061] Example 4

[0062] Comparison of sex reversal time of sex hormones: Both EE2 and E2 can be used as sex hormones for sex reversal of largemouth bass. In order to explore the effects of two different feeding times on sex reversal of largemouth bass, two different experimental groups were set up, namely, EE2 and E2 were continuously fed for 30 days after opening the mouth to feed, and EE2 and E2 were continuously fed for 60 days after successful training. The success rate of sex reversal inducing largemouth bass at different feeding times was compared.

[0063] The feeding method throughout the experiment was the same as in Example 1. Table 3 shows a comparison of sex reversal results between EE2 and E2 at different induction times. EE2 mixed with the start of feeding and continued for 30 days achieved an inhibitory effect at the early stages of gonadal development, with complete sex reversal achieved by 30 days after eclosion, with a 100% success rate. Continuing to feed for 60 days after successful transition also achieved a 100% induction effect, with no facultative individuals at the optimal feeding concentration. E2 mixed with the start of feeding and continued for 30 days did not achieve an inhibitory effect at the early stages of gonadal development, with some facultative individuals remaining and a sex reversal success rate of only 55%. After a successful transition, continued feeding for 60 days significantly increased the sex reversal success rate to 92%. The results of inducing sex reversal in largemouth bass at different feeding times showed that feeding EE2 from the moment they began feeding resulted in complete sex reversal by 30 days, achieving a significantly higher cost-effectiveness than continuing to feed E2 for 60 days after successful transition.

[0064] Table 3 Comparison of sexual reversal results between EE2 and E2 at different induction times

[0065]

[0066] Note: Different lowercase letters indicate significant differences (P<0.05)

[0067] The above experiment found that the sex reversal success rate of the EE2 group was 100% after 30 days of opening the mouth and 60 days of switching to a different diet; the sex reversal success rate of the E2 group was 75% after 30 days of opening the mouth. There were facultative individuals, and the sex reversal success rate reached 92% after 60 days of switching to a different diet.

[0068] Example 5

[0069] Phenotypic sex identification: On day 120, several largemouth bass that had been continuously fed with EE2 for 30 days were collected and the morphological and histological observations of the gonads of the largemouth bass fed with EE2 were performed to determine their phenotypic sex ( Figure 1 Dissection revealed that at EE2 concentrations of 80 to 160 mg / kg, all largemouth bass gonads developed into ovaries, with a small number of ova observed. This indicates successful sex reversal of XY males to XY pseudofemales. Histological observation of the gonads revealed that at this stage, the gonads developed into phase II oocytes, with numerous oocytes observed, prominent nuclei and nucleoli, and a small number of oil globules. Histological observation of the gonads demonstrated typical ovarian development, confirming successful sex reversal. Following phenotypic sex determination, genetic sex was further confirmed using SNP markers.

[0070] Genetic sexing: Collect the caudal fins of phenotypic largemouth bass for genomic DNA extraction. PCR amplification system (20 μL): 8 μL H₂O, 1 μL primers, 10 μL Premix Ex Taq, and 1 μL DNA sample. Digestion with the restriction endonuclease TaaI (10 μL): 3 μL PCR product, 5.8 μL H₂O, 1 μL 10× buffer, and 0.2 μL enzyme. TaaI digestion was performed at 65°C for 15 minutes. After digestion, the DNA was analyzed by 1% agarose gel electrophoresis.

[0071] Primer sequences used for PCR amplification:

[0072] F:TTTGTTCATCACTTCATATTAACGCTGA (SEQ ID NO. 1);

[0073] R: AGAGAAACTTCCGAGATAACGCAGAA (SEQ ID NO. 2).

[0074] Restriction enzyme digestion results ( Figure 2 ), 7 out of 16 largemouth bass had three specific bands and were genetically XY males, while the remaining 9 were genetic females. The genetic sex of the largemouth bass did not change, but the phenotypic sex had been reversed, successfully reversing to XY pseudo-females, proving that EE2 sex reversal was successful.

[0075] Parent cultivation and screening: After the sex-reversed group is completed, it is moved to an outdoor pond for parent cultivation. During the cultivation period, vitamin E is added to the largemouth bass feed to promote growth, improve feed protein efficiency, reduce serum malondialdehyde levels, and maintain stable antioxidant enzyme activity. The vitamin E dosage is 80mg / kg. Vitamin E is continuously fed during the cultivation period for parental strengthening. The fish are cultivated for one winter and used as parents for breeding when they reach sexual maturity. During the breeding season, parents are strictly selected, and those with a size of over 600g, good body shape, no injuries on the body surface, enlarged abdomen, and slightly convex genital pore are selected. A small amount of tail fin is cut from each parent for genetic sex identification. When the genetic sex shows XY male, the parent successfully produces XY pseudo-female fish.

[0076] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A method for breeding all-male largemouth bass from XY pseudo-female fish induced by a method for inducing sex reversal of XY genetic male largemouth bass to XY pseudo-female fish, comprising the following steps: XY pseudo-females were mated with XY genetic males for phenotypic and genetic sex identification to obtain YY males, which were then mated with XX females to obtain all-male largemouth bass. The induction method for sex reversal of largemouth bass XY genetic male fish to XY pseudo-female fish comprises the following steps: Largemouth black bass fry are fed 17α-ethynyl estradiol daily for 30 days when they start to feed. When the largemouth black bass are 120 to 240 days old, phenotypic sex identification and genetic sex identification are performed on the largemouth black bass to obtain XY pseudo-female fish. The 17α-ethynyl estradiol is mixed with feed and then fed. During the feeding, the concentration of 17α-ethynyl estradiol in the feed is 80 mg / kg. Each time the feed is fed, vitamin C is mixed in, and the feeding concentration of the vitamin C is 3 g / kg. After obtaining the XY-type pseudo-female fish, intensive cultivation is also carried out; the intensive cultivation includes: after the largemouth black bass fry start to feed for 60 days, they are transferred to a large area of ​​water for parent cultivation; during the parent cultivation process, 60-100 mg / kg of vitamin E is added to the feed.

2. The method for breeding all-male largemouth bass according to claim 1, wherein: The genetic sex determination uses restriction endonucleases TaaI Conduct testing.

Images