Treatment drugs, diagnostic kits and analytical systems for inflammatory bowel disease
By using drugs with proline as the main component and kits for detecting proline deficiency-related proteins, the problems of insufficient targeting and drug resistance in existing inflammatory bowel disease treatments have been solved, achieving effective relief of intestinal inflammation and personalized treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-18
- Publication Date
- 2026-04-03
AI Technical Summary
Existing treatments for inflammatory bowel disease lack specificity, common drugs have significant side effects and are prone to drug resistance, and are ineffective for some patients. New treatment methods are urgently needed to restore intestinal immune balance.
This treatment utilizes proline as the main component, combined with 5-aminosalicylic acid, glucocorticoids, and immunomodulatory drugs, to enhance the effector function of intestinal ILC3 cells, promote IL-22 production, and alleviate inflammation. Simultaneously, by detecting the expression levels of proline deficiency-related proteins SLC6A20, CEBPβ, and JMJD3, kits and analytical systems are provided for diagnostic and treatment guidance.
It significantly alleviates intestinal inflammation, enhances the function of ILC3 cells, provides personalized treatment plans, improves treatment efficacy, and reduces side effects.
Smart Images

Figure CN117017980B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical and analytical detection technology for treating inflammatory bowel diseases, specifically a therapeutic drug, detection kit, and analytical system for inflammatory bowel disease. Background Technology
[0002] Inflammatory bowel diseases include common enteritis and inflammatory bowel disease (IBD). Common enteritis is usually acute and often curable with anti-infective treatment. IBD refers to a group of nonspecific chronic inflammatory diseases of the gastrointestinal tract with unknown causes, mainly divided into ulcerative colitis and Crohn's disease. Clinical symptoms include diarrhea, abdominal pain, and rectal bleeding. Its exact cause is still unknown, and it is currently incurable, earning it the nickname "green cancer."
[0003] Currently, the treatment of inflammatory bowel disease (IBD) primarily relies on anti-inflammatory drugs, such as 5-aminosalicylic acid and glucocorticoids. These drugs are either not highly targeted, have significant side effects, and are prone to drug resistance. In recent years, antibody therapies, such as those blocking inflammatory factors TNFα and IL-12 / IL-23p40, have achieved significant efficacy. However, with clinical advancements, it has been found that nearly 50% of patients are insensitive and do not respond. Therefore, there is an urgent need to identify novel pathogenic mechanisms and reveal biomarkers for sensitive populations in IBD patients who do not respond to clinical treatment.
[0004] Although the etiology of inflammatory bowel disease (IBD) is not fully understood, mounting evidence suggests its occurrence is linked to intestinal immune homeostasis, caused by both genetic and environmental factors. In this regard, persistent intestinal infection, mucosal barrier defects, mucosal immune dysregulation, and both genetic and environmental factors appear to contribute to the disease process. Therefore, various treatments have been developed targeting IBD susceptibility genes, microbial dysbiosis, and metabolic disruption to restore the disordered immune response. Dietary habits are considered a crucial environmental factor, with the intake of certain nutrients potentially inducing, preventing, or treating the disease. Enteral nutrition therapy (ENT) is the most studied dietary treatment for IBD, especially in younger patients. In particular, elemental diets (containing free amino acids rather than complete proteins or peptides to reduce the intestinal antigen load in the intestinal lumen) are considered an effective primary treatment for active Crohn's disease; however, the nutrient ratios and suitable populations for ENT therapy remain unclear. Therefore, this application provides a diagnostic method for the etiology and risk of proline-dependent inflammatory bowel disease and a therapeutic application using proline as an active ingredient. Summary of the Invention
[0005] The first objective of this invention is to provide a therapeutic agent for inflammatory bowel disease. The second objective of this invention is to provide diagnostic reagents and kits for proline deficiency-related inflammatory bowel disease and its risk. The third objective of this invention is to provide an analytical system for detecting inflammatory bowel disease caused by proline deficiency.
[0006] The first objective of this invention is achieved through the following technical solution:
[0007] A drug for treating inflammatory bowel disease, comprising proline, wherein the proline content accounts for more than 1% of the total mass of the other components excluding water.
[0008] Further optimizations include that the drug is an oral drug, an enema drug, or an injectable drug; when the drug is an oral drug, it is in the form of powder, tablet, or oral liquid, and when it is an oral powder or tablet, the proline content is not less than 2%, and when it is an oral liquid, the proline content in the solute is not less than 5%; when the drug is an enema drug, the proline content in the solute is not less than 2%; and when the drug is an injectable drug, the proline content in the solute is not less than 5%.
[0009] Furthermore, the drug is a combination drug, and its components also include one or more of the following: 5-aminosalicylic acid, glucocorticoids, immunomodulatory drugs, biological agents, or oral small molecule reagents, wherein the biological agents include anticytokine drugs.
[0010] The implementation of this solution is based on the following research:
[0011] Intestinal proline concentration was found to be closely related to the severity of intestinal inflammatory diseases by affecting the effector function of intestinal type 3 innate lymphocytes (ILC3). Therefore, intestinal proline deficiency may be a cause of intestinal inflammatory diseases. Specifically, mice treated with proline-deficient diets or mice lacking proline transporters showed stronger DSS-induced inflammatory responses, and their intestinal ILC3 cells had a significantly reduced ability to produce the effector cytokine IL-22.
[0012] It has been found that moderately increasing intestinal proline concentration can treat inflammatory bowel diseases by promoting the intestinal ILC3 effector function.
[0013] Specifically, increasing the proline content in the drinking water of mice significantly alleviated DSS-induced inflammatory responses and enhanced the ability of intestinal ILC3 cells to produce the effector cytokine IL-22, and this effect was dependent on proline transporters. This indicates that proline can be used in the treatment of intestinal inflammatory diseases.
[0014] The second objective of this invention is achieved through the following technical solution:
[0015] A kit for detecting intestinal inflammatory diseases caused by proline deficiency includes quantitative reagents for detecting the expression levels of proline deficiency-related proteins; said proline deficiency-related proteins are any combination of one or more of SLC6A20, CEBPβ, and JMJD3.
[0016] Furthermore, the quantitative reagents for detecting SLC6A20 include primers for its gene SLC6A20: nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 (For: 5′-GCCAACTCGCTACAGTTCGT-3′, Rev: 5′-TACCTCCGCCGTACATCTGG-3′);
[0017] The quantitative reagent for detecting CEBPβ includes primers for its gene CEBPB: the nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 (For: 5'-CTTCAGCCCGTACCTGGAG-3', Rev: 5'-GGAGAGGAAGTCGTGGTGC-3').
[0018] The quantitative kit for detecting JMJD3 includes primers for its gene KDM6B: the nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 (For: 5'-CACCCCAGCAAACCATATTATGC-3', Rev: 5'-CACACAGCCATGCAGGGATT-3').
[0019] The implementation of this solution is based on the following research:
[0020] This study discovered transcription factors and histone modifying enzyme genes closely related to proline uptake in mouse intestinal ILC3, and these genes are also expressed in human intestinal ILC3.
[0021] Specifically, RNA-seq was used to analyze differentially expressed genes in wild-type and proline transporter Slc6a7-deficient ILC3 cells, revealing that the expression of transcription factor Cebpb and histone demethylase gene Kdm6b is regulated by proline content. Furthermore, the expression level of transcription factor Cebpb and the activity of histone demethylase JMJD3 encoded by Kdm6b are closely related to the effector function of ILC3.
[0022] Further analysis of RNA-seq and scRNA-seq data of intestinal ILC3 from IBD patients in the GEO database clarified the expression of proline transporter gene SLC6A20, transcription factor CEBPB, and histone demethylase gene KDM6B. This indicates that the expression of proline transporter, transcription factor CEBPB, and histone demethylase gene KDM6B is closely related to intestinal ILC3 function and intestinal inflammation. Therefore, these genes can be used to construct diagnostic reagents and kits for proline deficiency-related intestinal inflammatory diseases and their associated risk.
[0023] A kit for the auxiliary detection of intestinal inflammatory diseases caused by proline deficiency, comprising reagents for detecting proline uptake during protein synthesis.
[0024] Furthermore, reagents for detecting proline uptake during protein synthesis include: proline analogs with an alkynyl group, biotin- or fluorescein-labeled azides, tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA), CuSO4, and tri-(2-carboxyethyl)phosphine hydrochloride (TCEP); the proline analogs with an alkynyl group are shown in formula (1):
[0025]
[0026] The implementation of this solution is based on the following research:
[0027] Researching novel methods and kits for detecting proline uptake during protein synthesis.
[0028] First, a proline analog containing alkynes was synthesized. Then, this proline analog was added to 293T medium (the original medium did not contain proline) and cultured for 24 hours. The intracellular protein content containing the proline analog was then detected using a chemical click reaction, thus reflecting the cellular uptake of proline during protein synthesis.
[0029] Combining the two kits mentioned above yields a more comprehensive kit with the following features:
[0030] A kit for detecting intestinal inflammatory diseases caused by proline deficiency includes quantitative reagents for detecting the expression levels of proline deficiency-related proteins and reagents for detecting proline uptake during protein synthesis; the proline deficiency-related proteins are any combination of one or more of SLC6A20, CEBPβ, and JMJD3.
[0031] The third objective of this invention is achieved through the following technical solution:
[0032] An analytical system for detecting proline deficiency-induced inflammatory bowel disease, comprising:
[0033] Target expression level detection device: used to detect the expression level of the proline deficiency-related protein in a sample; the sample is tissue or cells from a colitis patient;
[0034] Detection device for proline uptake during target protein synthesis: used to detect proline uptake during protein synthesis in a sample.
[0035] Drug analysis device: Based on the expression level of proline deficiency-related proteins and the detection results of proline uptake during protein synthesis, analyze whether the patient is treated by supplementing proline, as well as the amount and method of proline supplementation;
[0036] Result output device: Used to output the results obtained from the drug analysis device.
[0037] The analytical system can be used with the aforementioned reagent kit.
[0038] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments. Attached Figure Description
[0039] Figure 1 To exacerbate the acute inflammatory response induced by sodium dextran sulfate (DSS) in proline-deficient diets, age- and sex-matched mice were randomly assigned to a normal diet group (ND) and a proline-deficient diet group (PFD). A DSS-induced colitis model was established after 2 weeks of feeding. Figure 1 A). Changes in body weight between the two groups of mice ( Figure 1 B) Colon length on day 7 of colitis ( Figure 1 C) and pathological changes in the colon ( Figure 1 D) and the expression differences of the colonic LTi cell effector cytokine IL-22 ( Figure 1 E). Values are expressed as mean ± SEM; n = 5 mice / group. * indicates a significant difference between the PFD group and the ND group (P < 0.05).
[0040] Figure 2 To demonstrate the aggravated DSS-induced acute inflammatory response in proline transporter-deficient mice, a DSS-induced colitis model was established using wild-type and proline transporter-deficient mice. Body weight changes in the two groups of mice were compared. Figure 2 A) Colon length on day 7 of colitis ( Figure 2 B) and pathological changes in the colon ( Figure 2 C) and the expression differences of the colonic LTi cell effector cytokine IL-22 ( Figure 2D). Values are expressed as mean ± SEM; n = 5 mice / group. * indicates a significant difference between proline transporter-deficient mice and wild-type mice (P < 0.05).
[0041] Figure 3 Adding proline to drinking water alleviated the acute inflammatory response induced by DSS. Age- and sex-matched mice were randomly assigned to a normal drinking water group (-Proline) and a proline-treated drinking water group (+Proline). A DSS-induced colitis model was also established. Figure 3 A). Changes in body weight between the two groups of mice ( Figure 3 B) Colon length on day 7 of colitis ( Figure 3 C) and pathological changes in the colon ( Figure 3 D) and the expression differences of the colonic LTi cell effector cytokine IL-22 ( Figure 3 E). Values are expressed as mean ± SEM; n = 5 mice / group. * indicates a significant difference between the PFD group and the ND group (P < 0.05).
[0042] Figure 4 The expression of transcription factor Cebpb is affected by proline deficiency. RNA-seq analysis of intestinal LTi cells from wild-type and proline transporter-deficient mice revealed gene expression changes closely related to proline deficiency. Volcano plots show differentially expressed genes in wild-type and proline transporter-deficient LTi cells. Figure 4 A), the heatmap shows differentially expressed genes in wild-type and proline transporter-deficient LTi cells (A), Figure 4 B), GO enrichment analysis of differentially expressed genes in wild-type and proline transporter-deficient LTi cells (B) Figure 4 C), differentially expressed transcription factors in wild-type and proline transporter-deficient LTi cells ( Figure 4 D), flow cytometry was used to detect the expression of C / EBPβ in wild-type and proline transporter-deficient LTi cells. Figure 4 E). And Cebpb expression levels affect the effector function of LTi cells ( Figure 4 F and G).
[0043] Figure 5 The expression of histone demethylase Kdm6b is affected by proline deficiency. RNA-seq analysis of intestinal LTi cells from wild-type and proline transporter-deficient mice revealed changes in gene expression closely related to proline deficiency. A heatmap shows the difference in histone modifying enzyme gene expression between wild-type and proline transporter-deficient LTi cells. Figure 5 AD), the bar chart shows the difference in expression of histone demethylase Kdm6b between wild-type and proline transporter-deficient LTi cells (AD). Figure 5E). Furthermore, the activity of the JMJD3 enzyme encoded by Kdm6b affects the effector function of LTi cells. Figure 5 F).
[0044] Figure 6 The expression of proline transporter SLC6A20, transcription factor CEBPB, and histone demethylase KDM6B in human intestinal ILC3 cells. Figure 6 AC).
[0045] Figure 7 This is a probe for detecting proline uptake during protein synthesis. The molecular structure of the synthesized proline analog containing an alkyne group is shown. Figure 7 A). Using this probe to incubate 293T cells for 24 hours, it was verified that the probe can be taken up by the cells and participate in protein synthesis. Figure 7 B). Detailed Implementation
[0046] The technical solution of the present invention will be further explained below with reference to experimental data.
[0047] Unless otherwise specified, the experimental methods used in the following embodiments and experimental examples are conventional methods.
[0048] Unless otherwise specified, all materials and reagents used in the following examples and experimental cases are commercially available.
[0049] In the quantitative experiments in the following examples and experimental cases, three replicate experiments were all set up.
[0050] All mouse studies in the following examples and experimental cases were conducted with the approval of the Ethics Committee of Peking University Health Science Center. All mice were housed and maintained in a specific pathogen-free facility with a 12-hour light / 12-hour dark cycle, an ambient temperature of 20-24°C, and a humidity of 30-70%. Six- to eight-week-old, sex-matched mice were used in the experiments. C57BL / 6J mice were purchased from the Department of Laboratory Animal Sciences, Peking University Health Science Center. - / - The mice were purchased from the Model Animal Research Center of Nanjing University.
[0051] Example 1
[0052] A drug for treating inflammatory bowel disease, wherein the drug is an oral powder, and the proline content is set to be no less than 2% based on the proline content in existing enteral nutrition powders and mouse experimental results; in this embodiment, it is 3%. Other components include other amino acids, fats, carbohydrates, minerals, vitamins, and trace elements. In this embodiment, other amino acids include arginine and glutamine.
[0053] Example 2
[0054] A drug for treating inflammatory bowel disease, the drug being an oral tablet, wherein the proline content is set to be no less than 2% based on the proline content in existing proline-containing tablets, the normal daily proline intake of humans, and mouse experimental results; in this embodiment, it is 5%. Other components include cellulose and vitamins.
[0055] Example 3
[0056] A drug for treating inflammatory bowel disease, wherein the drug is an oral liquid, and the proline content in the solute is set to be no less than 5% based on the proline content in existing amino acid oral solutions, the normal daily proline intake of humans, and the results of mouse experiments. In this embodiment, the proline content in the solute is 50%, and the other components of the solute are other amino acids. The other amino acids in this embodiment include arginine and glutamine.
[0057] Example 4
[0058] A drug for treating inflammatory bowel disease, the drug being an oral liquid, wherein the components of this embodiment are proline and water, and the solute is entirely proline.
[0059] Example 5
[0060] A drug for treating inflammatory bowel disease, the drug being an enema drug, wherein the proline content in the solute is set to be no less than 2% based on the proline content in existing amino acid-based enteral nutrition agents, the composition of inflammatory bowel disease enema drugs, and mouse experimental results; in this embodiment, the proline content in the solute is 2.5%; other components of the solute include anti-inflammatory drugs; in this embodiment, the anti-inflammatory drugs are mesalazine or hydrocortisone sodium succinate.
[0061] Example 6
[0062] A drug for treating inflammatory bowel disease, wherein the drug is an injectable drug, and the proline content in the solute is set to be no less than 5% based on the proline content in existing amino acid injectable drugs, the normal daily proline intake of humans, and the results of mouse experiments. In this embodiment, the proline content in the solute is 7%. Other components of the solute include hypertonic glucose (or glucose and fat emulsion), electrolytes, vitamins, and trace elements to achieve the purpose of nutritional support.
[0063] Example 7
[0064] A drug for treating inflammatory bowel disease, comprising proline and 5-aminosalicylic acid, wherein proline and 5-aminosalicylic acid are packaged separately, 5-aminosalicylic acid is in tablet or capsule form, and the proline solution contains only proline and water.
[0065] Example 8
[0066] A drug for treating inflammatory bowel disease, comprising proline and mesalazine, wherein proline and mesalazine are packaged separately, mesalazine is in tablet or capsule form, and the proline solution contains only proline and water.
[0067] Example 9
[0068] A kit for detecting inflammatory bowel disease caused by proline deficiency includes quantitative reagents for detecting the expression levels of proline deficiency-related proteins; said proline deficiency-related proteins are a combination of SLC6A20, CEBPβ, and JMJD3. The quantitative reagent for detecting SLC6A20 includes primers for its gene SLC6A20: nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; the quantitative reagent for detecting CEBPβ includes primers for its gene CEBPB: nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; the quantitative kit for detecting JMJD3 includes primers for its gene KDM6B: nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6.
[0069] If the expression levels of CEBPβ or JMJD3 are detected below the threshold, it indicates that the cause of the inflammation may be proline deficiency. Furthermore, if the expression level of SLC6A20 is higher than the detection threshold, it indicates that proline supplementation may be effective. However, if the expression level of SLC6A20 is lower than the detection threshold, it indicates that proline supplementation may be ineffective.
[0070] Example 10
[0071] A kit for the auxiliary detection of inflammatory bowel disease caused by proline deficiency includes reagents for detecting proline uptake during protein synthesis. The reagents for detecting proline uptake during protein synthesis include: an alkynyl proline analog, a biotin- or fluorescein-labeled azide, tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine, CuSO4, and tri-(2-carboxyethyl)phosphine hydrochloride; the alkynyl proline analog is shown in formula (1):
[0072]
[0073] After culturing target cells with alkyne-containing proline analogs for a period of time, the cells were fixed and perforated to remove intracellular free proline analogs. Then, a mixture of biotin- or fluorescein-labeled azide, tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine, CuSO4, and tri-(2-carboxyethyl)phosphine hydrochloride was added to the cells for reaction. The proline-containing proteins were then detected by flow cytometry. If proline cannot be effectively taken up by the target cells, such as human intestinal ILC3 cells, it suggests that the cause of inflammation may be proline deficiency.
[0074] Example 11
[0075] A kit for detecting inflammatory bowel disease caused by proline deficiency includes quantitative reagents for detecting the expression levels of proline deficiency-related proteins and reagents for detecting proline uptake during protein synthesis; the proline deficiency-related proteins are a combination of SLC6A20, CEBPβ, and JMJD3.
[0076] The quantitative reagent for detecting SLC6A20 includes primers for its gene SLC6A20: the amino acid sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; the quantitative reagent for detecting CEBPβ includes primers for its gene CEBPB: the amino acid sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; the quantitative kit for detecting JMJD3 includes primers for its gene KDM6B: the amino acid sequences are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0077] Reagents used to detect proline uptake during protein synthesis include: proline analogs with an alkynyl group, biotin- or fluorescein-labeled azides, tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA), CuSO4, and tri-(2-carboxyethyl)phosphine hydrochloride (TCEP); the proline analogs with an alkynyl group are shown in formula (1):
[0078]
[0079] If the expression levels of CEBPβ or JMJD3 are detected to be below the threshold, and the expression level of SLC6A20 is detected to be above the threshold, and the target cells can effectively take up proline, it indicates that proline supplementation may be effective for inflammatory bowel disease.
[0080] Example 12
[0081] An analytical system for detecting inflammatory bowel disease caused by proline deficiency, used in conjunction with the kit of Example 8, comprising:
[0082] Target expression level detection device: used to detect the expression level of proline deficiency-related proteins in a sample; the sample is tissue or cells from a colitis patient;
[0083] Detection device for proline uptake during target protein synthesis: used to detect proline uptake during protein synthesis in a sample.
[0084] Drug analysis device: Based on the expression level of proline deficiency-related proteins and the detection results of proline uptake during protein synthesis, analyze whether the patient is treated by supplementing proline, as well as the amount and method of proline supplementation;
[0085] Result output device: Used to output the results obtained from the drug analysis device.
[0086] Experimental Example 1
[0087] The effect of proline deficiency on DSS-induced intestinal inflammatory response in mice:
[0088] In this experiment, age- and sex-matched C57BL / 6 mice aged 6-8 weeks were randomly divided into two groups: a control diet (ND) group and a proline-deficient diet (PFD) group. The composition of the relevant diets is shown in Table 1. The experimental treatment process consisted of a pretreatment period with different diets (2 weeks), a DSS-induced acute colitis period (5 days), and a recovery period (2 days). During the DSS-induced acute colitis period (5 days) and the recovery period, the weight of the mice was recorded daily, and a weight change curve was plotted. On the last day of the recovery period, the mice were sacrificed, and the colon was photographed for length and H&E staining for histopathological examination. The results are as follows: Figure 1 As shown.
[0089] This experiment also used 6-8 week old, sex-matched wild-type C57BL / 6 mice and proline transporter Slc6a7-deficient mice to construct experimental models, divided into a DSS-induced acute colitis phase (5 days) and a recovery phase (2 days). Mouse weight was recorded daily, and weight change curves were plotted. On the last day of the recovery phase, mice were sacrificed, and the colon was harvested for length photography and H&E staining for histopathological examination. Results are as follows: Figure 2 As shown.
[0090] Table 1: Components of Control Diet (ND) and Proline-Deficient Diet (PFD)
[0091] Element Control feed (g) Proline-deficient feed (g) L-amino acid mixture without proline 176.1 176.1 L-proline 30.7 --- sucrose 348.38 348.38 beta-glucan 119.3 150 Soybean oil 143.3 143.3 Cellulose 30 30 Mineral mixture and vitamin mixture 69.5 69.5 tartrate choline 2.7 2.7 tert-butylhydroquinone 0.02 0.02 total 1000 1000
[0092] Experiment Example 2
[0093] Adding proline to drinking water can alleviate DSS-induced intestinal inflammatory response in mice.
[0094] In this experiment, age- and sex-matched C57BL / 6 mice aged 6-8 weeks were randomly divided into two groups: a non-proline group (-Proline) and a proline-matched group (+Proline). Simultaneously, age- and sex-matched Slc6a7-deficient mice were added to the diet to supplement proline and verify whether the function of proline depends on its transporter Slc6a7. The experiment consisted of a DSS-induced acute colitis period (5 days) and a recovery period (2 days), with proline added to the drinking water throughout the process, either directly or not. During the DSS-induced acute colitis period (5 days) and the recovery period, mouse weight was recorded daily, and weight change curves were plotted. On the last day of the recovery period, mice were sacrificed, and the colon was photographed for length and H&E staining for histopathological examination. Results are as follows: Figure 3 As shown.
[0095] Experimental Example 3
[0096] Gene analysis showing significant changes in wild-type and Slc6a7-deficient LTi cells:
[0097] Flow cytometry was used to sort corresponding LTi cells for transcriptomic RNA-seq analysis. cDNA preparation was performed using the SMART-SeqHT Kit (Takara). Sorted intestinal LTi cells were directly introduced into cell lysis buffer, and cDNA reverse transcription, amplification, and purification were completed according to the kit's recommended procedures. Library construction was performed according to the recommended procedures of the TruePrep DNA Library Prep Kit V2 for Illumina (Vazyme). Library sequencing was performed using the Illumina NovaSeq platform. The obtained data were analyzed using bioinformatics methods. Results are as follows: Figure 4 As shown in AE.
[0098] Experiment Example 4
[0099] Cebpb expression levels affect the effector function of LTi cells:
[0100] First, construct the corresponding plasmid. For the Cebpb RNA interference experiment, select SEQ ID NO.7:
[0101] The sequences ACAAGCTGAGCGACGAGTACA (sense strand) and SEQ ID NO. 8: ACAAGCTGAGCGACGAGTACA (antisense strand), and SEQ ID NO. 9: CACCCTGGGAACTGTTTCAA (sense strand) and SEQ ID NO. 10: TTGAACAAGTTCCGCAGGTG (antisense strand) were cloned into the pLKO.1 vector. For Cebpb overexpression, mouse Cebpb cDNA was cloned into pLent-EF1a-FH-CMV-GP. The corresponding lentiviruses were packaged using 293T cells. LTi cells were sorted by flow cytometry from the intestines of wild-type mice, and Cebpb expression levels were regulated in vitro using different lentivirus infections. Differences in the production of the effector cytokine IL-22 by LTi cells were detected 72 hours after infection. Results are as follows: Figure 4 As shown in FG.
[0102] Experimental Example 5
[0103] JMJD3 enzyme activity affects the effector function of LTi cells:
[0104] Sorted LTi cells were cultured in complete medium supplemented with 10 ng / ml recombinant mouse IL-7 (PeproTech), 10 ng / ml recombinant human IL-2 (PeproTech), and 10 ng / ml recombinant mouse SCF (PeproTech). Simultaneously, 2 mM α-KG or 2 mM α-KG and 1 μM JMJD3 inhibitor GSK-J4 were added to the medium. After 24 hours of culture, the differences in the production of the effector cytokine IL-22 by LTi cells were detected. Results are as follows: Figure 5 As shown.
[0105] Experimental Example 6
[0106] Human intestinal ILC3 cells express proline transporter SLC6A20, transcription factor CEBPB, and histone demethylase KDM6B.
[0107] Bulk RNA-seq and scRNA-seq data of IBD patients were downloaded from the GEO database. Bioinformatics analysis was used to clarify the expression of proline transporter, transcription factor CEBPB, and histone demethylase KDM6B in human intestinal ILC3 cells, and their correlation with inflammation. Results are as follows: Figure 6 As shown.
[0108] Experimental Example 7
[0109] To verify the availability and feasibility of the probe for detecting proline uptake during protein synthesis.
[0110] A proline analog containing alkyne was added to the culture medium of 293T cells. After 24 hours of culture, its binding to proteins was examined. Cells were fixed and permeabilized before the "click" reaction, which also avoided interference from intracellular free proline analogs. For the "click" reaction, a biotin-conjugated azide was added to the fixed and permeabilized cells, and the mixture was cultured in Cu... 2+ Catalysis leads to the formation of covalent bonds between the azide and the alkynes on the proline analog. After incubation with avidin conjugated with PE luciferin, the intracellular protein content incorporating the proline analog was detected by flow cytometry. This result clearly demonstrates the ability of proline analogs to be taken up by cells and bound to proteins. Results are as follows... Figure 7 As shown.
[0111] The above embodiments are only a partial embodiment of the present invention and do not cover all of the present invention. Based on the above embodiments and the accompanying drawings, those skilled in the art can obtain more implementation methods without creative effort. Therefore, all implementation methods obtained without creative effort should be included within the protection scope of the present invention.
Claims
1. A kit for assisting in the detection of inflammatory bowel disease caused by proline deficiency, characterized in that: The apparatus includes quantitative reagents for detecting the expression levels of proline deficiency-related proteins; the proline deficiency-related proteins are a combination of SLC6A20, CEBPβ, and JMJD3. It also includes reagents for detecting proline uptake during protein synthesis; Reagents used to detect proline uptake during protein synthesis include: proline analogs with an alkynyl group, biotin- or fluorescein-labeled azides, tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine, CuSO4, and tri-(2-carboxyethyl)phosphine hydrochloride; the proline analogs with an alkynyl group are shown in formula (1):
2. The kit for auxiliary detection of inflammatory bowel disease caused by proline deficiency according to claim 1, characterized in that: The quantitative reagents for detecting SLC6A20 include primers for its gene SLC6A20: the nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; The quantitative reagents for detecting CEBPβ include primers for its gene CEBPB: the nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; The quantitative kit for detecting JMJD3 includes primers for its gene KDM6B: the nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.
6.
3. An analytical system for detecting inflammatory bowel disease caused by proline deficiency, using the kit described in claim 1, characterized in that, include: Target expression level detection device: used to detect the expression level of proline deficiency-related proteins in samples; The sample was tissue or cells from a patient with colitis; Detection device for proline uptake during target protein synthesis: used to detect proline uptake during protein synthesis in a sample. Drug analysis device: Based on the expression level of proline deficiency-related proteins and the detection results of proline uptake during protein synthesis, analyze whether the patient is treated by supplementing proline, as well as the amount and method of proline supplementation; Result output device: Used to output the results obtained from the drug analysis device.
Citation Information
Patent Citations
Promotion of healing of intestinal mucosa using proline, serine and threonine
US20170368026A1