A paper-based microfluidic chip and a manufacturing method and a using method thereof
By designing a paper-based microfluidic chip with a stepped structure and flow channels to control liquid flow, the problem of difficult liquid flow control in existing technologies has been solved, realizing automated and low-cost nucleic acid amplification and CRISPR/Cas detection, which is suitable for the POCT field.
Patent Information
- Application Number
- CN202310321459.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-29
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2043-03-29
AI Technical Summary
Existing paper-based microfluidic chips cannot effectively control liquid flow, resulting in delayed detection results and requiring specialized equipment and operation, which cannot meet the application requirements of the POCT field, especially in detection schemes that combine nucleic acid amplification and CRISPR/Cas gene editing technologies.
A disposable paper-based microfluidic chip was designed, which adopts a stepped structure, hydrophobic walls and flow channels. Combined with a delay valve drawn with tape and marker, it realizes automated flow control of liquid in the chip and integrates lyophilized reagents to simplify the operation process.
It enables automated detection of trace samples, lowers the detection threshold and cost, is suitable for underdeveloped areas and home environments, improves detection sensitivity and accuracy, and meets the application needs of the POCT field.
Smart Images

Figure CN117046530B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of paper-based microfluidic chip, and in particular, relates to a paper-based microfluidic chip for combining constant temperature amplification and CRISPR / Cas gene editing technology, and a manufacturing method and use method thereof. BACKGROUND
[0002] Paper-based microfluidic chip was first proposed in 2007, which is a kind of microfluidic chip using the hydrophilic fibers of paper itself to provide fluid driving force, characterized by making patterned hydrophobic walls or flow channels on paper to control the flow direction of liquid. Since the liquid in the chip is completely driven by the capillary action of the paper fibers itself, the flow of the liquid in the chip does not require a complex external driving source. At the same time, using paper has obvious advantages of low manufacturing and use cost, one-time use, and small environmental pollution compared to plastic, glass and other substrates. In addition, the paper fiber structure also has the characteristics of high specific surface area, which is suitable for micro-sample reaction and detection. After the reagent is packaged on the paper, multiple sample addition operations can be omitted, and hierarchical reactions in different regions can be realized.
[0003] The most common paper-based microfluidic product at present is a lateral chromatographic test paper. Test paper products are widely used in clinical detection. Common detection products include early pregnancy test paper, blood glucose test paper, AIDS test paper, etc. However, such products have the defect that the flow of liquid in the paper cannot be controlled. When the reaction requires a certain incubation time, the operator needs to first configure the reagent in a test tube and perform a period of reaction, then insert the test paper strip, and then read the result. For example, the colloidal gold test paper used in patent CN113156124A limits its application scenarios and range.
[0004] The preparation of patterned hydrophobic walls / flow channels and valves that can control the flow of liquid on the paper-based microfluidic chip can solve the problem that the test paper cannot control the movement of liquid. There are mainly three methods for preparing hydrophobic walls. The first method is to directly use mechanical processing to process the chip into a flow channel shape. The second method is to use photoetching, printing, screen printing and other patterned processing methods to coat common hydrophobic materials such as paraffin and polylactic acid on the paper chip to form corresponding flow channels. The third method is to first hydrophobize the paper chip as a whole using a hydrophobic material, and then use corona, add a surfactant, Plasma treatment and other methods to make a hydrophilic flow channel. The most commonly used method for making patterned hydrophobic walls and hydrophilic flow channels is to use a ColorQube series of wax jet printers, which can directly print wax hydrophobic walls on the paper chip by designing patterns on the computer. For example, patent CN111879922A uses wax-based ink to print the paper chip. However, the equipment has been completely discontinued, and no alternative equipment can be found.
[0005] There are two types of flow control valves on paper chips at present, namely active and passive valves. Active valves include mechanical switch valves, magnetic drive valves, electrowetting valves, light response valves, temperature response valves, etc. They need external electric / magnetic / light energy to drive and control the opening and closing of the paper channel. Their advantage is that the opening time and on-off state of the valve can be adjusted at will. However, such chips often require complex driving and control devices, making the entire chip device large and complex. Passive valves slow down the movement of liquid in the paper fibers to achieve a time delay effect. Since the movement of liquid in the paper is mainly dependent on the capillary action generated by the paper fibers and the pores formed by the interlaced fibers, the common methods are to add hydrophobic materials such as paraffin, sucrose, polylactic acid, etc. to block the pores in the paper fibers, or directly use pressing process to change the fiber structure and pore size of the paper. Its advantage is that it does not require complex external equipment, and the production and use cost is low, which is suitable for POCT and other portable scenarios. However, its disadvantage is that the delay time is fixed, and the liquid cannot restore to the movement speed before the delay after passing through the delay area. At the same time, the delay area changes the pore structure of the paper, which may cause more reaction products to be adsorbed, so that the products cannot move with the liquid to the next reaction area. In addition, the precision of passive valve delay time is also worse than that of active valve.
[0006] Nucleic acid amplification detection and antigen-antibody detection are two mainstream detection methods widely used, but both methods have defects. Nucleic acid detection has false positive and false negative problems, and it needs professional instruments and operators, with high detection cost and threshold. Antigen-antibody detection is low in cost and suitable for family self-test, and there are many family self-test products based on antigen-antibody method at present, but the detection result has lag, which cannot meet the demand of precise epidemic prevention.
[0007] Since 2018, the detection scheme based on the combination of recombinant polymerase amplification technology and CRISPR / Cas12a system gene editing technology has been used in the clinical detection of infectious diseases such as HPV, dengue fever, African swine fever, etc. Compared with the amplification technology, the method has the advantages that the use of CRIPSR / Cas technology can specifically recognize and cut the target gene and reporter molecule of the amplicon and produce a fluorescence signal, thereby improving the sensitivity and accuracy of the detection, and the incubation temperature of both levels of reaction is about 37℃, thereby avoiding the complex temperature control between multiple reactions and different reaction areas. In order to expand the application scenarios and facilitate transportation, the reagents of the detection scheme have been developed and simplified into the form of a kit, but still need to be reacted and incubated in a test tube, such as patents CN108929918B, CN110106290B, CN113234856A, etc. At the same time, mutant detection kits for various mutant strains of the new coronavirus are also developed separately, such as CN113403424A, CN113817873A, CN113881806A. The above-mentioned patent technical solutions still require related operating personnel and equipment, and cannot meet the application requirements of the POCT field like test paper products. At present, the detection equipment patents for this type of detection scheme are digital microfluidic products CN211367579U and CN110885877A. The cost of the digital microfluidic chip is high, it needs complex peripheral driving equipment, and the reagent still needs to be configured and added by the operating personnel, which cannot meet the demand of on-site detection. SUMMARY
[0008] In order to solve the above problems, the purpose of the present application is to provide a paper-based microfluidic chip and a manufacturing method and a use method thereof, which can pre-embed a new coronavirus detection system for detecting the new coronavirus. The paper-based microfluidic chip of the present application does not require professional processing and operating equipment, can reduce the production cost and requirements, and simplify the operation of the operating personnel and reduce the detection threshold, so that the chip can be used in underdeveloped areas and families and other environments without professional equipment and personnel conditions.
[0009] According to one aspect, the present application provides a disposable paper-based microfluidic chip, which comprises, from bottom to top, a substrate layer, a flow layer and a sealing layer,
[0010] The substrate layer is used as a support and a sealing bottom, and in particular, there is a stepped structure on the substrate layer. The purpose of the stepped structure is to raise the part of the flow layer in front of the stepped structure. The height of the amplification area paper will make the liquid in the flow channel unable to continue to flow forward. After the use of the stepped structure to raise the liquid of the flow layer, the liquid can flow from the high part of the stepped structure to the paper sheet and then continue to flow to the low part of the flow channel. Therefore, the stepped structure is arranged in front of the position where the paper chip places the amplification reagent paper sheet,
[0011] In the disposable paper-based microfluidic chip of the present application, preferably, adhesive tape material is used as the base layer and a corresponding step structure is made by using the height difference of different adhesive tape materials, including Bostik traceless waterproof adhesive tape and 3M Scotch 3850 series adhesive tape.
[0012] The flow layer is used to provide a channel for liquid flow in the chip and control the flow condition of the liquid in the chip. The flow layer is sequentially divided into a sample adding area, a delay area, an amplification area, a cutoff area and a shearing area in the flow order. The flow layer comprises a base material, a paper sheet pre-embedded with amplification reagent freeze-dried powder and a paper sheet pre-embedded with shearing reagent freeze-dried powder. The amplification area and the shearing area are respectively arranged with the paper sheet pre-embedded with amplification reagent freeze-dried powder and the paper sheet pre-embedded with shearing reagent freeze-dried powder. The sample adding area receives and stores sample adding liquid. The liquid receiving area of the sample adding area needs to be larger than the bottom area of the liquid droplet formed by the sample adding liquid. The delay area is used to slow down the movement speed of the liquid flowing from the sample adding area, so that the sample adding liquid reaches the next area after a pre-set time. The amplification area receives a nucleic acid sample to amplify the nucleic acid in the sample. Meanwhile, the amplification area has a square pool structure capable of accommodating the paper sheet pre-embedded with amplification reagent freeze-dried powder. The cutoff area is used to cut off the liquid flow from the amplification area to the next area until the liquid in the delay area reaches the amplification area. The shearing area is used to specifically shear the nucleic acid sample flowing from the amplification area and release a fluorescence signal to display the detection result. The sample adding area, the delay area, the amplification area, the cutoff area and the shearing area are connected by flow channels. The liquid moves from the reagent sample adding area to the last shearing area in sequence through the flow channels.
[0013] In the disposable paper-based microfluidic chip of the present application, preferably, the base material of the flow layer comprises a paper product, hydrophobic ink materials containing an adhesive component used to form hydrophobic walls in the parallel direction of the paper product with the movement direction of the liquid in the flow channel, a flow channel area formed in the middle of the two hydrophobic walls, hydrophobic ink materials not containing an adhesive component used in the delay area in the flow channel area, and packaging adhesive tape material applied to the base layer (preferably, the packaging adhesive tape material is applied to the flow layer in whole or in part, and more preferably, the packaging adhesive tape material is not applied to the part where the delay area and the amplification area overlap).
[0014] Preferably, the paper product comprises Kimtech KimWipes series paper, Whatman Grade series test paper and Whatman GF series filter paper.
[0015] Preferably, the hydrophobic ink material used to form the hydrophobic wall comprises an ink material containing an adhesive component used in Sharipie metal color marker pen.
[0016] Preferably, the hydrophobic ink material used to form the flow channel delay zone comprises an ink material without adhesive component, such as that used in a Sharpie ultra-fine marker.
[0017] Preferably, the encapsulation tape material comprises a 3M Scotch 3850 series tape.
[0018] In the disposable paper-based microfluidic chip of the present application, preferably, the sample loading zone, the delay zone, the amplification zone, the cutoff zone and the shearing zone are connected by rectangular flow channels, and liquid can move from the reagent sample loading zone to the last shearing zone in sequence through the flow channels. The flow channel of the amplification zone is a paper channel without hydrophobic wall in the middle. The position where the flow channel is disconnected on the flow layer base material is filled with a paper sheet with pre-embedded lyophilized powder to continue the flow of liquid, and at the same time, it can also ensure that there is no large height difference between the base layer and the sealing layer, thereby affecting the sealing of the chip.
[0019] In the disposable paper-based microfluidic chip of the present application, preferably, the delay zone and the cutoff zone are obtained by drawing a delay valve in the flow channel area using a marker to obtain a delay time. Preferably, the marker used to draw the delay valve is a marker using a hydrophobic ink material without adhesive component, such as a Sharpie ultra-fine marker.
[0020] The principle of the delay valve of the delay zone is that when the fluid in front of the delay valve has sufficient volume, the liquid in the flow channel will slowly enter the delay valve area to realize the function of delayed flow of liquid, and the delay time is positively correlated with the length of the delay valve.
[0021] The principle of the cutoff valve of the cutoff zone is that the fluid directly sampled in front of the cutoff zone does not have sufficient volume to generate sufficient pressure to force the liquid to enter the delay valve. At this time, regardless of the length of the delay valve, it will play a role in stopping the movement of liquid. At this time, the delay valve plays a role in stopping, and when the liquid in the delay zone flows to the cutoff zone, the excess liquid can generate sufficient pressure to force the liquid to enter the delay valve area. At this time, the delay valve is opened to allow the liquid to flow through the cutoff zone into the subsequent shearing area. In order to be described separately from the delay valve of the delay zone, the delay valve of the cutoff zone is called a cutoff valve.
[0022] Preferably, the drawing length of the delay valve of the delay zone can be determined by the required delay time, and the length of the cutoff valve of the cutoff zone can be 0.5-2 mm.
[0023] Preferably, the marker used to draw the delay valve is a marker using an ink without adhesive component, such as a Sharpie ultra-fine marker.
[0024] The sealing layer serves as a sealing top, and a sample adding hole region for adding the nucleic acid sample to the amplification zone and a sample adding hole region for adding the sample adding liquid to the sample adding zone are arranged on the sealing layer.
[0025] Preferably, the disposable paper-based microfluidic chip of the present application uses a reagent including a novel coronavirus detection system combining a recombinant polymerase amplification technology and a CRISPR / Cas12a system-based gene editing technology.
[0026] In one embodiment, the amplification zone and the shearing zone are respectively provided with a paper sheet (for example, a square paper sheet) pre-embedded with amplification reagent freeze-dried powder and a paper sheet (for example, a square paper sheet) pre-embedded with shearing reagent freeze-dried powder. The amplification zone is a single paper sheet (for example, a square paper sheet with a side length of 5 mm), and the paper sheet can be placed to connect both ends of the intermediate broken paper channel. The shearing zone is a single paper sheet (for example, a square paper sheet with a side length of 10 mm). The side length of the amplification zone paper sheet is 5 mm to ensure that the reaction volume of the amplification zone is 25 μL. The side length of the paper sheet placed in the shearing zone is 10 mm to ensure that the reaction volume of the shearing zone is 20 μL.
[0027] According to another aspect of the present application, the present application provides a preparation method of the above-mentioned paper-based microfluidic chip, comprising the following steps:
[0028] S1, using plastic tape as the base layer and the sealing layer, the sealing layer is provided with a circular sample adding hole at the center position of the sample adding zone and the amplification zone of the flow layer, the base layer and the sealing layer are first cut into the corresponding shape by scissors or other die-cutting equipment, and then a through hole is processed on the corresponding position by a punch or other punching equipment. There is a step structure made of tapes with different thicknesses on the base layer, which is located at the junction of the amplification zone and the delay zone of the flow layer;
[0029] S2, a hydrophobic wall is drawn on the paper base material pasted with the tape at the bottom of the flow layer to obtain a flow channel of the flow layer, so as to control the direction of liquid flow;
[0030] S3, a paper sheet pre-embedded with shearing reagent freeze-dried powder is placed at the end of the cutoff zone and connected with the flow channel, and a paper sheet pre-embedded with amplification reagent freeze-dried powder is placed in the square pool structure of the amplification zone, and the flow channel of the delay zone is located above the paper sheet, and the flow channel of the cutoff zone is located below the paper sheet;
[0031] S4, after the base layer, the flow layer and the sealing layer are respectively manufactured, they are aligned in position and then bonded.
[0032] Preferably, in S1, plastic tapes such as 3M 3036 packaging tape, 3M Scotch 3850-60 tape, 3M Scotch Magic tape, etc. can be used.
[0033] Preferably, in S1, the size of the sample well is 1-4 mm, more preferably 2 mm.
[0034] Preferably, in S1, the height of the step structure is 0.5-2 mm, more preferably 1 mm.
[0035] Preferably, in S1, the sample area is a square area with a side length of 20-50 mm, more preferably a side length of 30 mm.
[0036] Preferably, in S2, the flow layer substrate material comprises a paper product, hydrophobic walls formed by using a hydrophobic ink material containing an adhesive component on both sides of the paper product in a direction parallel to the direction of liquid movement in the flow channel, a flow channel area formed in the middle of the two hydrophobic walls, a delay area using a hydrophobic ink material not containing an adhesive component in the flow channel area, and a packaging tape material applied to the substrate layer (preferably, the packaging tape material is applied to the flow layer in whole or in part, more preferably, the packaging tape material is not applied to the part where the delay area and the amplification area overlap), preferably, the paper product comprises Kimtech KimWipes series paper, Whatman Grade series test paper, Whatman GF series filter paper, the hydrophobic ink material used to form the hydrophobic wall comprises an ink containing an adhesive component used by a Sharipie metal color marker pen, the hydrophobic ink material not containing an adhesive component comprises an ink not containing an adhesive component used by a Sharipie ultra-fine marker pen, and the packaging tape material comprises a 3M Scotch 3850 series tape.
[0037] Preferably, in S2, when the pattern is relatively simple, it can be drawn manually using a compass and ruler, and when the pattern is relatively complex, it can be drawn using a plotter after designing the pattern on a computer.
[0038] Preferably, in S2, the hydrophobic wall can be drawn using a marker pen containing a hydrophobic ink material containing an adhesive component, such as a Dali ink double-head marker pen, a Sharipie metal color marker pen, etc.
[0039] Preferably, in S2, the delay area can be drawn using a marker pen containing a hydrophobic ink material not containing an adhesive component, such as an ink not containing an adhesive component used by a Sharipie ultra-fine marker pen, the width of the delay area is about 3-6 mm, the length of the flow channel between each area is about 5-10 mm, and the length of the delay area can be determined by the length of the desired delay valve.
[0040] In one embodiment, the paper sheet pre-embedded with the shearing reagent lyophilized powder is prepared by the following method: the paper sheet is first soaked with 1-5% BSA protein solution for at least 1 h, then washed with RNase water and dried in a blast oven for at least 4 h, then 5 μL of shearing reagent is added respectively and dried using a freeze dryer, so that the reagent is evenly distributed on the surface and inside the paper sheet in the form of lyophilized powder, wherein the shearing reagent includes LbCas12a protein, RNase inhibitor, crRNA, NEB buffer 3.0 and fluorescent reporter single-stranded DNA molecule.
[0041] Preferably, the pre-embedded shearing reagent paper sheet is a single sheet of 10 mm side length, which is first soaked with 5% BSA protein solution for at least 1 h, then washed with RNase water and dried in a blast oven at 50°C for at least 4 h for standby. After drying, the paper sheet is taken out, 1 μL of 1 μM LbCas12a protein, 100 nM crRNA, 0.5 μL of RNase inhibitor, 2 μL of 10×NEBuffer 3.0, 500 nM FAM-BHQ1-labeled ssDNA reporter are added in a centrifugal tube and mixed, then added dropwise on the 12 mm paper sheet. The FAM-BHQ1-labeled ssDNA reporter is synthesized by Thermo Fisher Company. After the reagent is added dropwise, the petri dish is sealed and stored in a -80°C refrigerator (at least 12 h) in the dark, and then dried using a freeze dryer at -50°C for at least 4 h. After lyophilization, it is taken out and stored in a refrigerator at -20°C. When needed, it is taken out again.
[0042] In one embodiment, the paper sheet pre-embedded with the amplification reagent lyophilized powder is prepared by the following method: the paper sheet is first soaked with 1-5% BSA protein solution for at least 1 h, then washed with RNase water and dried in a blast oven for at least 4 h, then 2.5 μL of RDA mix amplification reagent is added, and dried using a freeze dryer, so that the amplification reagent is evenly distributed on the surface and inside the paper sheet in the form of lyophilized powder. The remaining reagents in the RDA amplification system can be lyophilized in the chip amplification area, or added to the detection sample according to the system ratio for direct addition.
[0043] Preferably, the side length of the amplification area paper sheet is 5 mm to ensure that the reaction volume of the amplification area is 25 μL. The paper sheet placed in the shearing area has a side length of 10 mm to ensure that the reaction volume of the shearing area is 20 μL.
[0044] In another aspect, the present application provides a method for using the disposable paper-based microfluidic chip of the present application, comprising the following steps:
[0045] According to the chip design provided by the application, the application provides a corresponding operation process, which is suitable for a detection scheme requiring two-stage reactions and can be adjusted according to the incubation time of the first-stage reaction.
[0046] The operation process is as follows:
[0047] 1) Add the prepared nucleic acid sample (9.25 μL) and primers (2 μL), RDA buffer (11.25 μL) and ddH2O (2.5 μL) to the sample addition hole of the amplification area, and seal the sample addition hole with a PCR sealing film, wherein the nucleic acid sample to be detected can be a nucleic acid extracted from a clinical sample, or a sample processed by a sample processing method in other nucleic acid detection means, or an artificially synthesized nucleic acid fragment containing a target point such as a plasmid;
[0048] 2) Add 300 μL of RNase water containing 0.1% Tween-20 to the sample addition hole of the sample addition area;
[0049] 3) Put the chip as a whole into a constant temperature incubator and incubate at 37°C for 1.5 h, at this time, the nucleic acid sample will be incubated and amplified on the paper sheet pre-embedded with freeze-dried amplification reagents in the amplification area for about 30 min, and the sample liquid will be restricted by the flow valves at both ends and cannot diffuse to the two side areas;
[0050] 4) The RNase water containing 0.1% Tween-20 in the sample addition area will flow to the delay area and flow to the amplification area after about 30-40 min, and the liquid reaching the amplification area will drive the original sample liquid in the amplification area to break through the cutoff valve of the cutoff area and reach the shearing area;
[0051] 5) After the sample is amplified, it flows to the shearing area and incubates for 40 min to complete the shearing reaction;
[0052] 6) Take out the chip, and take a photo or read the fluorescent signal on the paper sheet in the shearing area under a fluorescence microscope or other fluorescent signal reading equipment.
[0053] Beneficial results
[0054] The detection chip according to the application has the following advantages:
[0055] 1) Micro-sample detection can be realized, and the typical sample detection amount is 35 μL, which is beneficial to save detection reagents, and a micro-sample can also be detected to obtain a result, and has the advantages of low detection limit and high sensitivity.
[0056] 2) The entire detection reaction process is automated, and all the required detection reagents are pre-embedded in the chip in the form of freeze-dried powder, so that only one sample addition operation is required to complete the entire detection reaction process, which simplifies the operation process of the operator and does not require human intervention in the intermediate process, and has low requirements for the operation level of the personnel.
[0057] 3) The detection chip according to the present application is disposable, and does not need to be cleaned after use, and has low manufacturing cost and simple process, and is suitable for large-scale detection.
[0058] 4) The chip and the detection scheme provided by the present application greatly shorten the liquid movement distance between the two reaction regions, can avoid the adsorption and volume loss of the sample to be detected on the paper during flow, and correspondingly improve the final detection sensitivity and detection capacity of the chip. BRIEF DESCRIPTION OF DRAWINGS
[0059] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiments or the prior art description will be briefly introduced as follows. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can obtain other drawings according to these drawings without creative labor.
[0060] Figure 1 It is a structure schematic diagram of a disposable paper-based microfluidic new coronavirus detection chip according to the present application.
[0061] Figure 2 It is a flow layer structure and region setting schematic diagram of the detection chip according to the present application.
[0062] Figure 3 It is a gray-scale fluorescence image detection result according to an embodiment of the present application.
[0063] Figure 4 It is a fluorescence intensity numerical value result of a gray-scale fluorescence image according to an embodiment of the present application.
[0064] Explanation of reference signs:
[0065] 1 base layer; 20 flow layer; 21 sample adding area; 22 delay area; 23 amplification area; 24 cutoff area; 25 shearing area; 26 flow layer amplification area pool wall; 27 flow layer amplification area paper sheet; 31, 32 sealing layer. DETAILED DESCRIPTION
[0066] The purpose of the present application is to provide a paper-based microfluidic new coronavirus detection chip and a preparation and detection method thereof. In order to make the purpose, technical scheme and effect of the present application more clear and explicit, the present application will be further described in detail.
[0067] Hereinafter, preferred embodiments of the present disclosure will be described in detail with reference to the accompanying drawings. Before the description, it should be understood that the term used in the specification and the appended claims should not be construed as limited to general and dictionary meanings, but interpreted based on the meanings and concepts underlying the technical principles of the present application presented in the present application. Therefore, the description herein is just a preferred example for the purpose of illustrations only, and not intended to limit the scope of the application, and it should be understood that other equivalents and modifications could be made thereto without departing from the spirit and scope of the application.
[0068] For the sake of clarifying the present application, portions unrelated to the description are omitted in the accompanying drawings, and throughout the specification, the same or similar components are designated by the same reference numerals.
[0069] In addition, the size and thickness of each component shown in the drawings are arbitrarily shown for the sake of explanation, and thus the present application is not necessarily limited to those shown in the drawings.
[0070] Throughout the specification, when it is referred to that one element is "connected" to another element, it includes not only "direct connection" but also "indirect connection" between other components. In addition, when it is referred to that one element "includes" a certain component, it means that the element can further include other components rather than excluding other components, unless explicitly described to the contrary.
[0071] Also, the terms used herein are merely used to explain exemplary embodiments, and are not intended to limit the present application. Singular expressions also include their plural expressions unless explicitly described otherwise in the context. The terms such as "comprise", "comprise", or "have" used herein are used to designate the presence of a stated property, number, step, constituent element, or a combination thereof, and it should be understood that the addition or presence of one or more other properties, numbers, steps, constituent elements, or combinations thereof is not excluded.
[0072] Also, if one layer or one element is referred to as being formed "on" or "above" another layer or element, it means that each layer or element is directly formed on the layer or element, or other layers or elements can be formed between the layers, bodies, or substrates.
[0073] Hereinafter, preferred embodiments of the present disclosure will be described in detail with reference to the accompanying drawings. Before the description, it should be understood that the term used in the specification and the appended claims should not be construed as limited to general and dictionary meanings, but interpreted based on the meanings and concepts underlying the technical principles of the present application presented in the present application. Therefore, the description herein is just a preferred example for the purpose of illustrations only, and not intended to limit the scope of the application, and it should be understood that other equivalents and modifications could be made thereto without departing from the spirit and scope of the application. Figures 1-2The design and manufacturing method of the disposable paper-based microfluidic chip according to the present application is described in detail. The chip comprises a three-layer structure from bottom to top, which is the substrate layer 1 as the substrate of the whole chip, the flow layer 20 including the sample adding area 21, the delay area 22, the amplification area 23 (including the square pool wall structure 26 of the amplification area and the paper sheet 27 of the amplification area), the cutoff area 24, the shear area 25, and the sealing layers 31 and 32. The substrate layer acts as a support and a sealing bottom, and uses adhesive tape material. The sealing layers 31 and 32 act as a sealing top of the chip, and are provided with a sample adding hole area to enable reagents and samples to enter the inside of the chip. The flow layer 20 acts as a channel to provide liquid flow in the chip, and controls the flow condition of the liquid in the chip, such as delay, cutoff, and passing.
[0074] The flow layer 20 is divided into the sample adding area 21, the delay area 22, the amplification area 23, the cutoff area 24, and the shear area 25 in the order of flow from right to left. Figure 2 The sample adding area 21 acts as adding a certain volume of reagents to push the reaction liquid in the subsequent area to flow forward. The delay area 22 acts as delaying the movement speed of the liquid flowing from the sample adding area, so that the liquid reaches the next area after a predetermined time. The amplification area 23 acts as amplifying the nucleic acid sample to improve the sensitivity of detection. The cutoff area 24 acts as cutting off the liquid in the amplification area from flowing to the next area until the liquid in the delay area 23 reaches the amplification area. The shear area 25 acts as specifically shearing the nucleic acid sample flowing from the amplification area, and releasing a fluorescence signal to display the detection result. The sample adding area 21, the delay area 22, the amplification area 23, the cutoff area 24, and the shear area 25 are connected by flow channels, and the liquid moves from the reagent sample adding area to the last shear area in sequence.
[0075] Preferably, the flow layer substrate material comprises a paper product, hydrophobic walls formed by using hydrophobic ink materials containing adhesive components on both sides of the paper product in parallel with the direction of liquid movement in the flow channel, a flow channel region formed between the two hydrophobic walls, a delay zone in the flow channel region formed by using hydrophobic ink materials not containing adhesive components, and a packaging tape material applied to the substrate layer, preferably, the packaging tape material is applied to the flow layer in whole or in part, more preferably, the packaging tape material is not applied to the part where the delay zone and the amplification zone overlap, preferably, the paper product comprises Kimtech KimWipes series paper, Whatman Grade series test paper, Whatman GF series filter paper, the hydrophobic ink materials used to form the hydrophobic walls comprise the ink containing adhesive components used by Sharipie metal color markers, the hydrophobic ink materials used to form the flow channel delay zone comprise the ink not containing adhesive components used by Sharipie ultra-fine markers, and the packaging tape material comprises 3M Scotch 3850 series tape and the like.
[0076] The sample loading zone 21, the delay zone 22, the amplification zone 23, the cutoff zone 24 and the shearing zone 25 are connected by Figure 1 and Figure 2 rectangular flow channels, and liquid can move from the sample loading zone 21 to the last shearing zone 25 in sequence through the flow channels, and the flow channel of the amplification zone 23 is a paper passage without hydrophobic walls in the middle.
[0077] The sample loading zone 21, the delay zone 22, the amplification zone 23, the cutoff zone 24 and the shearing zone 25 are connected by Figure 2 The flow channel is prepared by first using tape to paste the bottom of the paper, and then using markers to draw hydrophobic walls on the paper substrate to control the direction of liquid flow. When the pattern is simple, a ruler can be used to draw the pattern manually. When the pattern is complex, a computer can be used to design the pattern, and a plotter can be used to install markers to assist in drawing.
[0078] Preferably, the markers used to draw the hydrophobic walls are markers using ink containing adhesive components, such as Dali ink double-head markers, Sharpie metal color markers, and the like.
[0079] Preferably, the delay zone can be drawn by using markers using ink not containing adhesive components, such as the ink not containing adhesive components used by Sharipie ultra-fine markers. The width of the delay zone is about 3-6 mm, and the length of the flow channel between each region is about 5-10 mm. The length of the delay zone is determined by the length of the required delay valve.
[0080] The delay zone 22 and the cutoff zone 24 are prepared by using markers to draw delay valves in the flow channel region. By drawing delay valves of different lengths, different delay times can be obtained.
[0081] The principle of the delay valve is that when the liquid in front of the delay valve has sufficient volume, the liquid will slowly enter the delay valve area to realize the delay flow function of the liquid, and when the liquid in front of the valve does not have sufficient volume, the liquid in front of the delay valve cannot generate sufficient pressure to force the liquid at the delay valve to enter the delay valve. At this time, regardless of the length of the delay valve, the delay valve will play a role in stopping the movement of the liquid, so the length of the delay valve can be as short as possible. In order to separate the description of the delay valve in the delay area, the delay valve in the cutoff area is described as a cutoff valve.
[0082] Preferably, the marker pen for drawing the delay valve is a marker pen using ink without adhesive components, such as Sharpie ultra-fine marker pen, etc.
[0083] Preferably, the drawing length of the delay valve is determined by the required delay time, and the length of the cutoff valve is 0.5-2mm.
[0084] The expansion area 23 and the shear area 25 refer to Figure 1 The flow layer is provided with a square paper sheet with lyophilized powder pre-embedded, wherein the expansion area is a square paper sheet with a side length of 5mm, which can connect the two ends of the paper channel after being placed. The shear area is a single square paper sheet with a side length of 10mm.
[0085] In one embodiment, the shear paper sheet 25 is first soaked with 5% BSA protein solution for 1h, then washed with RNase water, and then dried in a blast oven at 50°C for 4h for standby. After drying, the paper sheet is taken out, 1μL of 1μM LbCas12a, 100nM crRNA, 0.5μL of RNase inhibitor, 2μL of 10×NEBuffer 3.0, 500nM FAM-BHQ1-labeled ssDNA reporter are added and mixed, and then added dropwise on the paper sheet. The FAM-BHQ1-labeled ssDNA reporter is synthesized by Thermo Fisher Company. After the reagent is added dropwise, the two kinds of paper sheets are sealed with a culture dish in the dark and stored in a-80°C refrigerator (at least 12h), and then dried in a freeze dryer at-50°C for 4h. After freeze-drying, take out and store in a refrigerator at-20°C. When needed, take it out again.
[0086] In one embodiment, the paper sheet 23 in the amplification zone is first soaked in 1-5% BSA protein solution for at least 1 h, then washed with RNase water and dried in a blast oven for at least 4 h, then 2.5 μL of RDA mix amplification reagent is added, and stored in a -80°C refrigerator (at least 12 h), and then dried in a freeze dryer at -50°C for 4 h. After freeze-drying, take out and store in a refrigerator at -20°C, and take out when needed. The remaining reagents in the RDA amplification system can be freeze-dried in the chip amplification area, or added to the detection sample according to the system ratio and directly added to the reagents after the addition of the sample. The two paper sheets are sealed in a culture dish.
[0087] Preferably, the paper material of the amplification zone and the cutting zone is Whatman Grade 1 test paper, and more preferably, the paper material of the amplification zone can be replaced by GF / D glass fiber to improve the amplification efficiency.
[0088] Preferably, the square paper sheet 23 in the amplification zone has a side length of 5 mm to ensure that the reaction volume of the amplification zone is 25 μL. The square paper sheet 25 placed in the cutting zone has a side length of 10 mm to ensure that the reaction volume of the cutting zone is 20 μL.
[0089] The sealing layers 31 and 32 are referred to Figure 1 A circular sample addition hole is provided at the center of the sample addition zone 21 and the amplification zone 23 corresponding to the flow layer, which is used to add reagents and samples for reaction.
[0090] Preferably, the size of the sample addition hole on the sealing layers 31 and 32 is 1-4 mm, and more preferably 2 mm.
[0091] Preferably, the materials of the base layer 1 and the sealing layers 31 and 32 are plastic adhesive tapes, such as 3M 3036 packaging adhesive tape, 3M 3850-60 adhesive tape, etc.
[0092] The base layer 1, the flow layer 20, and the sealing layers 31 and 32 are aligned and bonded in the regions after being respectively manufactured.
[0093] In one embodiment, the base layer 1 is manufactured by using Bostik waterproof adhesive tape on 3M Scotch 3850-60 adhesive tape, as shown in Figure 1 The height difference between the Bostik waterproof adhesive tape and the 3M Scotch 3850-60 adhesive tape is used to manufacture the corresponding shape and the step structure on the base layer 1 by using scissors or other die-cutting equipment, and the height of the step structure is about 1 mm.
[0094] The sealing layers 31 and 32 are made of 3M Scotch 3850-60 tape, and the corresponding shapes are made by scissors or other die-cutting equipment, and the through holes in the corresponding positions are processed by a punch or other punching equipment. The sealing layers 31 and 32 are provided with circular sample addition holes in the center positions of the sample addition area 21 and the amplification area 23 corresponding to the flow layer 20, and the size of the sample addition hole is 2 mm.
[0095] The 3M Scotch 3850-60 tape is pasted on the bottom of the Kimtech KimWipes dust-free paper, and a hydrophobic wall is drawn on the paper by using a Sharipie metal colored marker to obtain the flow channel of the flow layer 20, so as to control the direction of liquid flow. The width of the flow channel is 5 mm, the length of the flow channel between each area is 10 mm, and the length of the flow channel of the delay area 22 is 70 mm. The end of the flow channel of the delay area 22 is connected to the amplification area paper sheet 27 with an overlap of about 1-2 mm, which facilitates the flow of liquid from the delay area 22 to the amplification area 23. The overlap part is not pasted by using the 3M Scotch 3850-60 tape.
[0096] In an embodiment, the delay valve is drawn on the previously drawn paper chip flow channel by using a Sharpie ultra-fine marker. The length of the delay valve in the delay area 22 is 60 mm, and the length of the delay valve in the cutoff area 24 is 0.5 mm, so as to ensure that the liquid flow time of the delay area 22 is about 30-50 min.
[0097] In an embodiment, the paper sheet pre-embedded with a shearing reagent freeze-dried powder is placed in the shearing area 25 and connected to the end of the flow channel of the cutoff area 24, and the paper sheet pre-embedded with an amplification reagent freeze-dried powder is placed at the square pool structure of the amplification area 23.
[0098] After the base layer 1, the flow layer 20, and the sealing layers 31 and 32 are respectively made, they are aligned in the area positions and then bonded.
[0099] Preferably, the novel coronavirus rapid detection method according to the present application is a fluorescence detection scheme combined with a recombinant polymerase amplification technology and a CRISPR / Cas12a gene editing technology. The principle is that the concentration of a target gene fragment in a nucleic acid sample is amplified by an amplification technology, and then the target gene can activate the Cas12a protein activity in a CRISPR / Cas12a shearing system. The activated Cas12a can non-specifically shear a single-stranded DNA reporter molecule in the system. The reporter molecule is modified with a fluorescence emitting group and a quenching group at both ends, respectively. Once the reporter molecule is sheared, a corresponding fluorescence signal is generated. By comparing the strength of the fluorescence signal, it can be judged whether the target nucleic acid sample contains a target gene sequence of the novel coronavirus.
[0100] The following embodiments are merely examples illustrating implementation schemes of the present invention and do not constitute any limitation on the present invention. Those skilled in the art will understand that modifications that do not depart from the spirit and concept of the present invention fall within the protection scope of the present invention. Unless otherwise specified, the reagents and instruments used in the following embodiments are all commercially available products, and the samples and probes containing specific nucleic acid sequences used are all synthesized by commercial companies after the corresponding sequences have been designed.
[0101] Example
[0102] Unless otherwise specified, the test methods in the following examples are generally performed under standard experimental conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used are commercially available.
[0103] The Whatman Grade 1 filter paper and GF / D filter paper used in this invention embodiment are from Cytiva, the Kimtech KimWipes series paper is from Kimberly-Clark, the Sharipie metallic marker and ultra-fine marker are from Sharpie, the 3M 3036 tape and 3M 3850-60 tape are from 3M, the Bostik tape is from Lattice Rubber, the plotter is from Silhouette, the hole punch is from Deli, the primers and crRNA were designed in-house and synthesized by Shanghai Jierui Biotechnology Co., Ltd., and the fluorescent quenching labeled single-stranded DNA reporter molecule was synthesized by Thermo Fisher Scientific. The RDA amplification reagents used are from Guangzhou Megvii Biotechnology Co., Ltd.'s basic RDA amplification kit, and the RNACleanup Kit and HiScribe kit are also used. TM The T7 High Yield RNA Synthesis Kit, LbaCas12 protein, and NEB Buffer 3.0 reagents were from NEB Corporation. The DNase I kit used was from TaKaRa Corporation, and the BSA protein used was from Sigma-Aldrich Corporation. The RNase water used was from Biosharp Corporation, the freeze dryer used was from Labconco Corporation, and the fluorescence microscope and its accompanying image acquisition CCD used were from Olympus Corporation of Japan.
[0104] Manufacturing Example 1: Fabrication of Paper-Based Microfluidic Chips
[0105] like Figures 1-2 As shown, paper-based microfluidic chips are manufactured using the following method.
[0106] The base layer 1 was made by pasting Bostik waterproof tape on 3M Scotch 3850-60 tape, as shown in Figure 1 The corresponding shape and the step structure on the base layer 1 were made by scissors or other die-cutting equipment using the height difference of Bostik waterproof tape and 3M Scotch 3850-60 tape, and the height of the step structure was about 1 mm, as shown in
[0107] The sealing layers 31 and 32 were made by 3M Scotch 3850-60 tape, and the corresponding shape was made by scissors or other die-cutting equipment, and then the through holes in the corresponding positions were processed by a puncher or other punching equipment. The sealing layers 31 and 32 were provided with circular sample adding holes in the center positions of the sample adding area 21 and the amplification area 23 corresponding to the flow layer 20, and the size of the sample adding hole was 2 mm.
[0108] The flow channel of the flow layer 20 was obtained by pasting 3M Scotch 3850-60 tape on the bottom of Kimtech KimWipes dust-free paper and drawing the hydrophobic wall on the paper using a Sharipie metal colored marker pen to control the direction of liquid flow. The width of the flow channel was 5 mm, the length of the flow channel between each area was 10 mm, and the length of the flow channel of the delay area 22 was 70 mm. The end of the flow channel of the delay area 22 was connected to the paper sheet 27 of the amplification area 23 with an overlap of about 1-2 mm, which facilitated the flow of liquid from the delay area 22 to the amplification area 23. The overlap was not pasted with 3M Scotch 3850-60 tape.
[0109] The delay valve was drawn on the previously drawn paper chip flow channel using a Sharpie fine marker pen. The length of the delay valve in the delay area 22 was 60 mm, and the length of the delay valve in the cutoff area 24 was 0.5 mm, so as to ensure that the liquid flow time of the delay area 22 was about 30-50 min.
[0110] The paper sheet pre-embedded with the shearing reagent freeze-dried powder was placed in the shearing area 25 and connected to the end of the flow channel of the cutoff area 24, and the paper sheet pre-embedded with the amplification reagent freeze-dried powder was placed at the square pool structure of the amplification area 23. The paper sheet pre-embedded with the shearing reagent freeze-dried powder and the paper sheet pre-embedded with the amplification reagent freeze-dried powder were prepared as in Example 1 below.
[0111] After the base layer 1, the flow layer 20, and the sealing layers 31 and 32 were respectively made, they were aligned in position and then bonded.
[0112] Example 1: Detection of new coronavirus N gene target using a paper-based microfluidic chip
[0113] In the embodiment of the application, the CRISPR / Cas12a and RT-RAA amplification technology are used to rapidly detect the nucleic acid of the N gene sequence of the new coronavirus, which includes the following steps:
[0114] 1) Screening of conservative specific target sequence
[0115] The non-mutant and mutant genome sequences of the new coronavirus recorded in the NCBI database, other coronavirus genome sequences, and human influenza virus genome sequences are analyzed by using NCBI BLAST and Perl language programs to obtain the conservative specific sequence of the new coronavirus. In this embodiment, the N501 gene (codon AAT) is selected as the detection target. According to the recognition characteristics of Cas12a / crRNA to DNA sequences, a series of target points meeting the requirements are selected, and the sequence with the strongest detection signal is selected as the target sequence of Cas12a / crRNA through experiments. In this embodiment, the crRNA sequence is UUUCcaUcccacuaaugguguu.
[0116] 2) Preparation of lyophilized cleavage reagent paper sheet pre-embedded in cleavage region
[0117] The crRNA transcription template is obtained by PCR amplification of the synthesized crRNA expression plasmid, and then in vitro transcription and purification are performed to obtain the required crRNA for detection.
[0118] Specifically, the method for in vitro transcription of crRNA is as follows: 1.5 μL of NTP, 1.5 μL of 10×reaction buffer, 1 μg of Template DNA, 1.5 μL of T7 RNA Polymerase Mix, and Nuclease-free water are added to 20 μL, and the reaction is carried out at 37°C for 16 h.
[0119] Specifically, the purification method of the crRNA transcription product is as follows: after the transcription product is treated with DNase I (TaKaRa) for 15 min, the NEB RNA Cleanup Kit or other RNA purification kit is used to purify the crRNA after transcription.
[0120] The pre-embedded shearing reagent paper sheet is a single square paper sheet with a side length of 10 mm made of Whatman 1# filter paper. First, it is soaked in a 5% BSA protein solution for 1 h, then washed with RNase water and dried in a blast oven at 50°C for 4 h for standby. After drying, the paper sheet is taken out, 1 μL of 1 μM LbCas12a protein, 100 nM crRNA, 0.5 μL of RNase inhibitor, 2 μL of 10x NEBuffer 3.0, and 500 nM of FAM-BHQ1-labeled ssDNA reporter are added to a centrifugal tube, mixed, and then added dropwise to the 12 mm paper sheet. The FAM-BHQ1-labeled ssDNA reporter is synthesized by Thermo Fisher Company, and its structure is a 12-base random single-stranded DNA molecule with FAM and BHQ1 groups at both ends, 5'-FAM-NNNNNNNNNNNN-BHQ1-3'.
[0121] After adding the shearing reagent, the paper sheet is sealed in a culture dish and stored in a -80°C freezer (at least 12 h), and then dried in a freeze dryer at -50°C for 4 h. After freeze-drying, it is taken out and stored in a refrigerator at -20°C. When needed, it is taken out again. Reference Figure 2 The pre-embedded freeze-dried shearing reagent paper sheet should be placed in the shearing zone 25 and connected to the end of the flow channel of the cutoff zone 24.
[0122] 3) Preparation of pre-embedded freeze-dried amplification reagent paper sheet in the amplification zone
[0123] Based on the published coronavirus genome (genomic sequence information from GISAID coronavirus sequences submitted by various countries (as of January 13, 2021), a total of 360482 sequences. https: / / www.gisaid.org / )), a relatively conservative and specific region near the N gene target was selected as the primer for RDA amplification reaction. The RDA primer is selected from sequences with low mutation frequency (less than one thousandth) by high-throughput sequence alignment of coronavirus, and sequences with good amplification efficiency and high specificity are selected and verified as RDA primers according to the RDA primer design principle. The primers used in this embodiment include RDA-primer-F with the sequence cctgtatagattgtttaggaagtctaatctc and RDA-primer-R with the sequence cctgttaaaccattgaagttgaaattgacac. To ensure the stability of the freeze-dried amplification reagent during long-term storage, the RDA amplification system is pre-embedded on a single square paper sheet made of GF / D filter paper with a side length of 5 mm.
[0124] The paper sheet is first soaked in 5% BSA protein solution for 1 h, washed with RNase water, and dried in a blast oven at 50°C for 4 h for standby. After drying, the paper sheet is taken out, 2.5 μl of RDA mix reagent is added to the paper sheet, the culture dish is sealed, and stored in a freezer at -80°C (for at least 12 h), and then dried in a freeze dryer at -50°C for 4 h. After freeze-drying, the paper sheet is taken out and stored in a refrigerator at -20°C. When needed, the paper sheet is taken out again.
[0125] Reference Figure 2 After the pre-embedding of the 5 mm paper sheet is completed, the paper sheet is placed in the center of the amplification area 23 to ensure that the liquid flowing through the delay area 22 can continue to flow to the cutoff area 24 and the shearing area 25 from the amplification area 23.
[0126] 4) The prepared 10^-10M concentration of pUC-57N gene target plasmid (9.25 μL) and primers (2 μL), RDA buffer (11.25 μL), and ddH2O (2.5 μL) are added to the sample well of the sealing layer 32, and the sample well is sealed with a PCR sealing film. At the same time, another chip is prepared with 11.75 μL of DEPC water, 2 μL of primers, and 11.25 μL of RDA buffer as a negative control group to verify the specificity of chip detection. The nucleic acid sample to be detected can be extracted from a clinical sample, or processed by other nucleic acid detection methods, or artificially synthesized nucleic acid fragments such as plasmids.
[0127] 5) 300 μL of RNase water containing 0.1% Tween-20 is added to the sample well of the sealing layer 31.
[0128] 6) The chip is placed on a heating plate for incubation at 37°C for 2 h. At this time, the nucleic acid sample is incubated and amplified on the paper sheet pre-embedded with freeze-dried amplification reagents in the amplification area. The sample liquid is restricted by the flow valves at both ends and cannot diffuse to the two side areas.
[0129] 7) The RNase water containing 0.1% Tween-20 in the sample area flows to the delay area and flows to the amplification area after about 30-40 min. The liquid reaching the amplification area drives the original sample liquid in the amplification area to break through the cutoff valve of the cutoff area and reach the shearing area.
[0130] 8) After the amplification of the sample is completed, the sample flows to the shearing area and incubates for 40 min to complete the shearing reaction.
[0131] 9) The chip is taken out, and a fluorescence module with an excitation light wavelength of blue light and an emission light wavelength of green light is used to observe the fluorescence intensity of the paper under a fluorescence microscope and take a fluorescence picture.
[0132] 10) The pictures taken are processed using image processing software image J. First, the image is separated into independent channel color gray scale images using RGB three channels. Then, the G channel color gray scale image is selected, and the average gray scale of the paper sheet position in the picture is calculated. For example, Figure 3 and Figure 4 As shown in the gray scale fluorescence images of the plasmid group and the negative group in two independent experiments, there is a significant difference in the overall fluorescence brightness between the negative group and the positive group, and the gray scale values are significantly different, as shown in Figure 4 Therefore, the technical scheme provided by the present application can realize the detection of the new coronavirus N gene target.
[0133] The above embodiments are preferred embodiments of the present application, but the embodiments of the present application are not limited by the above embodiments, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement methods, and shall be included in the protection scope of the present application.
Claims
1. A disposable paper-based microfluidic chip, the chip comprising, from bottom to top, a substrate layer, a flow layer, and a sealing layer. in, The base layer serves as a support and seal for the bottom. The flow layer provides channels for liquid flow within the chip and controls the flow of liquid within the chip. The flow layer is sequentially divided into a sample application zone, a delay zone, an amplification zone, a cutoff zone, and a shearing zone. The flow layer includes a substrate material and paper discs pre-embedded with lyophilized amplification reagent powder and lyophilized shearing reagent powder. The amplification zone and the shearing zone respectively house the paper discs pre-embedded with lyophilized amplification reagent powder and the paper discs pre-embedded with lyophilized shearing reagent powder. The sample application zone receives and retains the sample liquid. The delay zone slows down the flow of liquid from the sample application zone, allowing the flowing liquid to pass through for a predetermined time. Then it reaches the next area; the amplification area receives nucleic acid samples to amplify the nucleic acids in the samples, and the amplification area has a square pool structure that can hold lyophilized paper discs containing amplification reagents; the cutoff area is used to stop the liquid in the amplification area from flowing to the next area in advance, and the liquid is only allowed to move to the next area after the liquid in the delay area reaches the amplification area; the shearing area is used to specifically shear the nucleic acid samples flowing from the amplification area and release a fluorescent signal to show the detection results. The sample loading area, delay area, amplification area, cutoff area and shearing area are all connected by flow channels, and the liquid moves sequentially from the reagent loading area to the final shearing area through the flow channels. The sealing layer serves as a sealing top, and the sealing layer is provided with a sample well area for adding the nucleic acid sample to the amplification area and a sample well area for adding the sample liquid to the sample well. in: The base layer is made of adhesive tape, and a corresponding stepped structure is fabricated at the corresponding position of the amplification area. The base material of the flow layer includes a paper product, hydrophobic walls formed by a hydrophobic ink material containing adhesive components used on both sides of the paper product in a direction parallel to the direction of liquid movement in the flow channel, a flow channel region formed between the two hydrophobic walls, a hydrophobic ink material without adhesive components used in the delay area of the flow channel region, and an encapsulation tape material applied to the base layer. The sample loading area, delay area, amplification area, cutoff area, and shearing area are all connected by rectangular flow channels. The liquid flows sequentially from the reagent loading area to the final shearing area through the flow channels. The flow channel of the amplification area is a non-hydrophobic paper channel with a break in the middle. The position where the flow channel of the amplification area is broken on the flow layer substrate material is filled by a paper sheet with pre-embedded lyophilized powder to continue the flow of liquid. At the same time, it can also ensure that there is no large height difference between the substrate layer and the sealing layer, so as not to affect the sealing of the chip. The delay zone and the cutoff zone are obtained by drawing the delay valve in the flow channel area using a marker to obtain the delay time.
2. The disposable paper-based microfluidic chip according to claim 1, wherein, The encapsulation tape material is applied, in whole or in part, to the flow layer.
3. The disposable paper-based microfluidic chip according to claim 2, wherein, The encapsulation tape material is not applied to the overlapping portion of the delay region and the amplification region.
4. The disposable paper-based microfluidic chip according to claim 1, wherein, The paper products include Kimtech KimWipes series paper, Whatman Grade series test papers, and Whatman GF series filter paper; the hydrophobic ink materials used to form hydrophobic walls include adhesive-containing inks used in Sharipie metallic markers; the adhesive-free hydrophobic ink materials include adhesive-free inks used in Sharipie ultra-fine markers; the encapsulation tape materials include 3M Scotch 3850 series tapes; and / or The marker used to draw the delay valve is a marker made with hydrophobic ink material that does not contain adhesive components.
5. The disposable paper-based microfluidic chip according to claim 4, wherein, The marker used to draw the delay valve was a Sharpie ultrafine marker.
6. The disposable paper-based microfluidic chip according to claim 4, wherein, The length of the delay valve in the delay zone is determined by the required delay time, while the length of the delay valve in the cutoff zone is 0.5-2 mm.
7. The disposable paper-based microfluidic chip according to claim 1, wherein, The amplification zone and the shearing zone are respectively provided with paper sheets pre-embedded with lyophilized amplification reagent powder and lyophilized shearing reagent powder in the flow layer. The amplification zone is a single paper sheet, and the paper sheet can connect the two ends of the paper channel that is broken in the middle after it is placed. The shearing zone is a single paper sheet.
8. The disposable paper-based microfluidic chip according to claim 7, wherein, The paper embedded in the amplification or shearing zone is made of Whatman Grade 1 test paper or GF / D glass fiber.
9. The disposable paper-based microfluidic chip according to any one of claims 1-8, in, The paper discs pre-embedded with lyophilized shearing reagent powder are prepared by the following method: the paper discs are first soaked in 1-5% BSA protein solution for at least 1 hour, rinsed with RNase water, and then dried in a forced-air oven for at least 4 hours. Then, 5 μL of shearing reagent is added and the paper discs are dried using a freeze dryer so that the reagent is evenly distributed on the surface and inside of the paper discs in the form of lyophilized powder. The shearing reagent includes LbCas12a protein, RNase inhibitor, crRNA, NEB buffer 3.0, and fluorescent reporter single-stranded DNA molecules. and / or The paper disc pre-embedded with lyophilized amplification reagent powder is prepared by the following method: the paper disc is first soaked in 1-5% BSA protein solution for at least 1 hour, rinsed with RNase water, and then dried in a forced-air oven for at least 4 hours. Then, 2.5 μL of RDA mix amplification reagent is added, and the disc is dried using a freeze dryer so that the amplification reagent is evenly distributed on the surface and inside of the paper disc in the form of lyophilized powder. The remaining reagents in the RDA amplification system are lyophilized in the chip amplification area, or added directly to the detection sample according to the system ratio.
10. The disposable paper-based microfluidic chip according to claim 9, in, The pre-embedded shearing reagent paper discs are single square paper discs with a side length of 10 mm. They are first soaked in 1-5% BSA protein solution for at least 1 h, rinsed with RNase water, and then dried in a forced-air oven at 50°C for at least 4 h for later use. After drying, the paper discs are removed, and 1 μL of 1 μM LbCas12a protein, 100 nM crRNA, 0.5 µL of RNase inhibitor, 2 μL of 10 × NEBuffer 3.0, and 500 nM FAM-BHQ1-labeled ssDNA reporter are added to a centrifuge tube and mixed well. The mixture is then dropped onto the 12 mm paper discs. After the reagents are added, both types of paper discs are sealed in petri dishes to protect them from light and frozen at -80°C. Then, they are freeze-dried at -50°C for at least 4 h and then stored at -20°C. The process involves first soaking the pre-embedded amplification reagent paper in 1-5% BSA protein solution for at least 1 hour, rinsing it with RNase water, drying it in a forced-air oven for at least 4 hours, then adding 2.5 μL of RDA mix amplification reagent, sealing it in a petri dish, and freezing it at -80°C. Then, it is freeze-dried at -50°C for at least 4 hours. After freeze-drying, it is removed and stored at -20°C.
11. The disposable paper-based microfluidic chip according to claim 10, wherein, The square paper disc for the amplification region has a side length of 5 mm to ensure a reaction volume of 25 μL; the square paper disc for the shearing region has a side length of 10 mm to ensure a reaction volume of 20 μL.
12. A method for preparing a paper-based microfluidic chip as described in any one of claims 1-11, comprising the following steps: S1, using plastic tape as a base layer and sealing layer, wherein the sealing layer has a circular sample loading hole at the center of the sample loading area and amplification area of the corresponding flow layer. The base layer and sealing layer need to be made into the corresponding shapes by scissors first, and then the through holes at the corresponding positions are processed by a hole punch. There is a stepped structure made of tape of different thicknesses on the base layer, and the structure is located at the junction of the amplification area and the delay area of the flow layer. S2, draw hydrophobic walls on the paper product of the base material of the flow layer to obtain the flow channel of the flow layer, thereby controlling the direction of liquid flow; S3, place the paper with the pre-embedded lyophilized shearing reagent powder at the end of the cutoff area and connect it with the flow channel, and place the paper with the pre-embedded lyophilized amplification reagent powder in the square pool structure of the amplification area, and ensure that the flow channel of the delay area is above the paper and the flow channel of the cutoff area is below the paper. S4. After the base layer, flow layer and sealing layer are fabricated, they are aligned vertically according to their respective regions and then bonded together.
13. The preparation method according to claim 12, wherein: In S1, the plastic tape is selected from 3M 3036 packaging tape, 3M Scotch 3850-60 tape, 3M Scotch Magic tape; and / or In S1, the sample well size is 1-4 mm; and / or In S1, the height dimension of the stepped structure is 0.5-2 mm; and / or In S1, the sample application area is a square region with a side length of 20-50 mm.
14. The preparation method according to claim 13, wherein, In S1, the size of the sample loading hole is 2mm.
15. The preparation method according to claim 13, wherein, In S1, the height dimension of the stepped structure is 1 mm.
16. The preparation method according to claim 13, wherein, In S1, the sample application area is a square region with a side length of 30 mm.
17. The preparation method according to claim 12, wherein: In S2, when the pattern is relatively simple, it is drawn manually using ruler and compass construction. When the pattern is relatively complex, it is designed on a computer and then drawn with the aid of a plotter. and / or In S2, a hydrophobic wall is drawn using a marker pen containing a hydrophobic ink material with adhesive components; and / or In S2, the width of the flow channel is about 3-6mm, the length of the flow channel between each region is about 5-10mm, and the length of the flow channel in the delay zone is determined by the length of the required delay valve.
18. The preparation method according to claim 17, wherein, The markers containing hydrophobic ink materials with adhesive components are Deli ink double-ended markers or Sharpie metallic markers.
19. The preparation method according to claim 12, wherein, In S3, The paper discs pre-embedded with lyophilized shearing reagent powder are prepared by the following method: the paper discs are first soaked in 1-5% BSA protein solution for at least 1 h, rinsed with RNase water and dried in a forced-air oven for at least 4 h, then 5 μL of shearing reagent is added and dried using a freeze dryer, so that the reagent is evenly distributed on the surface and inside of the paper disc in the form of lyophilized powder. The shearing reagent includes LbCas12a protein, RNase inhibitor, crRNA, NEB buffer 3.0 and fluorescent reporter single-stranded DNA molecules. and / or The paper disc pre-embedded with lyophilized amplification reagent powder is prepared by the following method: the paper disc is first soaked in 1-5% BSA protein solution for at least 1 h, rinsed with RNase water and dried in a forced-air oven for at least 4 h, then 2.5 μL of RDAmix reagent is added and dried using a freeze dryer so that the amplification reagent is evenly distributed on the surface and inside of the paper disc in the form of lyophilized powder.
20. A method of using the disposable paper-based microfluidic chip as described in any one of claims 1-11, comprising the following steps: 1) Add the prepared nucleic acid sample, primers, RDA buffer, and ddH2O to the sample wells in the amplification area, and seal the sample wells with PCR sealing film. The nucleic acid sample to be tested is nucleic acid extracted from clinical samples or artificially synthesized nucleic acid fragments containing targets. 2) Add RNase water containing 0.1% Tween-20 to the sample well in the sample application area; 3) Place the chip in a constant temperature incubator at 37°C for 1.5 h. At this time, the nucleic acid sample will be incubated and amplified on the paper with lyophilized amplification reagents pre-embedded in the amplification area for about 30 min. The sample liquid will be restricted by the flow valves at both ends and will not diffuse to the two sides. 4) The RNase water containing 0.1% Tween-20 in the sample loading area will flow to the delay area and then flow to the amplification area after about 30-40 minutes. The liquid that reaches the amplification area will drive the original sample liquid in the amplification area to break through the stop valve in the stop area and reach the shearing area. 5) After amplification, the sample is transferred to the shearing region and incubated for 40 min to complete the shearing reaction; 6) Remove the chip and photograph or read the fluorescence signal on the paper in the cut area using a fluorescence microscope.
Citation Information
Patent Citations
Nucleic acid detection method of digital micro-fluidic chip based on isothermal amplification and gene editing
CN110885877A
Method for detecting novel coronavirus based on gene editing and colloidal gold test strip
CN113156124A
Nucleic acid detection digital microfluidic operating system for isothermal amplification and gene editing
CN211367579U
Paper-based micro-fluidic analytical device of which signals can be amplified and preparation method of paper-based microfluidic analytical device
CN107570244A
Gene detection method based on CRISPR technology, kits and application
CN111944879A