SNP sites related to egg-laying sustainability of qingyuan chicken and application thereof

Abstract

The present application relates to the technical field of biological breeding, and particularly relates to a SNP site related to egg-laying duration of Qingyuan chicken and application thereof; the SNP site related to egg-laying duration of Qingyuan chicken is a G / C mutation at the 251th position in a sequence shown in SEQ ID NO:1; or a C / T mutation at the 201th position in a sequence shown in SEQ ID NO:2; or a G / A mutation at the 251th position in a sequence shown in SEQ ID NO:3; and the application of the SNP site in breeding of egg-laying duration of Qingyuan chicken; the present application adopts whole genome resequencing technology, can accurately determine the genotypes of all SNP sites, thereby improving the accuracy and reliability of research results; compared with existing conventional SNP chip and PCR-RFLP methods, the present application has the advantages of convenient operation, short time, high sensitivity and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological breeding, and particularly relates to SNP sites related to egg laying persistence of Qingyuan chicken and application thereof. BACKGROUND

[0002] Qingyuan chicken is a famous native yellow-feathered broiler breed in China, which is famous for its attractive appearance and delicious meat. In the breeding plan of chickens, egg laying traits are one of the main focuses. Egg laying persistence is an important factor that determines the number of eggs, even if the total number of eggs is the same, hens will also show different persistence. This trait is similar to the lactation persistence of cows, which can be estimated by fitting the egg laying curve based on the Wood model. Egg laying persistence is a low heritability trait, and after searching, there is no related report on SNP molecular markers of egg laying persistence of Qingyuan chicken.

[0003] Genome-wide association study (GWAS) has been proven to be a powerful tool for studying the genetic basis of various traits. GWAS uses linkage disequilibrium between markers and causal mutations to detect QTL, and its efficiency increases with the increase of marker density. Traditional GWAS is based on single nucleotide polymorphism (SNP) chip data. However, using whole genome sequencing technology can detect a much larger number of genetic variants that may contain causal mutations. Therefore, GWAS based on whole genome sequencing data is more efficient in identifying QTL, and is increasingly used due to the reduction in cost.

[0004] In the present application, blood samples of 287 Qingyuan chickens were collected, and after DNA extraction, quality detection was performed, then whole genome resequencing was performed, and the egg laying persistence of individuals was estimated based on the Wood model, finally SNP molecular markers of egg laying persistence of Qingyuan chicken were screened out through GWAS analysis, which can provide new resources for the breeding and related research of chicken egg laying persistence traits in the future. SUMMARY

[0005] The purpose of the present application is to overcome the shortcomings of the prior art and provide SNP sites related to egg laying persistence of Qingyuan chicken and application thereof.

[0006] The purpose of the present application is achieved by the following technical solution: the SNP site related to egg laying persistence of Qingyuan chicken is a G / C mutation at position 251 in the sequence described in SEQ ID NO: 1; or a C / T mutation at position 201 in the sequence described in SEQ ID NO: 2; or a G / A mutation at position 251 in the sequence described in SEQ ID NO: 3.

[0007] The SNP site is applied in the selection and breeding of the Qingyuan chicken with high egg production and egg laying duration.

[0008] A method for breeding the Qingyuan chicken with high egg production and egg laying duration, taking the G / C mutation site at the 251st position in the sequence shown in SEQ ID NO: 1 as the SNP site, designing a primer pair, amplifying and identifying the genotype of the Qingyuan chicken, and screening the Qingyuan chicken with the genotype of GG.

[0009] Or taking the C / T mutation SNP site at the 201st position in the sequence shown in SEQ ID NO: 2 as the SNP site, designing a primer pair, amplifying and identifying the genotype of the Qingyuan chicken, and screening the Qingyuan chicken with the genotype of CT.

[0010] Or taking the G / A mutation SNP site at the 251st position in the sequence shown in SEQ ID NO: 3 as the SNP site, designing a primer pair, amplifying and identifying the genotype of the Qingyuan chicken, and screening the Qingyuan chicken with the genotype of GG.

[0011] Further, the primer pair sequence for amplifying the sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 4-5, the primer pair sequence for amplifying the sequence shown in SEQ ID NO: 2 is shown in SEQ ID NO: 6-7, and the primer pair sequence for amplifying the sequence shown in SEQ ID NO: 3 is shown in SEQ ID NO: 8-9.

[0012] The present application has the following advantages:

[0013] (1) In the present application, blood is collected from 287 Qingyuan chickens, and DNA is extracted and quality detection is performed. The DNA that passes the detection is subjected to whole genome resequencing with an average sequencing depth of 5x, and data analysis is performed. The egg laying duration of each chicken is estimated based on the Wood model. The SNP molecular marker related to the egg laying duration of the Qingyuan chicken is screened by using the GEMMA software. The correlation between the screened SNP molecular marker and the egg laying duration of the Qingyuan chicken reaches the chromosome significant level. The present application provides a new molecular marker for subsequent research on egg laying traits, and has important significance for improving the breeding and reproduction efficiency of the Qingyuan chicken.

[0014] (2) In the present application, the genotypes of the Qingyuan chicken are detected by using the whole genome resequencing technology, which is suitable for detecting and analyzing the egg laying duration of the Qingyuan chicken for non-diagnostic purposes. The traditional genome association analysis method mainly relies on limited SNP sites and genotype information, and it is difficult to fully capture the complex genetic variation relationship. In the present application, the whole genome resequencing technology is used to accurately determine all genotypes of the SNP site, thereby improving the accuracy and reliability of the research results. Compared with the existing conventional SNP chip and PCR-RFLP method, the present application has the advantages of convenient operation, short time, high sensitivity, etc. DETAILED DESCRIPTION

[0015] The application will be further described in connection with the following examples, and the scope of protection of the application is not limited to the following description: Example 1: Screening of SNP sites

[0016] The sequence and whole genome association analysis result in the application are based on chicken genome GRCg6a version.

[0017] 1. Genotype data

[0018] Blood was collected from the test animals, Qingyuan chickens, and DNA was extracted. The qualified DNA was sent to Beijing Compass Biotechnology Co., Ltd. for whole genome resequencing (average sequencing depth of 5x) and data analysis. After obtaining the individual SNP genotype, the Beagle software was used for filling to obtain the SNP data set. The PLINK software was used for quality control of the genotype data, and the quality control standards were as follows: individual detection rate ≥ 95%;

[0019] a) SNP detection rate ≥ 95%;

[0020] b) Minimum allele frequency (MAF) ≥ 5%;

[0021] c) Hardy-Weinberg balance P value ≥ 1.0e-6;

[0022] d) Not located on the sex chromosome.

[0023] Finally, a total of 287 individuals and 6,059,941 SNPs were used for further analysis.

[0024] 2. Estimate individual egg laying duration based on Wood model

[0025] The Wood model is as follows:

[0026] y t = at b e -ct ,

[0027] Where y t is the egg laying amount in the tthweek, e is the natural base, a, b, and c are parameters that determine the shape of the curve, and the values are all greater than 0, wherein a is the egg laying potential, b is the speed of the decline of the egg laying amount after the egg laying peak, and c is the speed of the rise of the egg laying amount before the egg laying peak. When fitting, a, b, and c are limited to be greater than 0. The calculation formula of the egg laying duration p is

[0028] p=-(b+1)ln c.

[0029] This study used SAS 9.2 for egg production curve fitting analysis. After obtaining parameter estimates, outliers were removed using the quartile test, and estimates that did not conform to the parameter range defined by the model were also removed. A final fit was achieved for 68 individuals.

[0030] 3. Statistical Analysis

[0031] Before the GWAS analysis, SPSS 20.0 software was used to perform a multivariate analysis of variance on egg production persistence to determine whether cage layer and batch had a significant impact on egg production persistence, and the significant effects were included in the analysis model.

[0032] Unit point correlation analysis based on a mixed linear model was performed on egg production persistence estimated using the Wood model. The model is as follows:

[0033] y = 1μ + Xb + Zg + e,

[0034] Where y represents egg production persistence; μ is the population mean of the phenotypic records; b is the fixed effects vector (including batch, cage, and individual SNP effects), X is the design matrix for fixed effects; g is the vector of individual additive genetic effects, Z is the corresponding design matrix; and e is the residual vector. Assume the variance structure is as follows:

[0035]

[0036]

[0037] in These represent the additive genetic variance and residual variance, respectively; G and I are the genetic relationship matrix (GRM) and identity matrix, respectively.

[0038] In livestock GWAS analysis, due to high linkage disequilibrium between loci, using the total number of loci at the genome level for Bonferroni correction of P-values ​​is overly conservative and may produce false negative results. Therefore, this study used the number of independent markers at the genome level for Bonferroni correction of P-values. The number of independent markers was calculated using the PLINK indep-pairwise command, specifically expressed as: --indep-pairwise<window size> ('kb') <step size><r 2 threshold>. The window size is 25kb, the step size is set to 5, and the LDR used is... 2 Threshold standard (r) 2threshold) was set to 0.2, and finally 1,302,824 independent markers were estimated. Thus, the P-value threshold for the Bonferroni genome-wide 5% significance level was 0.05 / 1,302,824 = 3.84 x 10 -8 , and the P-value threshold for the potential association was 1.0 / 1,302,824 = 7.68 x 10 -7 . The chromosome-wide significant P-value was < 0.05 / N, where N refers to the number of SNP loci in the chromosome.

[0039] The results showed that there were 3 SNP loci significantly associated with egg-laying duration at the chromosome level, as shown in Table 1.

[0040] Table 1. Significant association loci of egg-laying duration (chromosome level)

[0041]

[0042] Note: The P-value of the chromosome-wide significant marker was < 0.05 / N (N refers to the number of SNPs in the chromosome); MAF: minimum allele frequency

[0043] (1) The first SNP locus significantly associated with egg-laying duration at the chromosome level (P < 0.05 / N) was rs731406013, located on chromosome 1, with a variation occurring in the intron of the MKLN1 gene (Table 1). According to related literature reports, the candidate gene MKLN1 (muskelin 1) is involved in cell adhesion, regulation of cytoskeletal dynamics, and regulation of protein transmembrane signal transduction, with the highest expression in mouse skeletal muscle, and may even be related to body size, oocyte maturation, and early embryonic development in pigs. Zhang Jianfeng et al. reported the effect of body size traits on reproductive traits in Chinese local chickens, and found that the longer the tibial length, the greater the average egg weight, the longer the body length, and the more the annual egg production. Therefore, MKLN1 may affect the body size of chickens, and more likely affect egg-laying duration by affecting the reproductive-related process, which is worth further study.

[0044] The nucleotide sequences 250 bp upstream and downstream of the SNP molecular marker rs731406013 are as follows:

[0045] 5'-AGTTTGGTGGGTTCATAAGCTCCCTCTGACATTCCCTTCCTTAAGTAACACTGCAACGACATAGCAAGAGCCAGCCACAGCCCCCACTGCTCTTTCCTCCTACAACCCTCACGTACTCTTAGATTCAGCAGGAAGTTGCCAGTTGAAGAATGCCTCTGCATTGCAGGAATCTGTTTACACTCCCTTCCAAGCCAACACCACCACTACGTCTCAGGAGGACAAGCAGCACTCAGAAGGACAAGGATGAACA S AGGCTCTTCTCAGGCTCAATGCTTGTAGCTGCTCAGGGAGTTTGGCACACGGCAGTTGAGCTGTTCTGCTTATATAGTTCACAAGACTTCTGTCAAAACTCACAGAAAGCCATTTACTGCATTTTTTGACAGCCTGTTGCAATAAACTCCCTAAAATTGTGCTCTGTTGAACAGCTTCCTCATGAAAGCATTGTGATTTTCATGGAAGACAAATGTGGATTTTAAACCTATTATCTCTACCATATCCTAA-3' SEQ ID NO: 1

[0046] Wherein, S is allele, G / C.

[0047] The base S at the 251st base in the nucleotide sequence of 250bp upstream and downstream of the SNP molecular marker is replaced by G or C, which causes the nucleotide polymorphism of the sequence. The individual with genotype GG has advantage over the individuals with genotype GC and CC, as shown in Table 2.

[0048] Table 2: Egg laying duration of individuals with different genotypes of rs7314060 13th site

[0049]

[0050] The primer of the SNP site is designed by using Primer5, including upstream primer and downstream primer:

[0051] Upstream primer F1: 5'-TGCTCTTTCCTCCTACAACCCTC-3' SEQ ID NO: 4

[0052] Downstream primer R1: 5'-GCAGTAAATGGCTTTCTGTGAGT-3' SEQ ID NO: 5

[0053] (2) The second SNP locus that was significantly associated with persistent egg production at the chromosome level (P<0.05 / N) was rs16200949, located on chromosome 26, with a variation distance of 1008 bp from the RBBP5 gene (see Table 1). According to relevant literature reports, its candidate gene RBBP5 (RBbinding protein 5) may be involved in signal transduction, vesicle transport, cytoskeleton assembly, cell cycle regulation, apoptosis, chromatin dynamics, and transcriptional regulation, and may also be involved in complex interaction mechanisms in the formation of chicken primordial germ cells.

[0054] The nucleotide sequences 200 bp upstream and downstream of the SNP molecular marker rs16200949 are as follows:

[0055] 5'-TCCCTACGAGGACGTAAACACCTCCCTGACTTGTGCAAAGAAAGCTTGAGTCCACAATCCTAGGGCTGAGCTGCCCTTGGAGTAGGACAGAGCTCCAGGA-GGGGGGTTATGGTGTGGGGTGCCATCCCCACGGGTGGCAGTGGTTACAGGTAGGGGGATCTTTTTAATACAGTTCCTTTTAATACCGTTCCTATTAGTCT Y GGTCACCTTACTCTGAAAAGACATTTTAAATAAACTACGTGAAAGCTCTCCTCTCAGGAAGAACTCCATACTCCATGGGGAGAAGTGCAGAGAAAGCAGTGCAAAGTTAGGGAAAACCTGCTGAGCTGTGATGCTGCACATGCAAGAAAACAGAGCAAATGGAAACGAGACAAAGGAAAAGGCAGCAGAGGAGTGTCT-3'

[0056] SEQ ID NO: 2

[0057] Where Y is an allele and is T / C.

[0058] A base substitution at position 201 (G or T) in the nucleotide sequence 200 bp upstream and downstream of the SNP molecular marker causes nucleotide polymorphism in the sequence shown. Individuals with genotype CT have an advantage over individuals with genotypes TT and CC, as shown in Table 3.

[0059] Table 3. Egg production persistence of individuals with different genotypes at the rs16200949 locus

[0060]

[0061] The primers of the SNP site were designed using Primer5, including upstream primers and downstream primers:

[0062] Upstream primer F1: 5'-CCACAGGTGGCAGTGGTTACAG-3' SEQ ID NO: 6

[0063] Downstream primer R1: 5'-GCATCACAGCTCAGCAGGTTTT-3' SEQ ID NO: 7

[0064] (3) The third SNP site significantly associated with egg production persistence at the chromosome level (P < 0.05 / N) was rs431900504, located on chromosome 19, and the variation occurred in the intron of the TAOK1 gene. According to the relevant literature reports, the candidate gene TAOK1 (Thousand and one amino acid protein kinase l serine threonine protein kinase l) is involved in regulating the MAPK and Hippo signaling pathways to affect the development of oocytes and the maturation process, and may affect lambing performance.

[0065] The nucleotide sequences 250 bp upstream and downstream of the SNP molecular marker rs431900504 are as follows:

[0066] 5'-TGGCAGAATTAAAATAGGACTGAAAACCACTTTTACAAAAGGCAGAGTGCTGACATTTCATTAATCTGTGTTCTGATAGGCTCTGATAGTACAAATACATTAAAAAATCAGCTTTTCCATCAGTCATCAGTGACTGCAGGCATGCATATTATTTTGATTTGTATCGTTTGGCTTCATATCCCAATTAACTGTGCTGCTCTGAGACACCCCCCCACCCCTGTGCCATGGTGTCCTTAGCACAGGCAGGTGG RGCCTTGTTTGGCCTTCATCCCTGCTGGTTGCAGGCTCACTGTAAGGTGCACGGGCCGCTGCTGTGTGCCAATTTAAACAAAACTTGTCTTATCTTGAAATGCTACTGTCTGAAATCAGGACGTCTGCCTTTGAAGTGTGAAAAACCACGCAGGCTTATTTTGCAATGTAAACAGCAACGTTATTGGGCTGAGCAAATGGCAGTCTGAGCTAGCACCTGGGAGTGGATGGCCGCGTGCTGCCATCTCTATA-3' SEQ ID NO: 3 wherein R is allele, G / A.

[0067] The SNP molecular marker is located at the 251st base S in the nucleotide sequence of 250bp upstream and downstream, and the base substitution of G or A causes the nucleotide polymorphism of the sequence. The individual with genotype GG has advantage over the individual with genotype GA and AA, as shown in Table 4.

[0068] Table 4: Egg laying duration of individuals with different genotypes of rs4319005 04 locus

[0069]

[0070] The primer of the SNP locus is designed by using Primer 5, including upstream primer and downstream primer:

[0071] Upstream primer F1: 5'-ACTGTGCTGCTCTGAGACACCC-3' SEQ ID NO: 8

[0072] Downstream primer R1: 5'-CATTTGCTCAGCCCAATAACGT-3' SEQ ID NO: 9

[0073] The above merely describes the preferred specific embodiments of the present application, but the protection scope of the present application is not limited thereto, and any person skilled in the art can make equivalent substitution or change according to the technical solution and the inventive concept of the present application within the technical range disclosed by the present application, which is also covered by the protection scope of the present application.

Claims

1. The application of SNP molecular markers in the continuous breeding of egg production in Qingyuan Ma chickens, characterized by: The SNP molecular marker is the G / C mutation at position 251 in the sequence shown in SEQ ID NO: 1; or the C / T mutation at position 201 in the sequence shown in SEQ ID NO: 2; or the G / A mutation at position 251 in the sequence shown in SEQ ID NO:

3.

2. A method for breeding high-producing, continuously laying Qingyuan Ma chickens, characterized in that, Using the G / C mutation site at position 251 in the sequence shown in SEQ ID NO: 1 as the SNP site, primer pairs were designed to amplify and identify the genotype of Qingyuan Ma chicken, and Qingyuan Ma chickens with the genotype GG were screened. Alternatively, primer pairs can be designed using the C / T mutation SNP site at position 201 in the sequence shown in SEQ ID NO: 2, to amplify and identify the genotype of Qingyuan Ma chickens, and screen for Qingyuan Ma chickens with the CT genotype. Alternatively, primer pairs can be designed using the G / A mutation SNP site at position 251 in the sequence shown in SEQ ID NO: 3 to amplify and identify the genotype of Qingyuan Ma chickens, and screen for Qingyuan Ma chickens with the genotype GG.

3. The method for breeding high-producing, continuously laying Qingyuan Ma chickens as described in claim 2, characterized in that, The primer pair sequences for amplifying the sequence described in SEQ ID NO: 1 are shown in SEQ ID NO: 4-5; the primer pair sequences for amplifying the sequence described in SEQ ID NO: 2 are shown in SEQ ID NO: 6-7; and the primer pair sequences for amplifying the sequence described in SEQ ID NO: 3 are shown in SEQ ID NO: 8-9.

Images