Application of long non-coding RNA LncZFHX2 in the preparation of drugs for treating osteoarthritis
By regulating the KLF4 protein with the long non-coding RNA LncZFHX2 and promoting RIF1 transcription, and by using adeno-associated virus to increase the expression level of LncZFHX2, the problem of precision in the early treatment of osteoarthritis has been solved, and rapid and efficient therapeutic effects have been achieved.
Patent Information
- Application Number
- CN202310924989.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-26
- Publication Date
- 2026-06-02
- Estimated Expiration
- 2043-07-26
AI Technical Summary
Current technologies cannot effectively control the pathological progression of osteoarthritis, especially in the early stages, resulting in the inability to reverse the disease by only relieving symptoms with anti-inflammatory and analgesic drugs, and a lack of precise treatment methods.
Using the long non-coding RNA LncZFHX2 as a regulatory agent, it specifically binds to the KLF4 protein and promotes the transcriptional regulation of the RIF1 protein. The expression level of LncZFHX2 is increased in vivo by adeno-associated virus, which enhances the cartilage matrix. It is prepared into tablets, capsules, granules, oral liquids, drops, aerosols or injections for treatment.
It achieves precise regulation of the RIF1 protein, improves the efficacy of osteoarthritis treatment, and features rapid action, high efficiency, and low cost, providing a new intervention and treatment approach.
Smart Images

Figure CN117018012B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to the application of long non-coding RNA LncZFHX2 in the preparation of drugs for treating osteoarthritis. Background Technology
[0002] Osteoarthritis is a degenerative disease characterized by cartilage destruction, subchondral bone remodeling, and synovial inflammation. The main symptoms of osteoarthritis include joint pain, stiffness, and difficulty in movement, affecting patients' normal work and life. However, the pathological mechanisms of osteoarthritis are complex, involving numerous factors, and treatment options are limited. Currently, treatment for early-stage osteoarthritis mainly involves increasing functional exercises and using non-steroidal anti-inflammatory drugs (NSAIDs). For patients with advanced osteoarthritis, only total joint replacement surgery can achieve the goals of eliminating pain, correcting deformities, and improving function. To date, treatment for osteoarthritis primarily focuses on anti-inflammatory and analgesic therapies, which can only relieve symptoms and cannot reverse disease progression. Early control of local inflammatory responses, protection of cell activity, and maintenance of the integrity of the extracellular matrix—that is, early intervention or even reversal of the degenerative process of articular cartilage tissue—can reduce patient suffering and economic burden, and achieve better treatment outcomes, which has significant medical and social value. Therefore, studying the mechanisms of cartilage degeneration, avoiding and reducing cell death in the early stages of the disease, preserving the extracellular matrix to the greatest extent, and even promoting tissue functional reconstruction are of great importance.
[0003] Gene therapy is a hot research topic in precision medicine. In this field, non-coding RNAs, due to their non-translation into proteins, possess a natural advantage in gene drug development. Among them, long non-coding RNAs (lncRNAs), with their large quantity, diverse regulatory mechanisms, and important functions, are expected to become the largest target library for gene therapy drug development. Currently, the US FDA has approved several RNA-based drugs targeting different diseases. The increasing number of approved RNA drugs year by year fully demonstrates the feasibility of RNA therapy and indicates its rapid development as a next-generation treatment approach. RNA-targeted drugs represent a completely new drug category, entirely different from small molecule drugs and antibody drugs. They possess advantages such as abundant candidate targets, short development cycles, long-lasting efficacy, and high clinical development success rates. Treating at the post-transcriptional level, they can achieve breakthroughs against specific protein targets that are difficult to drug, potentially conquering diseases for which there are currently no drugs, including genetic diseases and other intractable diseases. They have enormous potential to develop therapeutic drugs for diseases that are "untargetable" and "undrugable," and are expected to become the third wave of modern new drugs after small molecule drugs and antibody drugs. Summary of the Invention
[0004] The first objective of this invention is to address the shortcomings of the prior art by providing the application of a long non-coding RNA LncZFHX2 regulatory agent in the preparation of a drug for treating osteoarthritis.
[0005] Preferably, the regulatory agent regulates the overexpression of LncZFHX2.
[0006] As a preferred embodiment, LncZFHX2 specifically binds to the KLF4 protein and promotes its transcriptional regulation of the RIF1 protein.
[0007] Preferably, the regulatory agent is LncZFHX2 adeno-associated virus, which significantly increases the expression level of LncZFHX2 in vivo and increases the amount of cartilage matrix.
[0008] A second objective of this invention is to provide a medicament for treating osteoarthritis, wherein the active ingredient of the medicament comprises the long non-coding RNA LncZFHX2.
[0009] Preferably, the drug also includes pharmaceutically acceptable excipients.
[0010] Preferably, the dosage form of the drug is tablets, capsules, granules, oral liquid, pills, aerosols, or injections.
[0011] A third objective of this invention is to provide a medicament for treating osteoarthritis, wherein the active ingredient of the medicament comprises a long non-coding RNA LncZFHX2 adeno-associated virus.
[0012] Preferably, the drug also includes pharmaceutically acceptable excipients.
[0013] Preferably, the dosage form of the drug is tablets, capsules, granules, oral liquid, pills, aerosols, or injections.
[0014] The beneficial effects of this invention are:
[0015] This invention provides the application of a long non-coding RNA, LncZFHX2, in the preparation of drugs for treating osteoarthritis. This LncZFHX2 has a specific target; through its specific structure and base sequence, it specifically binds to the KLF4 protein and promotes its transcriptional regulation of RIF1, achieving precise regulation. By indirectly regulating the expression of large proteins, it overcomes the difficulty in constructing recombinant proteins or overexpression plasmids for RIF1 protein due to its large molecular weight and long coding sequence. LncZFHX2 can indirectly regulate RIF1 to improve cell state.
[0016] The LncZFHX2 sequence is short and does not require translation into a protein to function, exhibiting characteristics of rapid action, high efficiency, and low cost. Its synthetic application offers high cost-effectiveness, providing a new intervention approach and candidate drug for the clinical prevention and treatment of osteoarthritis. Attached Figure Description
[0017] Figure 1 This is a schematic diagram of the LncZFHX2 gene knockout mouse construction protocol, with the knockout region shown in the figure.
[0018] Figure 2 The results are the behavioral analysis results of mice, where A is the hot plate analysis result and B is the rotarod analysis result;
[0019] Figure 3 Micro-CT analysis of osteophyte formation in mice;
[0020] Figure 4 The results of the morphological study of mouse articular cartilage tissue are shown in Figure A, where A represents the results of Red and Fast Green staining, and B represents the OARSI score and subchondral bone thickness measurement.
[0021] Figure 5 The results of RNA fluorescence in situ hybridization and immunofluorescence staining in mouse articular cartilage are shown in Figure A, where RNA fluorescence in situ hybridization and immunofluorescence staining are shown in Figure B, and the percentage of LncZFHX2 and RIF1 positive cells is statistically analyzed.
[0022] Figure 6 The results of immunohistochemical staining of mouse articular cartilage tissue are shown in Figure A, where immunohistochemical staining is shown in Figure B, and the percentage of γH2AX positive cells is shown in Figure B.
[0023] Figure 7 The image shows the red and fast green staining analysis of the treatment effect of LncZFHX2AAV, where A is the red and fast green staining result, and B is the OARSI score and subchondral bone thickness measurement.
[0024] Figure 8 The image shows the RNA FISH staining analysis of the therapeutic effect of LncZFHX2AAV, where A represents RNA fluorescence in situ hybridization and B represents the statistical percentage of LncZFHX2 positive cells.
[0025] Figure 9 To validate the in vitro knockdown and overexpression function of LncZFHX2, A represents the LncZFHX2 knockdown efficiency assay, B represents the protein expression assay of genes related to anabolism (SOX9, Col2a1, ACAN), catabolism (ADAMTS5, MMP13), and cellular senescence (P16, P21), C represents the LncZFHX2 overexpression efficiency assay, and D represents the protein expression assay of genes related to anabolism (SOX9, Col2a1, ACAN), catabolism (ADAMTS5, MMP13), and cellular senescence (P16, P21). Detailed Implementation
[0026] The present invention will be further described below.
[0027] LncZFHX2 is expressed and highly conserved in both humans and mice. The human derivative is IDENST00000553985, and the mouse derivative is IDENSMUST00000183822. This invention is primarily based on the mouse-derived sequence, as shown in SEQ ID NO.1:
[0028] ATACAATGGAGGAAGCAGGCCATGACTAAGACCCCAAGGATGAAGAATGGAGAGCCCTGACC
[0029] GTCCTCCTGGCCTCCAGTCATTTCCCCACTGAAGATGGCCGTACCCTCTAGCCTGGGAGGACC
[0030] ATGGCCCAACAATGGCAGTGGGAGAGAAGATGACTCTGTGGAGGACACTCTCCGTTATCTGTG
[0031] ATGACATACACCAGCCCCCGAACAATTTAACCTCAAGCTGCCCTCTGCAAGACTTCGGTAGCA
[0032] CTGGACTTCCCTCATTCCTGGTAGGCAGAGGTTGTTAGCCATCAGCCTGGAAGATCTGAAGGA
[0033] AAATTTGGCTTGGGTAAAGTCAAAGGGGATGGCTCTCAGAGATAAGGCCAGTTCATGAGAA
[0034] GTAAGCAGGGCTTTGCTACCTGTGCAGGGGCAGAGCTGCCCTGGGCTGGGGGGAGTTCTGATG
[0035] TCAACATCTCTGGAGGCAGATGACAACTTCAGAAGAGGCAAAATTTCCCCAGGAGAAAAGAA
[0036] AACAGGAGGTCTTCAGTCAACATGGAGTGCCAGCACAGGAGGAGGCACCAGCCAAGCTCAT
[0037] GGTATACCTACAGCGCTTCAGGCCTCTGGACTATCAGCGCCTGCTAGAAGCAGCCAGTTCTGGTGAGGCCACAGGGGACTCAGCATCCTGACAACAGCGTTCACTTTCC. (SEQ ID NO.1)
[0038] Example 1: Phenotype of LncZFHX2 gene knockout mice in an arthritis model
[0039] (1) Construction of LncZFHX2 conditional knockout mice: LncZFHX2 conditional knockout mice were prepared using CRISPR-CAS9 technology. The mouse genotype identification is shown in the figure. Figure 1 The identification primers used include the sense strand with the sequence shown in SEQ ID NO.2 and the antisense strand with the sequence shown in SEQ ID NO.3. The specific sequences are as follows:
[0040] Chain of Justice: 5'-GGACAATAGCTGTCAGTCAATAGC-3' (SEQ ID NO.2);
[0041] Antisense chain: 5'-ACATAACTCAGAGTGTTTGCCTGT-3' (SEQ ID NO.3).
[0042] (2) Induction of LncZFHX2 conditional knockout mice: Construction of Col2 articular cartilage-specific CreLncZFHX2 fl / fl Gene knockout mice. Two months after birth, the genes were induced to be knocked out using Tamoxifen. The knockout mice maintained normal physiological activity and showed no obvious physical abnormalities. The identification primers used for Col2a1 mice included the sense strand sequence shown in SEQ ID NO.4 and the antisense strand sequence shown in SEQ ID NO.5. The specific sequences are as follows:
[0043] Chain of Justice: 5'-CACTGCGGGCTCTACTTCAT-3' (SEQ ID NO.4);
[0044] Antisense chain: 5'-ACCAGCAGCACTTTTGGAAG-3' (SEQ ID NO.5).
[0045] (3) Construction of a mouse arthritis model: Wild-type mice and LncZFHX2 conditional knockout mice were randomly divided into two groups: the medial meniscus instability group (DMM) and the sham-operated control group (Sham). The DMM procedure is briefly described as follows: On the day of surgery, the mice were weighed. Preoperative anesthesia was performed by intraperitoneal injection of pentobarbital 50 mg / kg. After successful anesthesia, the mice were fixed to the experimental board with rubber bands to complete the surgical restraint. The surgical procedure is briefly described as follows: After fixing and disinfecting the mouse knee joint, the medial side of the patellar ligament was cut with a scalpel blade to expose the joint cavity; the intercondylar fat pad of the femoral condyle was bluntly dissected to expose the intercondylar region, so that the medial meniscus and tibial ligament could be observed; the medial meniscus and tibial ligament were cut with microscissors, and the tissue and skin were sutured. Postoperatively, the patient was placed under an infrared warm lamp until fully recovered from anesthesia and then returned to the original cage. Ampicillin was administered subcutaneously at a dose of 20 mg / kg based on body weight to prevent infection, and buprenorphine was administered subcutaneously at a dose of 0.05 mg / kg based on body weight for analgesia at 0 and 4 hours postoperatively.
[0046] (4) Behavioral Analysis: Behavioral analysis was performed on mice eight weeks post-operation using the DMM model. This included hot plate pain analysis and rotarod analysis. For the hot plate pain analysis, mice were transferred to the operating room at least 30 minutes before the experiment. To assess thermal hyperalgesia, mice were placed individually on a 55°C hot plate. The time elapsed before the appearance of obvious hindlimb licking, shaking, or jumping was recorded as the response latency. The maximum duration for each test was 45 seconds. After observing a response, the mice were immediately removed from the hot plate. The test was repeated three times for each mouse, with a one-day rest between each test, and the average value was calculated. For the rotarod analysis, mice were placed on a rotating rod and trained at a constant speed for at least 30 minutes to exclude differences in learning skills. After training, the mice were placed on an accelerated rotating rod. The time each mouse remained on the rod was called the first ride time. The maximum duration for each test was 5 minutes. The analysis of the response latency and first ride time results is shown in [link to analysis]. Figure 2 .
[0047] (5) Micro-CT Analysis: Eight weeks after mouse modeling, mice were euthanized by cervical dislocation, and their tibias were fixed in 4% paraformaldehyde for 48 hours. The knee joint was scanned using a SkyScan 1,275 micro-CT scanner under the following conditions: resolution 9 μm, X-ray energy source set to 45 kV / 55 μA. The osteophyte formation in the mouse knee joint was observed after three-dimensional reconstruction following micro-CT scanning. Figure 3 ).
[0048] (6) Fast Green and Red Staining: After Micro-CT scanning of mouse knee joints, the tissues were decalcified with 12.5% EDTA for one week. The tissues were then dehydrated in ethanol of varying concentrations and embedded in molten paraffin. All knee joint tissues were cut into 3-micrometer-thick sections under a microscope. The paraffin sections were dewaxed with xylene, rehydrated in a gradient of alcohols, and washed with PBS to remove the alcohol. The sections were stained with 1% Fast Green for 5 min, soaked in 1% acetic acid for 5 s, and then stained with 1% Fast Green. After dehydration with a gradient of alcohols, the sections were mounted with neutral resin, and images of the articular cartilage tissue were taken under a microscope. The analysis results showed that LncZFHX2 fl / fl Col2CRE mice showed significantly greater joint severity after DMM modeling compared to the control group. Figure 4 ).
[0049] (7) RNA fluorescence in situ hybridization (FISH): A cy3-labeled LncZFHX2-specific probe was designed and synthesized. Paraffin sections were dewaxed with xylene, rehydrated in a gradient of alcohols, and washed with PBS to remove the alcohol. The sections were then treated with 0.8% pepsin at 37°C for 30 minutes and incubated overnight at 37°C with the FISH probe. They were then washed three times with washing buffer at 42°C. Staining was performed with 4,6-diamino-2-phenylindole (DAPI) at room temperature for 10 minutes. The staining of articular cartilage was observed under a fluorescence microscope. Analysis showed that LncZFHX2... fl / fl LncZFHX2 expression was significantly reduced in the articular cartilage of Col2CRE mice. Figure 5 ).
[0050] (8) Immunofluorescence staining of tissue sections: Paraffin sections were dewaxed with xylene, rehydrated in a gradient of alcohols, and washed with PBS to remove the alcohol. After incubating with sodium citrate antigen retrieval solution for 1 hour, the sections were incubated sequentially with 3% H2O2 and 5% bovine serum albumin at room temperature for 30 minutes each. Then, the sections were incubated with RIF1 antibody overnight at 4°C. The next day, the sections were washed three times with PBS and incubated with Alexa Fluor 594-labeled goat anti-rabbit IgG fluorescent secondary antibody for 1 hour. Cell nuclei were stained with DAPI at room temperature for 10 minutes. The staining of articular cartilage was observed using a fluorescence microscope. Analysis results showed that LncZFHX2 fl / fl RIF1 expression was significantly reduced in the articular cartilage of Col2CRE mice. Figure 5 ).
[0051] (9) Immunohistochemical staining: Paraffin sections were dewaxed with xylene and rehydrated in a gradient of alcohols, then washed with PBS to remove the alcohol. After incubating with sodium citrate antigen retrieval solution for 1 hour, the sections were incubated sequentially with 3% H2O2 and 5% bovine serum albumin at room temperature for 30 minutes each. Then, the sections were incubated overnight at 4°C with γH2AX antibody. The next day, the sections were washed three times with PBS and incubated with biotinylated linker and streptavidin-horseradish peroxidase (HRP) reagent for 30 minutes, followed by staining with 3,30-tetrahydrochloric acid hydrated diaminobenzidine (DAB). Finally, the sections were stained with hematoxylin. Images of the articular cartilage tissue were taken under a microscope. Analysis results showed that LncZFHX2 fl / fl RFI1 expression was significantly reduced in the articular cartilage of Col2CRE mice. Figure 6 ).
[0052] Example 2: Treatment of arthritis in mice with LncZFHX2 adeno-associated virus (AAV).
[0053] (1) Construction of LncZFHX2AAV: The full-length sequence of LncZFHX2 was amplified by PCR and inserted into the AAV vector GPAAV-CMV-MCS-EF1-ZsGreen1-WPRE. The correct construction of the full-length sequence was verified by Sanger sequencing. One day before transfection, HEK293 cells were seeded in 10cm cell culture dishes with pre-treated surfaces at a density of 70%–80%. 300 μl of Opti-MEM medium (containing 15 μl of Lipofectamine 3000 and 4 μg of recombinant plasmid) was mixed with HEK293 cells and incubated for 6 h. After 48 hours, the adenovirus-containing medium was purified using a 0.45 μm filter (Millipore, Billerica, MA, USA). AAV virus was collected from HEK293 cells, concentrated by centrifugation with cesium chloride, and its titer was determined.
[0054] (2) LncZFHX2AAV treatment in mice: Mice were randomly divided into three groups: control group, DMM group, and DMM+ treatment group. The mouse arthritis model was established as described above. One week after DMM modeling, mice in the treatment group were injected with 10 μL of LncZFHX2AAV into the knee joint, with a total dose of 5 × 10⁻⁶ μL. 9 PFUs.
[0055] (3) Analysis of the therapeutic effect of LncZFHX2AAV: Red and Fast Green staining, RNA-FISH staining, and tissue immunofluorescence staining were performed as described above. The results showed that in the LncZFHX2AAV treatment group, the expression level of LncZFHX2 was significantly increased, and the cartilage matrix increased, confirming that LncZFHX2 has a significant therapeutic effect on arthritis. Figure 7 , Figure 8 ).
[0056] Example 3: LncZFHX2 silencing / overexpression promotes / inhibits osteoarthritis in vitro
[0057] (1) Isolation of mouse chondrocytes: Articular cartilage was carefully isolated from the femoral condyle and tibial plateau of 5-day-old mice (wild-type C57BL / 6). The free cartilage was washed three times with sterile PBS and digested with 0.2% type II collagenase. The digestion solution was filtered through a 0.075 mm cell filter, and the cells were cultured in a high-glucose medium containing 10% fetal bovine serum in a 37°C, 5% CO2 incubator.
[0058] (2) Cell transfection: LncZFHX2 silencing: antisense oligonucleotides (ASO) were synthesized by Guangzhou Ruibo Biotechnology and transfected using Lipofectamine 3000 transfection reagent at a ratio of 1 μl / 10 5 Transfected mouse chondrocytes with LncZFHX2ASO or the control (NCASO) at a concentration of 20 nM. The medium was changed 8 hours after transfection, and RNA and protein were extracted from the cells 48 hours later. The LncZFHX2ASO sequence includes ASO1 (SEQ ID NO. 6) and ASO2 (SEQ ID NO. 7), as shown below:
[0059] ASO1:5'-CAACATGGAGTGCCAGCACA-3'(SEQ ID NO.6)
[0060] ASO2:5'-CTTCAGTCAACATGGAGTGC-3'(SEQ ID NO.7)
[0061] LncZFHX2 overexpression: The full-length sequence of LncZFHX2 was amplified by PCR and inserted into the adenovirus vector GPAAV-CMV-MCS-EF1-ZsGreen1-WPRE. The remaining steps were the same as for AAV construction. The obtained LncZFHX2 was used to infect mouse chondrocytes at a concentration of 100-400 MOI. The medium was changed 8 hours after transfection, and RNA and protein were extracted from the cells 48 hours later.
[0062] (3) Protein and RNA detection: RNA and protein were obtained from mouse chondrocytes. The expression of LncZFHX2 was detected by RT-qPCR, and the protein expression of genes related to chondrocyte anabolic metabolism (SOX9, COL2A1, ACAN), catabolism (ADAMTS5, MMP13), and cellular senescence (P16, P21) was detected by Western blotting. The results are as follows: Figure 9 . Figure 9This indicates that knockdown of LncZFHX2 reduced the anabolic substances SOX9, Col2a1, and ACAN, while increasing the catabolism substances ADAMTS5 and MMP13, and increasing cellular senescence substances P16 and P21. Conversely, overexpression of LncZFHX2 produced the opposite results.
Claims
1. The application of a long non-coding RNA LncZFHX2 regulatory agent in the preparation of drugs for treating osteoarthritis, characterized in that, The sequence of the long non-coding RNA LncZFHX2 is shown in SEQ ID NO.
1. The regulatory agent is LncZFHX2 adeno-associated virus, used to regulate LncZFHX2 overexpression.
2. The application according to claim 1, characterized in that, LncZFHX2 specifically binds to the KLF4 protein and promotes its transcriptional regulation of the RIF1 protein.
3. The application according to claim 1, characterized in that, The drug also includes pharmaceutically acceptable excipients.
4. The application according to claim 1, characterized in that, The dosage form of the drug is tablets, capsules, granules, oral liquid, pills, aerosols, or injections.
Citation Information
Patent Citations
Diagnostic and therapeutic uses of long non-coding RNA
CN112063710A
Identification of Cancer Genes by In-Vivo Fusion of Human Cancer Cells and Animal Cells
US20160060707A1