Application of HbWUS Gene in Improving Genetic Transformation Efficiency of Hevea brasiliensis and Construction of Its Expression Vector

By constructing the overexpression vector of the HbWUS gene and performing genetic transformation, the problem of genotype-dependent genotype of the rubber dendrimer somatic embryogenesis is solved, the genetic transformation efficiency is significantly improved, and the regeneration and large-scale breeding of rubber dendrimers are promoted.

CN117143887BActive Publication Date: 2025-06-24RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311120356.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-31
Publication Date
2025-06-24
Estimated Expiration
2043-08-31

AI Technical Summary

Technical Problem

There is a serious genotype dependence in the somatogenesis and secondary somatogenesis of rubber tree, which limits the application of large-scale somatogenesis and genetic transformation technology in excellent varieties.

Method used

By constructing the overexpression vector of HbWUS gene, the genetic transformation efficiency of the somatic embryo of the dicotum leaf of rubber tree was improved by using Agrobacterium-mediated genetic transformation method.

Benefits of technology

It significantly improves the genetic transformation efficiency of callus embryos in rubber tree anther callus, promotes the growth of plant cells and the regeneration of body embryos, is easy to operate and efficient.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117143887B_ABST
    Figure CN117143887B_ABST
Patent Text Reader

Abstract

The present invention provides the application of the HbWUS gene in improving the genetic transformation efficiency of rubber trees and the construction of its expression vector, the application of the HbWUS gene in participating in the regulation of somatic embryogenesis in plants of the subfamily Crotonoideae, and the nucleotide sequence of the HbWUS gene is shown in SEQ ID NO:1. By constructing an overexpression vector of the HbWUS gene to genetically transform the dicotyledonous somatic embryos of rubber trees, the present invention can improve the genetic transformation efficiency of anther callus somatic embryos of rubber trees, and provides a candidate gene for the large-scale breeding technology of rubber tree somatic embryo seedlings and the application of genetic transformation technology in excellent varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of an HbWUS gene in improving genetic transformation efficiency of rubber trees and construction of an expression vector thereof. Background Art

[0002] my country was the first country in the world to utilize somatic and secondary somatic embryogenesis techniques from anther callus to cultivate fast-growing, high-yielding, and stress-resistant rubber tree somatic seedlings, achieving large-scale production. Furthermore, dicotyledonous somatic embryos derived from rubber tree anther calli are also excellent receptors for genetic transformation. However, somatic and secondary somatic embryogenesis from rubber tree anther callus are highly genotype-dependent, limiting the application of large-scale somatic seedling propagation and genetic transformation techniques in developing superior varieties. Wus is a key gene in plant stem cell development. Modulating its expression can effectively improve plant regeneration and genetic transformation efficiency, but there are no reports on the HbWUS gene in rubber trees improving the genetic transformation efficiency of rubber tree somatic embryos. Summary of the Invention

[0003] In view of this, the object of the present invention is to propose the application of the HbWUS gene in improving the genetic transformation efficiency of rubber tree and the construction of its expression vector. Somatic embryogenesis and secondary somatic embryogenesis derived from rubber tree anther callus are key steps in the in vitro breeding and genetic transformation of rubber tree, and somatic embryogenesis is heavily dependent on genotype. Wus is a key gene in plant stem cell development. By regulating the expression of this gene, the regeneration and genetic transformation efficiency of the plant can be effectively improved. The present invention proposes to genetically transform rubber tree dicotyledonous somatic embryos (abbreviated as somatic embryos) by constructing an overexpression vector of the HbWUS gene, which can improve the genetic transformation efficiency of rubber tree anther callus somatic embryos.

[0004] The technical solution of the present invention is achieved as follows:

[0005] One of the purposes of the present invention is to provide an application of the HbWUS gene, wherein the HbWUS gene is used to regulate somatic embryogenesis in plants of the Crotonoideae subfamily. The nucleotide sequence of the HbWUS gene is shown in SEQ ID NO: 1.

[0006] Furthermore, the HbWUS gene is used to increase the frequency of somatic embryo regeneration after genetic transformation of embryoids in plants of the Crotonoideae subfamily.

[0007] Furthermore, the plant of the subfamily Crotonoideae is a rubber tree.

[0008] Furthermore, dicotyledonous somatic embryos of rubber trees are selected.

[0009] Furthermore, dicotyledonous somatic embryos were obtained by anther induction culture.

[0010] A second object of the present invention is to provide a method for constructing an expression vector of the HbWUS gene, comprising the following steps:

[0011] S1 amplifies the nucleotide sequence of the HbWUS gene using primers to obtain the amplified target fragment;

[0012] S2 double-digested the pCambia1300-35S-cGF P-Tnos vector plasmid with XbaI and BamHI restriction endonucleases, ligated the digested vector with the amplified target fragment from step S1, and transformed and sequenced to obtain the pCambia1300-35S-HbWUS-GFP expression vector for the HbWUS gene.

[0013] A third object of the present invention is to provide a method for genetic transformation of rubber tree embryos mediated by Agrobacterium, comprising the steps of:

[0014] S1: Amplify the nucleotide sequence of the HbWUS gene using primers to obtain the amplified target fragment, double-digest the pCambia1300-35S-cGF P-Tnos vector plasmid using XbaI and BamHI restriction endonucleases, ligate the digested vector with the amplified target fragment from step S1, transform and sequence, and obtain the pCambia1300-35S-HbWUS-GFP expression vector for the HbWUS gene;

[0015] S2: Transform the pCambia1300-35S-HbWUS-GFP expression vector into Agrobacterium, place the cells in an ice bath for 20-40 minutes, treat with liquid nitrogen for 3-8 minutes, add to LB liquid medium, and culture at 27-29°C and 200-250 rpm for 4-5 hours. Spread the culture onto LB solid medium and culture at 27-29°C for 2-3 days. Pick out the positive single-clone Agrobacterium and add to LB liquid medium. Culture at 27-29°C and 200-250 rpm for 22-26 hours to obtain the Agrobacterium solution.

[0016] S3: Transfer the Agrobacterium solution into LB liquid medium, culture at 27-29°C and 200-250 rpm for 16-24 hours, centrifuge, collect the cells, resuspend the cells, adjust the OD600 value of the culture solution to 0.45-0.5, and culture at 27-29°C and 200-250 rpm for 3-5 hours to obtain the infection culture solution; each 1L of the resuspension solution contains 90-110 μM acetosyringone;

[0017] S4: Immerse the dicotyledonous somatic embryos of the rubber tree in the infected bacterial solution, let it stand, ultrasonicate it, let it stand again, and after absorbing the bacterial solution, place the dicotyledonous somatic embryos in HCK-12-AS medium, culture them at 21-23°C in the dark for 72-84 hours, wash them, soak them in sterile water containing timentin, and then transfer them to HCK-12-T medium. After incubation in the dark for at least 24 hours, cut the somatic embryos obtained by culture, transfer them to HCK-12-TH medium, culture them in the dark for 20-30 days, and then transfer them to embryo emergence medium HE-7 until embryos emerge;

[0018] The HCK-12-AS culture medium is as follows: 1 to 2 mL of acetosyringone is added to every 1 L of HCK-12;

[0019] The HCK-12-T culture medium is as follows: 1 to 2 mL of Timentin is added to every 1 L of HCK-12;

[0020] The HCK-12-TH culture medium is as follows: 1 to 2 mL of timentin and 150 to 250 μL of hygromycin are added to every 1 L of HCK-12.

[0021] Furthermore, in the HCK-12-AS medium, the concentration of acetosyringone is 90-110 mM, in the HCK-12-T medium, the mass concentration of timentin is 450-550 mg / mL, in the HCK-12-TH medium, the mass concentration of timentin is 450-550 mg / mL, and the mass concentration of hygromycin is 5-15 mg / mL.

[0022] Furthermore, the cultured somatic embryos are divided into two by longitudinal cutting along the mid-axis of the cotyledons, and then cut into somatic embryo blocks with a length×width of 3-4 mm×3-4 mm.

[0023] Furthermore, the mixture is allowed to stand for 5 to 10 minutes, ultrasonically treated for 40 to 60 seconds, and then allowed to stand for another 8 to 12 minutes.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The invention utilizes the overexpression of the HbWUS gene to improve the genetic transformation efficiency of rubber tree anther callus somatic embryos, promotes the growth of plant cells and the regeneration of somatic embryos, is easy to operate, and has high efficiency.

[0026] The present invention can effectively improve the regeneration and genetic transformation efficiency of rubber tree callus by constructing an overexpression vector of the HbWUS gene, and provides a candidate gene for the application of rubber tree embryo seedling large-scale breeding technology and genetic transformation technology in excellent varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1The phylogenetic tree constructed using WOX proteins from rubber tree, Arabidopsis thaliana, and rice (left part of the figure) and the distribution of conserved motifs of WOX proteins (right part of the figure);

[0028] Figure 2 The expression characteristics of HbWUS gene in rubber tree during somatic embryogenesis and development;

[0029] Figure 3 Figure 1 shows the genetic transformation efficiency of the HbWUS gene during somatic embryogenesis and development in rubber trees, and images of secondary somatic embryogenesis and development in rubber tree dicotyledonous somatic embryos. Figure A shows the enhanced somatic embryo regeneration efficiency achieved by overexpressing HbWUS in embryoids of rubber tree 'Reyan 7-33-97'. Statistical data are presented as mean ± standard deviation. Results are from 4-5 independent genetic transformation experiments. Student's t test was used for statistical significance (*, P < 0.05). Figure B shows the secondary somatic embryogenesis and development in rubber tree dicotyledonous somatic embryos overexpressing both GFP and HbWUS.

[0030] Figure 4 The figure shows PCR identification of HbWUS gene-overexpressing somatic embryos in rubber trees. A is a schematic diagram of primer design for PCR identification of HbWUS gene-overexpressing somatic embryos; B is an electrophoresis diagram of genomic-level identification of HbWUS gene-overexpressing somatic embryos using two pairs of primers; M is the DL2000 marker; 73397 is a non-transgenic Reyan 73397 rubber tree somatic embryo; 1-15 is a HbWUS gene-overexpressing resistant somatic embryo; P is the pCambia1300-35S-HbWUS-GFP expression vector; and W is water. DETAILED DESCRIPTION

[0031] In order to better understand the technical content of the present invention, specific examples are provided below to further illustrate the present invention.

[0032] Unless otherwise specified, the experimental methods used in the examples of the present invention are all conventional methods.

[0033] Unless otherwise specified, the materials, reagents, etc. used in the examples of the present invention can be obtained from commercial sources.

[0034] The HCK-12 of the present invention is a callus induction medium (containing auxin), and the HE-7 is a somatic embryo induction medium (not containing auxin).

[0035] Example 1 - Identification of the HbWUS gene and evolutionary analysis of WOX family genes

[0036] Using the protein sequences of Arabidopsis WOX family genes, BLAST analysis was performed one by one in the protein database in the rubber tree genome database to obtain all the WOX protein sequences of the rubber tree. The WOX protein sequences of rice were downloaded from the plant PLAZA database, and the neighbor-joining method in MEGA7.0 software was used to construct a phylogenetic tree; the conserved motifs of the rubber tree WOX family genes were analyzed using MEME (Multiple Em for Motif Elicitation) software. It was finally determined that there were 20 HbWOX proteins in the rubber tree, all of which contained a conserved Homeobox domain. Among them, XP_021672272.1 was clustered into a class with WUS in Arabidopsis and rice and named HbWUS ( Figure 1 ).

[0037] The nucleotide sequence of the HbWUS gene is shown in SEQ ID NO: 1:

[0038] ATGGAGCCTCAACAACAACAGCAAAACCAACAACAACCAAACGAGGACAATAGCAGCGGTGCTAAAGGAAGCTTTCTTTGCAGGCAAAGCAGTACAAGGTGGACTCCCACAACTGACCAGATAAGAATATTGAAGGATCTTTACTACAACAGTGGAGTTAGGTCCCCAAGTGCAGAGCAGATTCAGAGGATATCTGCTAGGCTTAGACAGTACGGTAAGATTGAAGGCAAGAATGTCTTTTATTGGTTTCAGAACCATAAAGCTCGTGAGAGGCAGAAGAAAAGGTTCACCACTGATGTCCCCATGCAACAAAGAACTGTTTCAAATGCTTCTAACTGGAAACCTGAAGATTATTCCTTTCACAACAAGCACCCCAACGTTACTCCTGGGTTTTCTTCTGCATCTCCATCCTCAGCTGGTGGGCTTACTGTTGGACAGATGGGAAACTATGGGTATGGATCTGTAAACATGGAGAAGAGTTTTAGGGACTGCTCAATATCAGCTAGTGCCAACAGTGGTGTTGGTGGATCTATGAACCCCAACTATGGGTGGGTTGGGATTGATCCCTACTGTTCATCTTATTCTTTCTTTGGCAAGCAAAAATCAAATAATGAAACCCTAGACGATGAAGAACAAGATCTAGGACAAGAAGAGGAAGCAACTCCAGAGATTGAAACTCTCCCTCTCTTCCCTACCCAGAGAGAAGACATCAATGGCTTCTGCAACATGAAGCACAAAACCATCTGCTACTCCCAAAACTACTGGTGTGGCTCTGACGATGGAAACAATACTTCGCGTACTTCCCTCGAGCTTAGCCTCAACTCCTACAGCACTGGGCAGGCACCGGATTCCATCTAA

[0039] Example 2 - Expression characteristics of HbWUS during somatic embryogenesis and development of anther callus in Hevea brasiliensis

[0040] By detecting the expression of HbWUS gene in callus materials of different stages of anther somatic embryogenesis and development of rubber tree 'Reyan 7-33-97', it was found that the expression trend of HbWUS was highly correlated with the process of somatic embryogenesis. The expression was gradually upregulated in the early stage of somatic embryogenesis and gradually downregulated after the formation of embryonic callus ( Figure 2 ).

[0041] Callus tissue was immediately frozen in liquid nitrogen. RNA was extracted using a Qiagen extraction kit, and reverse transcription was performed using Toyobo's ReverTra Ace qPCR RT Master Mix. 1 μg of RNA was heated at 65°C for 5 minutes and immediately placed on ice. 5× RT master mix and ddH2O were added to a final volume of 10 μL. Reverse transcription was performed as follows: 37°C for 15 minutes; 42°C for 15 minutes; and RT master mix at 98°C for 5 minutes. The cDNA product was diluted 10-fold by adding 90 μL of ddH2O. Relative quantification was performed using an ABI7500 real-time quantitative PCR instrument and the SYBR Green assay using primers 5'-CCCAACGTTACTCCTGGGTT-3' and 5'-CCCACCCATAGTTGGGGTTC-3'. Each experiment was performed with three biological replicates, and each RT-qPCR reaction was performed with three technical replicates. Hbactin7a was used as an internal reference gene.

[0042] Example 3-Construction of HbWUS overexpression vector and transformation of rubber tree embryos

[0043] To further investigate the function of HbWUS in rubber tree somatic embryogenesis and development, a 35S:HbWUS-GFP expression vector was constructed and overexpressed in dicotyledonous somatic embryos of rubber tree via Agrobacterium-mediated stable transformation.

[0044] Based on the nucleotide sequence of the HbWUS gene in Example 1, the following primer pairs were designed for amplification:

[0045] 5'-AGAACACCTGCAGGTCGACTCTAGAATGGAGCCTCAACAACAACAGCAA-3'

[0046] 5'-TGCTCACCATGGTACCCGGGGATCCCGCCGCCGCGATGGAATCCGGTGCCTGCC C-3',

[0047] The pCambia1300-35S-cGFP-Tnos vector plasmid was double-digested with restriction endonucleases XbaI and BamHI. The digested vector and the amplified target fragment were recovered and ligated using the NEBuilder HiFiDNA Assembly Master Mix kit. The resulting plasmid was transformed and sequenced to obtain the pCambia1300-35S-HbWUS-GFP expression vector for the HbWUS gene.

[0048] The constructed vectors pCambia1300-35S-HbWUS-GFP and pCambia1300-35S-GFP were transformed into EHA105 Agrobacterium, incubated on ice for 30 minutes, in liquid nitrogen for 5 minutes, and at 37°C for 5 minutes. 1 mL of LB liquid medium was added and cultured at 28°C and 220 rpm for 4-5 hours. 200 μL of the bacterial solution was transferred to LB solid medium supplemented with 20 mg / L Kana and Rif, evenly spread on the plate, and cultured in an inverted manner at 28°C for 2 days. Single clones were selected for verification, and the correct single clone Agrobacterium was transferred to 5 mL of LB liquid medium and cultured with shaking at 28°C and 220 rpm for 24 hours to preserve the bacteria for subsequent experiments.

[0049] Transfer 1 mL of the shaken bacterial suspension into 500 mL of liquid LB medium and culture at 28°C, shaking at 220 rpm for 16-24 hours. Collect the cells by centrifugation at 4000 rpm for 20 minutes. Resuspend the cells in a resuspension buffer (1 L of resuspension buffer containing 100 μM acetosyringone (AS), pH 5.8). Use a pipette to disperse the bacterial clumps and mix thoroughly. Adjust the OD value of the bacterial suspension. 600 The value was adjusted to 0.45-0.5, and the resuspension was cultured at 28°C and 220 rpm for 4 h and then used to infect rubber tree embryos immediately.

[0050] The infection operation of rubber tree embryo is as follows:

[0051] 1) Place dicotyledonous somatic embryos of rubber trees into the resuspension solution on a clean bench. Gently shake the cotyledonary embryos until the cotyledonary embryos are completely immersed in the resuspension solution. Let them stand for 8 minutes, then ultrasonicate them for 50 seconds, and let them stand for another 10 minutes.

[0052] 2) After completely absorbing the bacterial liquid from the somatic embryos with filter paper, place the embryos in HCK-12-AS medium (1 mL of 100 mM AS added to 1 L of HCK-12, pH = 5.8) and culture for 72-84 hours at 22°C in the dark.

[0053] 3) Rinse the embryos with sterile water until the water is clear, then soak them in sterile water containing timentin (1:1000) for 8 minutes. After blotting with filter paper, place them in HCK-12-T (HCK-12-T: 1 mL of 500 mg / mL timentin in 1 L of HCK-12) for at least 24 hours in the dark.

[0054] 4) Cut the somatic embryos into small pieces, first by cutting them in half longitudinally along the mid-axis of the cotyledons, and then by cutting them transversely into 3 mm long and wide pieces. Transfer them to HCK-12-TH medium (1 mL of 500 mg / mL timentin and 200 μL of 10 mg / mL hygromycin in 1 L of HCK-12, pH = 5.8) and culture them in the dark for about 25 days.

[0055] 5) Transfer the callus tissue to embryogenesis medium HE-7 until embryos emerge.

[0056] The empty vector of P1300-35S-GFP was used as a control to analyze the genetic transformation efficiency of P1300-35S-HbWUS-GFP and P1300-35S-GFP. The results showed that HbWUS gene can significantly improve the efficiency of somatic embryo regeneration after genetic transformation of embryoid bodies ( Figure 3 A and 3B), further clarifying that the HbWUS gene is involved in regulating the somatic embryogenesis of rubber trees and can be used to improve the genetic transformation efficiency of rubber tree somatic embryos. By identifying positive embryos at the genomic level, 14 embryo blocks stably transformed with the HbWUS gene were obtained ( Figure 4 ).

[0057] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of HbWUS gene, characterized in that, The application of the HbWUS gene in regulating somatic embryogenesis of the Crotonoideae plants, wherein the nucleotide sequence of the HbWUS gene is shown as SEQ ID NO:1; The application of the HbWUS gene in improving the somatic embryo regeneration frequency after genetic transformation of the Crotonoideae plants; The Crotonoideae plant is Hevea brasiliensis, and the variety of the Hevea brasiliensis is Reyan 7-33-97; The somatic embryo is a dicotyledonous somatic embryo of Hevea brasiliensis, and the dicotyledonous somatic embryo is obtained by anther induction culture; An Agrobacterium-mediated genetic transformation method for infecting somatic embryos of Hevea brasiliensis, comprising the following steps: S1 Amplify the nucleotide sequence of the HbWUS gene using primers to obtain an amplified target fragment. Double digest the pCambia1300-35S-cGFP-Tnos vector plasmid with XbaI and BamHI restriction endonucleases, ligate the digested vector with the amplified target fragment in step S1, transform and verify by sequencing to obtain the pCambia1300-35S-HbWUS-GFP expression vector of the HbWUS gene; S2 Transfer the pCambia1300-35S-HbWUS-GFP expression vector into Agrobacterium, ice-bath for 20-40 min, treat with liquid nitrogen for 3-8 min, add LB liquid medium, culture at 27-29 °C and 200-250 rpm for 4-5 h, spread the cultured bacterial liquid onto LB solid medium, culture at 27-29 °C for 2-3 d, pick positive monoclonal Agrobacterium, add LB liquid medium, culture at 27-29 °C and 200-250 rpm for 22-26 h to obtain Agrobacterium liquid; Transfer the Agrobacterium liquid into LB liquid medium, culture at 27 - 29 °C and 200 - 250 rpm for 16 - 24 h, centrifuge, collect the bacterial cells, resuspend the bacterial cells with the resuspension solution, and adjust the OD 600 value of the bacterial liquid to 0.45 - 0.5, culture at 27 - 29 °C and 200 - 250 rpm for 3 - 5 h to obtain the infection bacterial liquid; each 1 L of the resuspension solution contains 90 - 110 μM of acetosyringone; S4 Immerse the dicotyledonous somatic embryos of Hevea brasiliensis in the infection bacterial liquid, let stand, perform ultrasonic treatment and then let stand again. After sucking off the bacterial liquid, put the dicotyledonous somatic embryos into HCK-12-AS medium, culture at 21-23 °C in the dark for 72-84 h, wash, soak in sterilized water containing ticarcillin, then transfer to HCK-12-T medium, culture in the dark for at least 24 h, cut the cultured somatic embryos, longitudinally cut them in half along the cotyledon central axis, and then cut them into somatic embryo blocks with a length×width of 3-4 mm×3-4 mm and transfer them into HCK-12-T-H medium, culture in the dark for 20-30 d, and transfer to embryo induction medium HE-7 until embryos emerge; The HCK-12-AS medium is: add 1-2 mL of acetosyringone with a concentration of 90-110 mM to every 1 L of HCK-12; The HCK-12-T medium is: add 1-2 mL of ticarcillin with a concentration of 450-550 mg / mL to every 1 L of HCK-12; The HCK-12-T-H medium is: add 1-2 mL of ticarcillin with a concentration of 450-550 mg / mL and 150-250 μL of hygromycin with a concentration of 5-15 mg / mL to every 1 L of HCK-12.

2. Use of an HbWUS gene according to claim 1, characterized in that, Let stand for 5-10 min, perform ultrasonic treatment for 40-60 s and then let stand for 8-12 min.

Citation Information

Patent Citations

  • Method of promoting generation of lateral buds of Heveabrasiliensis by trans-AtWUS (Arabidopsisthaliana WUSCHEL) gene

    CN104031936A